Streptomyces griseus h114 and preparation method and application of antibacterial metabolites

Abstract

The invention discloses a preparation method and application of Streptomyces griseus h114 and antibacterial metabolites, and the steps are: (1) collecting citrus rhizosphere soil in a sterile culture dish, dissolving it with sterile distilled water, purifying it, and storing it in a refrigerator. (2) using the preserved citrus green mold strain as a strain, obtaining a strain confrontation culture, and screening out a strain that effectively inhibits the growth of citrus post-harvest green mold. Further testing the biocontrol strain cultured on NA culture medium. (3) inoculating the strain h114 in NB culture medium, shaking culture in a shaker, continuously collecting, centrifuging the fermentation liquid, obtaining the sterile fermentation filtrate of the strain, and determining that the sterile fermentation filtrate of the strain h114 can significantly inhibit the growth of citrus post-harvest green mold. (4) inoculating the strain h114 on NA culture medium, and growing it in an incubator until it covers the surface of the plate. The culture method is simple, the growth and reproduction rate is fast, the application of inhibiting citrus post-harvest green mold pathogens is simple to operate, the effect is good, and it is suitable for wmurcott fruit storage.

Description

Technical Field

[0001] The present invention relates to the field of citrus storage and preservation and biological control. Specifically, it relates to a biological control strain of Streptomyces griseus H114 for effectively controlling post-harvest green mold pathogens of citrus, a method for preparing antibacterial metabolites of Streptomyces griseus H114, and a use of Streptomyces griseus H114 in controlling post-harvest green mold disease of citrus. The use of the biological control strain H114 can reduce the rot rate of citrus fruits infected by green mold during storage and improve economic benefits. Background Art

[0002] Citrus is one of the most important fruit trees in southern China, with a wide cultivation area and high fruit yield. In 2021, China's citrus production reached 55.9561 million tons, an increase of 9.25% over the previous year, and the citrus industry has steadily increased. However, citrus fruits are easily infected by pathogenic microorganisms in various links such as processing, storage, preservation and sales after harvest (Moscoso-Ramirez and Palou, 2013), which in turn causes rot and deterioration, resulting in very serious economic losses, greatly limiting the efficient and healthy development of the citrus industry. According to statistics, the losses caused by pathogenic microorganisms account for about 60-80% of rotten fruits each year, among which green mold disease induced by Penicillium digitatum (green mold) is the most serious (Moscoso-Ramirez and Palou, 2013).

[0003] Currently, chemical agents such as prochloraz and imazalil are mainly used to control green mold. However, the long-term, large-scale and unlimited use of chemical agents not only aggravates the pesticide residues in fruits and causes environmental pollution, but also seriously threatens human health and accelerates the emergence of drug-resistant strains. In addition, reducing the use of pesticides is also an important goal of sustainable agricultural production. Therefore, it is urgent to find a safer and greener method to control green mold. Biological control is a control method using organisms (mainly microorganisms) and is considered to be an alternative, environmentally friendly, safe and new control strategy.

[0004] The applicant isolated, purified and screened the biocontrol strain h114 from the rhizosphere soil of citrus, which has a strong inhibitory effect on citrus post-harvest green mold, and further identified it as Streptomyces griseochromogenes. Strain h114 can inhibit the growth of citrus green mold on solid culture plates, and can also produce volatile substances that can inhibit the spread of citrus green mold; the filtrate after fermentation in liquid culture medium can effectively inhibit the growth of a variety of pathogenic fungi including citrus green mold, and can effectively reduce the rot of citrus fruit caused by green mold. Summary of the invention

[0005] The purpose of the present invention is to provide a biocontrol Streptomyces griseus strain h114, which can be cultured in a variety of culture media and a variety of temperature ranges, and grows and proliferates rapidly. The strain can be used to effectively prevent and control post-harvest green mold disease of citrus, and can also effectively inhibit the growth of a variety of pathogens such as post-harvest penicillium, acid rot fungi, anthracnose fungi and gray mold of citrus.

[0006] Another object of the present invention is to provide a method for preparing antibacterial metabolites of Streptomyces griseus h114, which is simple to operate, saves time and effort, is efficient and easy to implement, and the metabolites obtained by this method are durable in preservation and can significantly inhibit the growth and spread of citrus green mold.

[0007] Another object of the present invention is to provide an application of a biocontrol strain h114 in the preparation of a drug for treating or preventing citrus post-harvest green mold pathogens, which can effectively prevent and control citrus green mold pathogens, has unique feasibility, simple result judgment, and good effect.

[0008] In order to achieve the above object, the present invention adopts the following technical measures:

[0009] A method for preparing antibacterial metabolites of biocontrol strain h114 for effectively preventing and controlling post-harvest green mold disease of citrus, comprising the following steps:

[0010] (1) Collect citrus rhizosphere soil in a sterile culture dish, dissolve it with 1L sterile distilled water and dilute it to 10 times, 100 times, and 1000 times. Take an appropriate amount and spread it on a 90 mm potato dextrose solid medium (PDA) plate, culture it at about 25°C for 1-3 days, number and name the single colonies that grow, and after further purification, put them into 25% glycerol and store them in a -80°C ultra-low temperature refrigerator.

[0011] (2) The citrus green mold strain N1 preserved in the laboratory was used as an indicator strain, and was cultured in opposition to the strain obtained in step (1), thereby screening out the strain h114 that can effectively inhibit the growth of post-harvest green mold in citrus. In addition, after the strain h114 was grown on LB medium, Gao's medium No. 1, and beef extract peptone medium, it was determined that the optimal inhibitory medium for strain N1 was beef extract peptone medium (solid NA, liquid NB). The inhibitory effect of the biocontrol strain on multiple plant pathogenic fungi preserved in the laboratory after being cultured on NA medium was further tested.

[0012] (3) Based on the above results, strain h114 was inoculated into NB medium and cultured in a shaker at 24-26℃ at 150rpm. The fermentation liquid was collected every 12h, and the collection was continued for several times (5-10 times). The fermentation liquid was centrifuged at 6000rpm for 6-8min, and the supernatant was filtered once through a 0.22μm sterile microporous filter membrane to obtain the sterile fermentation filtrate of the strain. The time curve of the sterile fermentation filtrate of strain h114 inhibiting the growth of strain N1 was drawn, and the optimal fermentation time was determined to be 35-37h. The antibacterial effect on various pathogenic fungi was further tested, and it was determined that the sterile fermentation filtrate of strain h114 could significantly inhibit the growth of post-harvest green mold in citrus.

[0013] (4) The strain h114 was inoculated on NA medium and grown in an incubator at 24-26°C until the entire surface of the plate was covered. An appropriate amount of spore suspension of citrus green mold was added to the center of the PDA plate. The NA plate and the PDA plate were placed vertically together. The volatile metabolites of the strain h114 were detected to effectively inhibit the growth of post-harvest green mold in citrus.

[0014] The strain was deposited in the China Center for Type Microorganism Collection on September 30, 2022, and was classified and named Streptomyces griseochromogenes h114, with a deposit number of CCTCC NO: M20221539 and an address of No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The biocontrol strain h114 sequence contains the nucleotide sequence shown in SEQ ID NO: 1.

[0015] Strain h114 was streaked on NA medium and grown at 25°C for 1-3 days, and the colonies were gray and round with slightly wrinkled edges. After continued growth, dense hyphae structures could be observed under an optical microscope.

[0016] By means of the above technical measures (1), (2), (3) and (4), strain h114, fermentation filtrate of strain h114 and its volatile antibacterial metabolites were obtained respectively. Strain h114 can inhibit the growth of various pathogens, such as citrus green mold, citrus penicillium, apple penicillium, citrus black rot, citrus acid rot, gray mold, kiwifruit phytospores, gloeosporium, botrytis, stolonifer, penicillium ulaverii, penicillium polishii, penicillium peeling and penicillium chrysogenum; its fermentation filtrate can inhibit the growth of pathogens such as citrus green mold, citrus penicillium and penicillium ulaverii; and volatile antibacterial metabolites have been detected to effectively inhibit the growth of citrus green mold. Compared with the chemical agents commonly used in production, strain h114 can effectively inhibit the post-harvest green mold of citrus without causing environmental pollution problems.

[0017] A biocontrol strain h114 is used in the preparation of a drug for treating or preventing pathogenic bacteria of postharvest green mold disease of citrus, the steps of which are:

[0018] 1) The strain h114 was inoculated into NB liquid culture medium and cultured in a shaker at 25°C and 150 rpm for about 36 h. The fermentation broth was filtered through a 0.1 mm filter and collected for later use.

[0019] (2) Mature citrus fruits without obvious mechanical damage were selected, immersed in the diluted fermentation liquid collected by the strain h114 for about 1 minute, naturally air-dried, bagged, and stored in a ventilated warehouse; after 88-92 days, the morbidity of the stored fruits was counted. Compared with the group treated with traditional chemical agents, the rot rate of the fruits treated with the fermentation liquid of the strain h114 was within 0.5%, which was lower than that of the group treated with chemical agents.

[0020] The citrus fruit is w Murcott.

[0021] Compared with the prior art, the present invention has the following advantages and effects:

[0022] The Streptomyces griseus strain h114 provided by the present invention has a good inhibitory effect on citrus post-harvest green mold pathogens, and the diameter of the antibacterial zone of the fermentation filtrate after culturing for 36 hours can reach 40.25 mm; the rot rate of W. murcott fruit stored for 3 months is lower than that of the traditional chemical agent treatment group, and the rot rate is within 0.5%. Compared with traditional chemical agents, the strain h114 effectively inhibits the citrus post-harvest pathogen Penicillium digitatum without causing pesticide residues.

[0023] Figures and Description

[0024] Figure 1 This is a schematic diagram of the colony of h114, a biocontrol strain that is highly effective in controlling post-harvest green mold disease of citrus, growing on NA medium.

[0025] Figure 2 The following is a schematic diagram of the phylogenetic tree of the 16S rDNA sequence of the biocontrol strain h114, which is highly effective in controlling postharvest green mold disease in citrus. The strain h114 has the highest homology with Streptomyces griseochromogenes ATCC14511.

[0026] Figure 3 This is a schematic diagram of the NA culture medium lawn of the biocontrol strain h114, which is highly effective in controlling citrus postharvest green mold, inhibiting the growth of Penicillium digitatum. The middle of the culture dish is the lawn of strain h114, and only some Penicillium digitatum grows on the edge.

[0027] Figure 4 This is a schematic diagram of the antibacterial activity of the fermentation filtrate of NB medium of the biocontrol strain h114, which is highly effective in controlling post-harvest green mold disease in citrus. The fermentation filtrate of strain h114 was added to the concave part of the culture dish, and only some digitate Penicillium grew on the edge.

[0028] Figure 5 This is a schematic diagram of the volatile metabolites produced by the biocontrol strain h114, which is highly effective in controlling postharvest green mold disease in citrus, on NA medium to inhibit the growth of Penicillium digitatum. Figure A shows the growth of Penicillium digitatum on a PDA plate, and Figure B shows the growth of Penicillium digitatum in the presence of the volatile metabolites of strain h114. The volatile metabolites of strain h114 significantly inhibited the spread and spore production of Penicillium digitatum.

[0029] Figure 6 This is a schematic diagram of the storage antibacterial effect analysis of a biocontrol strain H114 that effectively controls post-harvest green mold disease in citrus. "Fungicide" is the rot rate of W Murcott fruit with green mold disease in the chemical agent treatment group, and "H114+CFS" is the rot rate of W Murcott fruit with green mold disease in the fermentation liquid treatment group of strain H114. The fermentation liquid of strain H114 significantly reduced the green mold lesions in citrus fruit. DETAILED DESCRIPTION

[0030] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0031] Embodiment 1:

[0032] A method for preparing a biocontrol strain h114 for effectively preventing and controlling post-harvest green mold disease of citrus, comprising the following steps:

[0033] (1) The collected citrus rhizosphere soil was dissolved with sterile distilled water and diluted in different gradients. Appropriate amounts were applied to 90 mm PDA plates and placed in a 25°C incubator for 1-3 days. The grown single colonies were numbered, further purified and preserved. Citrus green mold strain N1 was used as an indicator strain and cultured against the obtained strains, and then strain h114 was screened out, which can effectively inhibit the growth of post-harvest green mold in citrus.

[0034] (2) Strain h114 was cultured in NA solid medium at 25°C. Figure 1 As shown: the colony is gray and round, with slightly wrinkled edges. Using the genome of strain h114 as a template, 16S rDNA sequence PCR amplification was performed, and the primer sequences were as follows: 1, 27F: AGAGTTTGATCCTGGCTCAG, 2, 1492R: TACGGCTACCTTGTTACGACTT, and about 1500bp DNA fragment was obtained for sequencing. The sequence of the biocontrol strain h114 contained the nucleotide sequence shown in SEQ ID NO: 1.

[0035] Blast alignment was performed on NCBI, and some reported sequences of the same genus were selected to construct a phylogenetic tree, such as Figure 2 shown.

[0036] Therefore, strain h114 was finally classified as Streptomyces griseochromogenes.

[0037] The strain was sent to the China Type Culture Collection in Wuhan University, Wuhan City, Hubei Province for preservation on September 30, 2022, and the classification name is Streptomyces griseochromogenes h114, the preservation number is CCTCC NO: M20221539, and the address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. A biocontrol strain h114 contains the nucleotide sequence shown in SEQ ID NO: 1.

[0038] Embodiment 2:

[0039] An application of a biocontrol strain h114 in inhibiting the pathogen of postharvest green mold disease of citrus comprises the following steps:

[0040] A. Experiment on the inhibition of citrus post-harvest green mold by strain h114:

[0041] Use a sterile metal spoon to scrape an appropriate amount of the biocontrol strain h114 obtained in Example 1 into 1 mL of sterile distilled water, mix well, and then pipette 100 μL onto the surface of the NA plate, and spread evenly with a sterile bacterial stick, and culture at 25°C for 2 days. Use a 5mm sterile puncher to punch holes on the NA plate covered with the biocontrol strain h114, pick the bacterial moss and inoculate it into the PDA medium mixed with the strain N1, and culture at 25°C. The results are as follows: Figure 3 , showing that the biocontrol strain h114 can inhibit the growth of strain N1.

[0042] B. Experiment on the inhibition of citrus postharvest green mold pathogen by fermentation filtrate of strain h114:

[0043] Use a sterile metal spoon to scrape an appropriate amount of the biocontrol strain h114 obtained in Example 1 into 1 mL of sterile distilled water, mix well, and then draw 100 μL into 100 mL of NB liquid culture medium. Shake and culture at 150 rpm in a 25°C incubator for 36 hours. Collect the fermentation broth, centrifuge at 6000 rpm for 7 minutes, draw the supernatant and filter it once through a 0.22 μm sterile microporous filter membrane, and dispense it into sterile 2 mL centrifuge tubes for later use. Take 30 μL and add it to a PDA plate punched with a 5 mm puncher and mixed with strain N1, and grow it in a 25°C incubator. The results are as follows: Figure 4 , indicating that the sterile filtrate of biocontrol strain h114 contained antibacterial substances.

[0044] C. Experiment on the inhibition of volatile metabolites of strain h114 on post-harvest green mold pathogens of citrus:

[0045] Use a sterile metal spoon to scrape an appropriate amount of the biocontrol strain h114 obtained in Example 1 into 1 mL of sterile distilled water, mix well, and then pipette 100 μL onto the surface of the NA plate, and spread evenly with a sterile bacterial stick, and culture at 25°C for 1 day. The NA plate was placed on the PDA plate inoculated with 2.5 μL of the N1 spore suspension in the center, sealed, and cultured at 25°C. The results are as follows. Figure 5 , showing that the volatile substances produced by the biocontrol strain h114 can inhibit the growth of strain N1.

[0046] D. Effect of strain h114 on reducing the decay rate of citrus during storage:

[0047] (1) Preparation of strain h114 fermentation broth:

[0048] Prepare 10L of NB culture medium, divide it into 20 1L Erlenmeyer flasks, sterilize at 121°C for 15min and set aside. Use a sterile metal spoon to scrape a sufficient amount of the biocontrol bacteria strain h114 obtained in Example 1, mix well and then pipette 500 μL into an Erlenmeyer flask containing NB culture medium, shake and culture at 25°C and 150rpm for 36h, and collect the fermentation broth after filtering through a 0.1mm filter.

[0049] (2) Experiment of immersing citrus fruits with strain h114

[0050] Healthy orchards with scientific and effective management methods were selected, and mature fruits with similar fruit sizes and no obvious mechanical damage were selected. They were treated as follows: 1. Soaked in chemical fungicide (prochloraz), recorded as CK; 2. Soaked in h114 fermentation liquid; 3 replicates per group, 100 fruits per replicate; After natural air drying, the fruits were bagged and stored in a ventilated warehouse. After 90 days, the fruit morbidity was counted. The results are as follows Figure 6 shown.

[0051] This Streptomyces griseus strain was isolated from the rhizosphere soil of citrus. Its bacteria, sterile fermentation filtrate and volatile metabolites produced by the bacteria can significantly inhibit the growth of citrus green mold pathogens and effectively reduce the incidence of green mold disease in citrus fruits. Strain H114 also has a good inhibitory effect on a variety of pathogenic fungi including citrus acid rot fungi, citrus penicillium, gray mold and Botrytis cinerea, and has potential application value in the biological control of citrus green mold diseases. The strain H114 has a simple culture method and a fast growth and reproduction rate. In the application of inhibiting post-harvest green mold pathogens in citrus, the operation is simple and the effect is good. It is a feasible biocontrol strain suitable for W Murcott fruit storage. For relevant information, see Table 1 (Schematic diagram of the antibacterial spectrum of strain H114 moss and sterile fermentation filtrate)

[0052] It should be understood that those skilled in the art can make improvements or changes based on the above description, and all these improvements and changes should fall within the scope of protection of the appended claims of the present invention.

[0053] Table 1 Schematic diagram of the antibacterial spectrum of strain h114 moss and sterile fermentation filtrate

[0054]

[0055] Note: When the biocontrol bacterium h114 and the strains A31-2-1, BD, and DA were cultured side by side, "+" indicates an inhibitory effect and "-" indicates no inhibitory effect.

Claims

1. A Streptomyces griseus h114, characterized in that: Streptomyces griseochromogenes, deposit number: CCTCC NO:M20221539.

2. The use of a Streptomyces griseus h114 according to claim 1 in the preparation of a drug for treating or preventing the pathogenic bacteria of post-harvest green mold disease of citrus, the steps of which are: (1) inoculating strain h114 into NB liquid culture medium, shaking and culturing at 150 rpm in a shaker at 25°C for 36 hours, and collecting the fermentation liquid after filtering through a 0.1 mm filter; (2) selecting mature citrus fruits without obvious mechanical damage, immersing them in the diluted fermentation liquid collected by strain h114 for 1 minute, naturally air-drying them, bagging them, and storing them in a ventilated warehouse; after 88-92 days, the incidence rate of the stored fruits was counted.

Images