Anti-aging short peptide and preparation method thereof

Abstract

The present invention belongs to the field of genetic engineering technology, and specifically relates to anti-aging short peptides and methods for preparing the same. The present invention provides a short peptide, the amino acid sequence of which comprises the sequence shown in SEQ ID No. 1. The present invention also provides a polynucleotide encoding the peptide, a recombinant expression vector comprising the polynucleotide, a recombinant host cell comprising the recombinant expression vector, a method for producing the peptide, and tissue engineering products, cosmetics or medicines with anti-aging functions comprising the peptide, as well as uses of the peptide in the preparation of anti-aging products. The anti-aging short peptide of the present invention has a simple production process and low cost, and can bring anti-aging skin nutrition products closer to the daily lives of the people, with broad market application prospects.

Description

[0001] Priority and related applications

[0002] This application claims priority to the Chinese patent application filed with the China Patent Office on June 15, 2022, with application number 202210681922.8 and invention name “Anti-aging short peptides and preparation methods thereof”, the entire contents of which are incorporated by reference into this application. Technical Field

[0003] The present invention relates to the field of genetic engineering, and in particular to an anti-aging short peptide and a preparation method thereof. Background Art

[0004] The skin of humans and higher animals is composed of the epidermis, dermis, and subcutaneous tissue. The epidermis lacks blood vessels, so cellular energy and nutrients must be supplied by the dermal microcirculation. The dermis, the skin's lifeblood, is a dense, tough, and elastic layer of tissue primarily composed of fibrous components (collagen, elastin, and reticular fibers), glycoproteins, glucosamine, and hyaluronic acid. Hyaluronic acid is a transparent, gelatinous substance with a water absorption capacity of 500-1000 times its original value, making it recognized as the best moisturizer. Young skin, with a high hyaluronic acid content, is smooth, elastic, supple, and plump. As skin ages, the dermis thins, reducing the interface for material exchange between the dermis and epidermis. This hinders normal cellular metabolism and mitosis, leading to skin atrophy and wrinkles. Therefore, anti-aging efforts begin by replenishing dermal nutrients (such as collagen and hyaluronic acid). Collagen complements the basement membrane, facilitating the connection between the epidermis and dermis, and transporting water and nutrients to the dermis. Therefore, if the collagen in human skin can be supplemented, it will be able to effectively combat the problem of skin aging.

[0005] Pentapeptide-3, also known as a five-ring short peptide or five-moon peptide, is a synthetic short peptide developed and produced by the renowned French cosmetics company Sederma. It effectively promotes the proliferation of hyaluronic acid, collagen, and elastin fibers, reducing fine lines, increasing skin hydration, enhancing skin thickness, and enhancing skin firmness and radiance. It is a compound derived from the combination of collagen I fragments and palmitic acid, resulting in a more skin-friendly, hydrophilic, and water-binding substance. Studies have shown that adding pentapeptide-3 to fibroblast culture plates can enhance the synthesis of collagen I, VII (fibrous collagen), and fibronectin, and also promote the production of important components such as collagen and hyaluronic acid by fibroblasts within the epidermis. Therefore, pentapeptide-3 plays a significant role in alleviating skin aging. In vitro tests have shown that Pentapeptide-3 Palmitate can rapidly activate collagen IV synthesis by 100% to 327% and hyaluronic acid synthesis by 267%. Today, this short peptide is widely used in cosmetics from many well-known brands.

[0006] Currently, many well-known cosmetic brands in many countries have added palmitic acid pentapeptide-3 to their product lines as an anti-aging ingredient. Several biotech companies in Shanghai and Shenzhen, my country, also sell this product. However, the current preparation methods for palmitic acid pentapeptide-3 are limited to chemical synthesis, and the high cost restricts the widespread use of this product. Therefore, in order to make these short peptide skin nutrition products more accessible to the public and provide ordinary people with safe, stable, and practical high-quality cosmetics, it is necessary to design and develop more effective anti-aging short peptides and explore technologies for large-scale production of these short peptides. Summary of the Invention

[0007] Problems to be solved by the invention

[0008] In order to improve the biological activity of the existing anti-aging short peptide - palmitic acid pentapeptide-3, and at the same time reduce the production cost of this type of beauty peptide, the present invention provides an anti-aging short peptide and a preparation method thereof, which can achieve excellent anti-aging effects while reducing production costs, thereby facilitating large-scale production and application.

[0009] Solutions for solving problems

[0010] In a first aspect, the present invention provides a short peptide, wherein the amino acid sequence of the short peptide comprises any one of the following (i)-(iv):

[0011] (i) the amino acid sequence shown in SEQ ID NO. 1;

[0012] (ii) an amino acid sequence having 90%, 92%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence of SEQ ID NO. 1, which retains the anti-aging effect of the sequence of SEQ ID NO. 1;

[0013] (iii) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or modified in the amino acid sequence as shown in SEQ ID NO. 1 while retaining the anti-aging effect of the sequence as shown in SEQ ID NO. 1;

[0014] (iv) an amino acid sequence encoded by a nucleotide sequence, which hybridizes with a polynucleotide sequence encoding the sequence shown in SEQ ID NO.1 under stringent conditions, and the amino acid sequence retains the anti-aging effect of the sequence shown in SEQ ID NO.1, wherein the stringent conditions are moderate stringency conditions, medium-high stringency conditions, high stringency conditions or very high stringency conditions.

[0015] In a second aspect, the present invention provides a polynucleotide encoding the above-mentioned short peptide, wherein the sequence of the polynucleotide comprises the sequence shown in SEQ ID NO.2. Preferably, the sequence of the polynucleotide is a sequence that has been codon-optimized according to the host cell expression system.

[0016] In a third aspect, the present invention provides a recombinant expression vector, wherein the recombinant expression vector comprises the sequence of the above-mentioned polynucleotide;

[0017] Preferably, the recombinant expression vector includes pET series vectors, shuttle vectors, phage or viral vectors;

[0018] More preferably, the recombinant expression vector is pET-32a.

[0019] Furthermore, the recombinant expression vector further comprises polynucleotide I, which is a polynucleotide encoding an amino acid sequence that can be removed by TEV protease;

[0020] Preferably, the polynucleotide I is directly linked to the 5' end of the above polynucleotide.

[0021] Furthermore, the recombinant expression vector further comprises polynucleotide II, which is a polynucleotide encoding the amino acid sequence shown in SEQ ID NO.3;

[0022] Preferably, the polynucleotide II is directly linked to the 3' end of the above polynucleotide.

[0023] In a fourth aspect, the present invention provides a recombinant host cell, wherein the recombinant host cell comprises the above-mentioned recombinant expression vector;

[0024] Preferably, the recombinant host cell is a prokaryotic cell, yeast or eukaryotic cell;

[0025] More preferably, the recombinant host cell is Escherichia coli BL21 (DE3).

[0026] In a fifth aspect, the present invention provides a method for producing the above-mentioned short peptide, which comprises the following steps: S1: introducing the above-mentioned recombinant expression vector into a host cell; S2: culturing the host cell in a production medium and producing a short peptide; S3: harvesting and purifying the short peptide, preferably purifying the protein by affinity column chromatography; S4: optionally enzymatically cleaving the protein, preferably cleaving the short peptide with TEV protease.

[0027] In a sixth aspect, the present invention provides a composition comprising the above-mentioned short peptide. Preferably, the composition is a tissue engineering product, a cosmetic or a medicine.

[0028] In a seventh aspect, the present invention provides the use of the above-mentioned short peptide in the preparation of anti-aging products.

[0029] Effects of the Invention

[0030] Through the implementation of the above technical solution, the novel anti-aging short peptide prepared by the present invention is a sequence optimized through long-term screening, and its effect is significantly improved compared to similar products on the market. The production method of the novel anti-aging short peptide disclosed in the present invention adopts an E. coli expression system, which is suitable for large-scale amplification and has very low production costs. In addition, the sequence of the polynucleotide encoding the anti-aging short peptide is codon-optimized for the E. coli expression system, further increasing the yield. At the same time, the short peptide prepared by the present invention can effectively inhibit the activity of elastase, has a good firming effect, and provides effective help for the development and production of anti-aging products. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The figure shows the electrophoresis test results of each sample during the purification process of the anti-aging short peptide 2T5 according to the present invention; lane 1 is the supernatant sample after centrifugation of the bacteria, lane 2 is the precipitate sample after centrifugation of the bacteria, lane 3 is the wash solution sample, lane 4 is the elution flow-through sample, lane 5 is the flow-through sample after enzyme digestion, and lane 6 is the molecular weight marker.

[0032] Figure 2 The figure shows the mass spectrometry identification results of the anti-aging peptide 2T5. The theoretical molecular weight of the anti-aging peptide 2T5 is 1415.57 Da, which is consistent with the mass spectrometry detection results.

[0033] Figure 3 Schematic diagram showing the structure of the pET-32a-2T5 expression vector.

[0034] Figure 4 The graph shows the inhibition results of the anti-aging short peptide 2T5 according to the present invention on elastase activity at different concentrations. DETAILED DESCRIPTION

[0035] Hereinafter, embodiments of the present invention will be described, but the present invention is not limited thereto.

[0036] In the present invention, the use of "may" includes both the meaning of performing a certain process and the meaning of not performing a certain process. In this specification, "optionally" or "optionally" means that the event or situation described below may or may not occur, and the description includes both cases where the event occurs and cases where the event does not occur.

[0037] In the present invention, the terms "comprising," "having," "including," or "containing" may be inclusive or open-ended, and do not exclude additional, unrecited elements or method steps. At the same time, "comprising," "having," "including," or "containing" may also be closed-ended, excluding additional, unrecited elements or method steps.

[0038] In the present invention, the terms "short peptide", "polypeptide" or "protein" refer interchangeably to a string of at least two amino acid residues linked to each other by a covalent bond (e.g., a peptide bond), which may be a recombinant short peptide, a natural short peptide or a synthetic short peptide. The short peptide may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation or any other operation, such as conjugation with a labeling component). In the present invention, the term "short peptide" may refer to a short peptide containing 2 to 40 amino acid residues.

[0039] The anti-aging peptide of the present invention comprises the sequence set forth in SEQ ID No. 1, an amino acid sequence having 90%, 92%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence set forth in SEQ ID No. 1, or a sequence in which one or more amino acids are added, substituted, deleted, or modified from the sequence set forth in SEQ ID No. 1, as long as the anti-aging peptide of the present invention retains the anti-aging effect of the amino acid sequence of SEQ ID No. 1. The "plurality" can be 2, 3, 4, 5, 6, or 7. Preferably, the anti-aging peptide of the present invention consists of 12 amino acids, and its amino acid sequence is: GKTTKSENL YFQ (SEQ ID No. 1).

[0040] In the present invention, the term "amino acid" may include natural amino acids, unnatural amino acids, amino acid analogs, and all their D and L stereoisomers.

[0041] In the present invention, "homology" refers to the degree of similarity between the nucleotide sequences of two nucleic acid molecules or between the amino acid sequences of two protein molecules.

[0042] In the present invention, amino acid addition may refer to the addition of 1, 2 or 3 or more amino acids at the C-terminus, N-terminus or any position between the C-terminus and the N-terminus of the amino acid sequence, as long as the altered sequence fully or partially retains the activity of the original amino acid sequence.

[0043] In the present invention, amino acid substitution may refer to the replacement of an amino acid at a certain position in an amino acid sequence by another amino acid, as long as the altered sequence retains the activity of the original amino acid sequence in whole or in part. Amino acid substitution may be a conservative amino acid substitution, which refers to the replacement of several amino acids by amino acids with similar or similar properties compared to the original amino acid sequence to form a peptide (conservative variant peptide). Exemplary, these conservative variant peptides can be produced based on the following amino acid substitutions: replacement of Ala by Val, Leu or Ile, replacement of Arg by Lys, Gln, Asn or His, replacement of Asn by Gln, His, Lys or Arg, replacement of Asn by Glu or Asn, replacement of Cys by Ser or Ala, replacement of Gln by Asn or Glu, replacement of Glu by Asp or Gln, replacement of Gly by Ala, replacement of His by Asn, Lys, Gln or Arg, replacement of Leu, Met, Ala, Val or P The amino acid substitutions may also be non-conservative amino acid substitutions.

[0044] In the present invention, amino acid deletion may refer to the deletion of 1, 2 or 3 or more amino acids from an amino acid sequence, as long as the altered sequence fully or partially retains the activity of the original amino acid sequence.

[0045] In the present invention, amino acid modification may include modification of the natural sequence, such as modification of functional groups, intramolecular covalent bonding (e.g., cyclization between side chains), methylation, acylation, ubiquitination, phosphorylation, aminohexanylation, biotinylation, etc.

[0046] In the present invention, "hybridization" refers to the ability of a polynucleotide or oligonucleotide to bind to a substantially complementary sequence under stringent conditions, without nonspecific binding to non-complementary sequences under these conditions. For this purpose, the sequences are preferably 90-100% complementary. The ability of complementary sequences to specifically bind to each other is utilized, for example, in Northern or Southern blotting techniques, or in primer binding for PCR or RT-PCR. According to the present invention, hybridization occurs under conditions of moderate stringency, medium-high stringency, high stringency, or very high stringency. Such hybridization conditions are described in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6. For example, specific hybridization conditions are as follows: (1) low stringency hybridization conditions are in 6× sodium chloride / sodium citrate (SSC) at about 45°C, followed by two washes in 0.2×SSC, 0.1% SDS at at least 50°C (the washing temperature can be increased to 55°C for low stringency conditions); (2) moderate stringency hybridization conditions are in 6×SSC at about 45°C, followed by one or more washes in 0.2×SSC, 0.1% SDS at 60°C; (3) high stringency hybridization conditions are in 6×SSC at about 45°C, followed by one or more washes in 0.2×SSC, 0.1% SDS at 65°C, and preferably; (4) very high stringency hybridization conditions are 0.5 M sodium phosphate, 7% SDS at 65°C, followed by one or more washes in 0.2×SSC, 1% SDS at 65°C.

[0047] The present invention also provides nucleic acid molecules comprising a nucleic acid sequence encoding a short peptide of the present invention. The nucleic acid can be DNA or cDNA. The nucleic acid molecule can be primarily composed of a nucleic acid sequence encoding the short peptide of the present invention, or can be composed solely of a nucleic acid sequence encoding the short peptide of the present invention. Such nucleic acid molecules can be synthesized using methods known in the art. Due to the degeneracy of the genetic code, those skilled in the art will appreciate that nucleic acid molecules with different nucleic acid sequences can encode the same amino acid sequence.

[0048] In a preferred embodiment, the amino acid sequence of 2T5 (including the sequence shown in SEQ ID No. 1) is optimized according to the codons preferred by E. coli. Preferably, the sequence of the polynucleotide of the present invention is: GGCAAAACCACCAAAAGCGAAAATCTGTATTTTCAG (SEQ ID NO. 2).

[0049] In the present invention, suitable vectors are known in the art of vector construction, including the selection of promoters and other regulatory elements, such as enhancer elements. The vectors described in the present invention include sequences suitable for introduction into cells. For example, the vector can be an expression vector, in which the coding sequence of the protein is controlled by its own cis-acting regulatory elements, and the vector design facilitates gene integration or gene replacement in the host cell. Those skilled in the art will understand that, in the present invention, "vector" includes DNA molecules, such as plasmids, phages, viruses, or other vectors, which contain one or more heterologous or recombinant nucleotide sequences. Suitable phage and viral vectors include, but are not limited to, lambda phage, EMBL phage, simian virus, bovine wart virus, Epstein-Barr virus, adenovirus, herpes virus, mouse sarcoma virus, murine mammary carcinoma virus, lentivirus, and the like. In a preferred embodiment, the recombinant expression vector of the present invention includes a pET series vector, a shuttle vector, a phage, or a viral vector. More preferably, the recombinant expression vector is pET-32a.

[0050] The present invention also provides a recombinant expression vector, wherein the recombinant expression vector comprises the sequence of the above-mentioned polynucleotide.

[0051] In a preferred embodiment, the recombinant expression vector of the present invention further comprises polynucleotide I, which is a polynucleotide encoding an amino acid sequence that can be removed by TEV protease; preferably, the polynucleotide I is directly linked to the 5' end of the above polynucleotide.

[0052] In another preferred embodiment, the recombinant expression vector of the present invention further comprises polynucleotide II, which is a polynucleotide encoding the amino acid sequence shown in SEQ ID NO. 3; preferably, the polynucleotide II is directly linked to the 3' end of the above polynucleotide.

[0053] In a preferred embodiment, the short peptide sequence of the present invention can have an ENLYFQ (SEQ ID No. 4) sequence added to its N-terminus during expression, which can be cleaved by TEV protease to directly obtain the sequence of SEQ ID No. 1. Preferably, the ENLYFQ (SEQ ID No. 4) sequence is directly linked to the N-terminus of the short peptide of the present invention.

[0054] In another preferred embodiment, the short peptide sequence of the present invention may contain the C-terminal sequence GKTTKS (SEQ ID No. 3) during expression to increase the stability of the expressed polypeptide. Preferably, the GKTTKS (SEQ ID No. 3) sequence is directly linked to the C-terminus of the short peptide of the present invention.

[0055] In the present invention, the host cell can be a eukaryotic cell, such as fungi and yeast, or a prokaryotic cell, such as Enterobacteriaceae. In a specific embodiment, the host cell is Escherichia coli BL21 (DE3).

[0056] The present invention provides a method for producing the above-mentioned anti-aging short peptide, comprising the following steps:

[0057] S1: introducing the recombinant expression vector of the present invention into a host cell; S2: culturing the host cell in a production medium and producing a short peptide; S3: harvesting and purifying the short peptide; S4: optionally performing enzymatic cleavage on the protein.

[0058] In a preferred embodiment, the anti-aging short peptide of the present invention can be prepared by the following method. For example, it can be produced by the following steps: (1) construction of genetically engineered Escherichia coli; (2) fermentation and cultivation of genetically engineered Escherichia coli; (3) induction and expression of the protein; (4) purification of the protein and optional enzymatic cleavage.

[0059] In the above step (1), the construction of the genetically engineered Escherichia coli can be carried out by the following steps:

[0060] a. Designing the amino acid sequence of the anti-aging short peptide 2T5; b. Synthesizing the nucleotide sequence corresponding to the above amino acid sequence; c. Cloning the nucleotide sequence of the anti-aging short peptide 2T5 into an expression vector, then transforming the expression vector into an Escherichia coli expression strain, and screening to obtain genetically engineered Escherichia coli bacteria;

[0061] In the above steps (2) and (3), the fermentation culture of the genetically engineered Escherichia coli and the induction and expression of the protein can be carried out by the following steps:

[0062] a. Select a single colony of genetically engineered E. coli and culture it in LB medium at 35-38°C overnight. b. Inoculate the culture solution and culture it at 35-38°C for 2.5-3 hours. Induce it with IPTG and continue to culture it at 15-18°C for 18-22 hours. Collect the cells by centrifugation.

[0063] In the above step (4), protein purification and enzyme cleavage can be carried out by the following steps:

[0064] a. Resuspend the bacteria in Tris buffer, disrupt by sonication, and collect the supernatant by centrifugation;

[0065] b. Anti-aging short peptides were purified from the supernatant using an affinity chromatography column.

[0066] In the present invention, "tissue engineering products" refer to products used for tissue engineering. Tissue engineering is an emerging discipline that combines cell biology and materials science to construct tissues or organs in vitro or in vivo.

[0067] Example

[0068] The present invention is further illustrated by the following examples, but any example or combination thereof should not be construed as limiting the scope or implementation of the present invention. The scope of the present invention is defined by the appended claims. In conjunction with this specification and common knowledge in the art, a person of ordinary skill in the art will clearly understand the scope defined by the claims. Without departing from the spirit and scope of the present invention, those skilled in the art may make any modifications or changes to the technical solution of the present invention, and such modifications and changes are also included in the scope of the present invention.

[0069] In the examples, if specific conditions are not specified, the conditions are carried out according to conventional conditions or manufacturer's recommendations. All reagents or instruments that do not specify the manufacturer are conventional products that can be purchased commercially. In order to better illustrate the present invention, numerous specific details are provided in the following specific embodiments. It should be understood by those skilled in the art that the present invention can be implemented equally without certain specific details. In other embodiments, methods, means, equipment and steps well known to those skilled in the art are not described in detail to highlight the main purpose of the present invention.

[0070] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art. Unless otherwise specified, the units used in this specification are all international standard units, and the numerical values ​​and numerical ranges appearing in this invention should be understood to include inevitable systematic errors.

[0071] Example 1: Construction of genetically engineered Escherichia coli

[0072] a. In order to obtain the anti-aging short peptide 2T5, the amino acid sequence was specially designed: GKTTKSENLYFQ (SEQ ID NO.1).

[0073] b. The nucleotide sequence corresponding to the above amino acid sequence is synthesized as follows: GGCAAAACCACCAAAAGCGAAAATCTGTATTTTCAG (SEQ ID NO.2).

[0074] c. The nucleotide sequence of the anti-aging short peptide 2T5 was cloned into an expression vector, and then the expression vector was transformed into an E. coli expression strain, and genetically engineered E. coli was obtained by screening; specifically:

[0075] According to the amino acid sequence of 2T5, it was optimized according to the codons preferred by E. coli, namely SEQ ID NO.2.

[0076] Beijing Liuhe BGI Gene Technology Co., Ltd. was commissioned to connect the front end of the 2T5 gene fragment (SEQ ID NO. 2) (i.e., the 5' end of the 2T5 gene fragment) to the gene sequence encoding the TEV protease cleavage site (ENLYFQ (SEQ ID NO. 4)), and the end (i.e., the 3' end of the 2T5 gene fragment) to the gene sequence encoding the amino acid sequence GKTTKS (SEQ ID NO. 3) to obtain CCGAAAACCTGTATTTCCAGGGCAAAACCACCAAAAGCGAAAATCTGT ATTTTCAGGGTAAAACCACCAAGAGC (as shown in SEQ ID NO. 5). The resulting fragment was then inserted into the pET-32a expression vector (Beijing Liuhe BGI Gene Technology Co., Ltd., which contains the gene sequence encoding Trx) through the Kpn I (NEB Company Catalog No.: R0136L) and Xho I (NEB Company, Catalog No.: R0146L) cleavage sites to construct the pET-32a-2T5 expression vector (see the vector map of the recombinant expression plasmid for details). Figure 3 ), the expression vector was introduced into Escherichia coli BL21 (DE3), and positive Escherichia coli genetically engineered bacteria were screened.

[0077] Example 2: Fermentation culture of genetically engineered Escherichia coli

[0078] a. Pick a single colony of genetically engineered E. coli after optimization and culture it in 5 mL of LB medium at 37°C overnight.

[0079] b. The bacterial solution was inoculated at a ratio of 1:100 and cultured at 37°C for 3 hours. 0.5 mM IPTG was added for induction and cultured at 16°C for another 20 hours. The protein expressed at this time was 2T5 and the cells were collected by centrifugation.

[0080] Example 3: Purification and optional enzymatic cleavage of recombinant anti-aging short peptide 2T5

[0081] Crude purification: a. Wash the column with water. b. Equilibrate the column with equilibration solution (200mM sodium chloride, 25mM Tris, 20mM imidazole). c. Loading: Crush and collect the bacterial cells, centrifuge (the supernatant sample is named "bacteria supernatant", and the precipitate sample is named "precipitate"). Add the supernatant after centrifugation to the column until the liquid flows out. d. Clean impurities: Add 25mL of wash solution (200mM sodium chloride, 25mM Tris, 20mM imidazole) until the liquid flows out (the sample name of the wash solution that flows out is named "column material"). e. Collect the target protein: Add 25mL of eluent (200mM sodium chloride, 25mM Tris, 250mM imidazole) and collect the flow-through to obtain the target short peptide Trx-2T5 (the sample name of the eluted flow-through is named "elution"). In order to remove the target short peptide of the Trx tag and obtain the short peptide 2T5 with the amino acid sequence shown in SEQ ID NO.1, an appropriate amount of TEV protease with a His tag was added, and after incubation at 4°C for 16 hours, the flow-through liquid was collected (the name of the flow-through liquid sample after enzyme cleavage was recorded as "after cleavage"), which was the short peptide 2T5 with the carrier protein Trx removed.

[0082] The samples of the above-mentioned anti-aging short peptide 2T5 were subjected to SDS-PAGE detection, and the detection results were as follows: Figure 1 As shown in the figure, the short peptide 2T5 cannot be detected and displayed by conventional SDS-PAGE because of its theoretical molecular weight of 1415.57Da. Therefore, it needs to be identified by mass spectrometry. Therefore, the purified anti-aging short peptide 2T5 was subjected to mass spectrometry detection. The test sample was desalted by ziptipC18, then mixed with matrix (CHCA) and spotted on the plate. The sample was detected by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF / TOF Ultraflextreme). TM , Brucker, Germany, and analyzed in reflectron mode. Figure 2 As shown in the figure, the theoretical molecular weight of the short peptide 2T5 is 1415.57 Da, which is consistent with the mass spectrometry detection result.

[0083] Example 4: Biological functions of recombinant anti-aging short peptide 2T5

[0084] 1. During collagen secretion, TGF-β is expressed in large quantities. Therefore, increased TGF-β expression indicates enhanced collagen synthesis. Using rat tenocytes as a model, different concentrations of the short peptide 2T5 (0.2 μg / ml, 2 μg / ml, 20 μg / ml, and 200 μg / ml) were added. After 24 hours, the supernatant of the rat tenocytes was collected and directly transferred to a TGF-β detection kit for testing.

[0085] 2. The cytotoxicity of the anti-aging peptide 2T5 was detected using the standard MTT assay. Following the standard MTT assay procedure, different concentrations of the peptide (0.2 μg / ml, 2 μg / ml, 20 μg / ml, 200 μg / ml) were added, and cell viability was detected 24 hours later.

[0086] 3. Immunohistochemistry was used to examine the effect of the anti-aging peptide 2T5 on stimulating cellular collagen synthesis. Rat tenocytes were treated with the peptide (at a concentration of 20 μg / ml) for 24 hours, fixed with 4% paraformaldehyde, blocked with 3% BSA, and then labeled with a rabbit anti-mouse collagen antibody (Novotec, Saint Martin-La-Garenne, France) for 1 hour. Fluorescence staining was used and the cells were observed under a microscope.

[0087] Example 5: Evaluation of the firming efficacy of the anti-aging short peptide 2T5 (elastase activity inhibition test) Preparation of reagents:

[0088] Weigh 0.4 g of calcium chloride and dissolve it in 10 ml of purified water to prepare a 40 g / L calcium chloride solution. Mix 0.1 ml of this solution with 10 ml of 10× TES solution (purchased from Shanghai Biyuntian Biotechnology Co., Ltd., product number ST453-500 ml) and dilute to 100 ml to prepare TESCA buffer.

[0089] An appropriate amount of elastase (purchased from Shanghai Yuanye Biotechnology Co., Ltd., catalog number: S10165) was weighed and dissolved in TESCA buffer to prepare a 200 U / ml working solution as the elastase solution.

[0090] Weigh 5 mg of elastin solution (purchased from Sigma) and add 5 ml of purified water to prepare a 1 mg / ml protein solution.

[0091] 12 mg of epigallocatechin gallate (EGCG) (purchased from Shanghai Yuanye Biotechnology Co., Ltd., catalog number: B20106) was weighed and added to 10 ml of TESCA buffer to prepare an EGCG solution.

[0092] Evaluation of Elastase Activity Inhibition:

[0093] The activity of elastase was evaluated by the following method. 50 μL of sample or reference substance, pure water, protease solution and / or TESCA buffer were added to a 96-well plate according to the composition listed in Table 1 below. After incubation at 37°C for 10 minutes, 100 μL of protein solution was added. Enzyme hydrolysis was then carried out at 37°C for 40 minutes, and the absorbance (OD value) at 405 nm was measured using a microplate reader. Three parallels were run in each group, and the average value was taken. Among them, the samples used in the sample group were the short peptide 2T5 with the Trx label removed prepared in Example 3 with concentrations of 0.10%, 0.05% and 0.025%, respectively; the reference substance used in the positive control group was EGCG solution.

[0094] Table 1

[0095]

[0096] The elastase activity inhibition rate of the sample group was calculated according to the following formula.

[0097] Where:

[0098]

[0099] A-OD value of (protease solution + sample) experimental solution;

[0100] B-(sample + TESCA buffer) experimental blank OD value;

[0101] C-OD value of (protease solution + pure water) control solution;

[0102] D-(pure water + TESCA buffer) OD value of the control blank.

[0103] For the positive control group, the OD value was measured in the same manner as above except that the samples in formula A and B were replaced by the control EGCG in groups E and F shown in Table 1, and the elastase activity inhibition rate of the control EGCG was calculated.

[0104] The assay results for the sample group and the positive control group are summarized in Table 2 below.

[0105] Table 2

[0106] Group Elastase inhibition rate (%) Positive control group 41.91 Sample group (0.10%) 64.10 Sample group (0.05%) 53.55 Sample group (0.025%) 47.96

[0107] As shown in Table 2 above, compared with the positive control EGCG, the short peptide 2T5 prepared according to the present invention has a significantly increased elastase inhibition rate at different concentrations, indicating that the short peptide 2T5 of the present invention has a certain firming effect.

[0108] Industrial applicability

[0109] The anti-aging peptide 2T5, prepared according to the present invention, consists of 12 amino acids with the amino acid sequence GKTTKSENLYFQ (SEQ ID NO. 1). This method utilizes recombinant expression in E. coli fermentation to produce the peptide 2T5, resulting in a simple, low-cost, and readily commercializable production process. The resulting peptide 2T5 can be used as a useful ingredient in anti-aging products.

Claims

1. A short peptide, characterized in that The amino acid sequence of the short peptide is the amino acid sequence shown in SEQ ID NO.

1.

2. A polynucleotide encoding the short peptide according to claim 1, characterized in that: The sequence of the polynucleotide is the sequence shown in SEQ ID NO.

2.

3. The polynucleotide according to claim 2, characterized in that The polynucleotide sequence is a sequence that has been codon-optimized according to the host cell expression system.

4. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the sequence of the polynucleotide according to claim 2 or 3.

5. The recombinant expression vector according to claim 4, characterized in that The recombinant expression vector includes pET series vectors, shuttle vectors or viral vectors.

6. The recombinant expression vector according to claim 4, characterized in that The recombinant expression vector is pET-32a.

7. The recombinant expression vector according to claim 4, characterized in that The recombinant expression vector is a phage.

8. The recombinant expression vector according to any one of claims 4 to 7, characterized in that The recombinant expression vector further comprises a polynucleotide 1, wherein the polynucleotide 1 is a polynucleotide encoding an amino acid sequence that can be removed by TEV protease, wherein the amino acid sequence encoded by the polynucleotide 1 is as shown in SEQ ID NO: 4, and the polynucleotide 1 is directly linked to the 5' end of the polynucleotide according to claim 2; The recombinant expression vector further comprises polynucleotide II, which is a polynucleotide encoding the amino acid sequence shown in SEQ ID NO. 3; the polynucleotide II is directly linked to the 3' end of the polynucleotide according to claim 2.

9. A recombinant host cell, characterized in that The recombinant host cell comprises the recombinant expression vector according to any one of claims 4 to 8.

10. The recombinant host cell according to claim 9, characterized in that The recombinant host cell is a prokaryotic cell or a eukaryotic cell.

11. The recombinant host cell according to claim 10, characterized in that The eukaryotic cell is yeast.

12. The recombinant host cell according to claim 9, characterized in that The recombinant host cell is Escherichia coli BL21 (DE3).

13. A method for producing a short peptide according to claim 1, comprising the following steps: S1: introducing the recombinant expression vector according to any one of claims 4 to 8 into a host cell; S2: culturing the host cell in a production medium and producing a short peptide; S3: harvesting and purifying the short peptide; S4: cleaving the short peptide with TEV protease.

14. The method for producing a short peptide according to claim 13, characterized in that: In step S3, the short peptide is purified by affinity column chromatography.

15. A composition, characterized in that Comprising the short peptide according to claim 1.

16. The composition according to claim 15, characterized in that The composition is a tissue engineering product, a cosmetic or a medicine.

17. Use of the short peptide according to claim 1 in the preparation of anti-aging products.

Images