Method for establishing a rat with conditional knockout of mtDNA-encoded genes

Abstract

The present invention provides a method for establishing a rat with conditional knockout of mtDNA-encoded genes. By using the DdCBE base editing tool, the codons TGA (encoding amino acid W) or CAA (encoding amino acid Q) of the rat mtDNA-encoded genes are converted into the stop codon TAA, resulting in premature termination of translation. Through the CRISPR / Cas9 technology, the Cre-dependent expression LSL-DdCBE element is knocked into the Rosa26 locus of rats to establish a rat with conditional knockout of mtDNA-encoded genes. By crossing with Cre tool rats, the expression and editing of DdCBE are activated, thereby achieving tissue- or cell-specific knockout of mtDNA-encoded genes. In view of the technical limitations of mtDNA-encoded gene knockout, the present invention develops a method capable of conditionally knocking out mtDNA-encoded genes in rats through the combined application of the DdCBE tool and the Cre-loxP system.

Description

Technical Field

[0001] The present invention belongs to the field of animal gene genetic modification, and specifically relates to a method for knocking out and conditionally knocking out mtDNA-encoded genes in rats. Background Art

[0002] Mitochondria are the only organelles with genetic material (mitochondrial DNA, mtDNA) independent of the nuclear genome. MtDNA encodes 13 proteins, 22 tRNAs, and 2 rRNAs. These 13 mtDNA-encoded proteins, as the core subunits of mitochondrial complexes, are crucial for maintaining mitochondrial homeostasis. MtDNA mutations ultimately affect the expression of mtDNA-encoded proteins, leading to mitochondrial dysfunction. However, there is currently no technology that can successfully knockout mtDNA-encoded proteins in vivo. Therefore, focusing on the 13 mtDNA-encoded genes and establishing a method for knocking out and conditionally knocking out mtDNA-encoded proteins in rats is crucial for understanding the biological functions of mtDNA-encoded proteins and their mechanisms in diseases for the drug development of mitochondrial diseases.

[0003] In recent years, a tool based on bacterial double-stranded DNA deaminase - DdCBE - has been successfully used for the C·G to T·A base conversion of mtDNA. The emergence of this technology provides the possibility for targeted establishment of rat mtDNA mutation models. Using this technology, we previously successfully established a rat model with mtDNA mutations and showed phenotypic characteristics of human mitochondrial diseases. However, this technology has not been reported to be applied to the knockout of mtDNA-encoded proteins and the establishment of related animal models. Summary of the Invention

[0004] The purpose of the present invention is to establish a method for knocking out and conditionally knocking out mtDNA-encoded genes in rats for non-therapeutic or diagnostic purposes.

[0005] According to the first aspect of the present invention, a method for knocking out mtDNA-encoded genes in rats is provided, including:

[0006] According to the target gene, select the codon TGA or CAA near the 5'-end of the reading frame of the mtDNA-encoded gene as the DdCBE recognition target site, and select a TALE recognition sequence upstream and downstream of it respectively. The interval length between the two TALE recognition sequences is 7-18bp, and the two TALE recognition target sequences together with the interval sequence define the target mutation sequence;

[0007] Screen a pair of DdCBE combinations according to the selected TALE recognition target sequences for knocking out and conditionally knocking out mtDNA-encoded genes in rats.

[0008] The target sites and DdCBE combinations for knocking out mtDNA-encoded genes in rats are as follows:

[0009] Nd1 G2996:

[0010] MTS-N-1366aa-RVDarray-C-G1333C-UGI + MTS-N-1366aa-RVDarray-C-G1333N-UGI (L1333C + R1333N)

[0011] Nd2 G3992: L1333C + R1333N

[0012] Nd3 C9526: L1397C + R1397N

[0013] Nd4 G10230: L1333C + R1333N

[0014] Nd5 G11938: L1333C + R1333N

[0015] Nd6 G13817: L1333N + R1333C

[0016] Cytb G14365: L1333C + R1333N

[0017] Cox1 G5396: L1333C + R1333N

[0018] Cox2 C7021: L1333N + R1333C

[0019] Cox3 G8645: L1333C + R1333N

[0020] Atp6 G8121: L1333C + R1333N

[0021] Atp8 G7783: L1333C + R1333N.

[0022] According to another aspect of the present invention, there is provided an application of the above method in constructing a rat cell line with knockout of Nd1 and Nd2.

[0023] According to still another aspect of the present invention, there is provided a method for establishing a rat with conditional knockout of mtDNA-encoded genes, comprising:

[0024] Connecting the above-mentioned target gene locus-specific L-DdCBE and R-DdCBE sequences through a P2A sequence to construct an L-DdCBE-P2A-R-DdCBE element;

[0025] Clone the L-DdCBE-P2A-R-DdCBE element into the Rosa26-HR-CAG-LSL vector to construct the Rosa26-HR-CAG-LSL-DdCBE expression vector.

[0026] The present invention can be applied to the establishment of Nd1 conditional knockout rats.

[0027] The Nd1 conditional knockout rats established by the method of the present invention are mated with wild-type rats, and the transmission of modified genes can be detected in the offspring rats.

[0028] The Nd1 conditional knockout rats established by the method of the present invention are hybridized with heart tissue-specific Cre (α-MHC-Cre) rats and applied to achieve heart tissue-specific Nd1 gene knockout. Through the analysis of the heart function phenotype of heart tissue-specific Nd1 gene knockout rats, it is applied to the functional study of this gene in the heart.

[0029] According to other aspects of the present invention, there is also provided the application of the above method to the knockout of mtDNA-encoded genes in different tissues, organs or cell types.

[0030] According to other aspects of the present invention, there is also provided a kit containing reagents for achieving the above gene knockout. Brief Description of the Drawings

[0031] Figure 1 Schematic diagram of introducing premature termination codons using DdCBE

[0032] Figure 2 Design of knockout targets for mtDNA-encoded genes in rats

[0033] Figure 3 Comparison of editing efficiencies of different DdCBE combinations

[0034] Figure 4 Detection of the expression of mtDNA-encoded proteins ND1 and ND2 in C6 cells

[0035] Figure 5 Detection of the oxidative phosphorylation level of mtDNA-encoded proteins ND1 and ND2 knocked out in C6 cells

[0036] Figure 6 Schematic diagram of the construction of LSL-DdCBE KI rats

[0037] Figure 7 Genotype identification of LSL-DdCBE-Nd1 KI F0 rats

[0038] Figure 8 Passage detection of LSL-DdCBE-Nd1 KI F0 rats

[0039] Figure 9 Detection of Nd1 knockout specificity and knockout efficiency in heart tissue

[0040] Figure 10 Survival curve of rats with specific knockout of Nd1 in heart tissue

[0041] Figure 11 Analysis of cardiac function in rats with specific knockout of Nd1 in heart tissue Specific implementation manners

[0042] First, according to the strategy of mutating mitochondrial codons TGA / CAA into stop codon TAA (see Figure 1 ), the following target sites were selected in the rat mtDNA-encoded genes: Nd1 G2996, Nd2 G3992, Nd3 C9526, Nd4 G10230, Nd5 G11938, Nd6 G13817, Cytb G14365, Cox1 G5396, Cox2 C7021, Cox3 G8645, Atp6 G8121, Atp8 G7783, and the recognition sequences of TALE were designed (see Figure 2 ).

[0043] According to the recognition principle of TALE, one TALE recognition site was selected upstream and downstream of the target site respectively. The intervening sequence between the two TALE recognition sites was 7-18 bp, which needed to contain the target mutated base C, and at the same time, the base C other than the target base was avoided in the intervening sequence.

[0044] The DdCBEs fused with two TALE recognition sites were localized to the corresponding target mutated sequences, and the target mutation G was edited into A, so as to introduce a stop codon in advance in the rat mtDNA-encoded genes;

[0045] For the sites of rat Nd1 G2996, Nd2 G3992, Nd3 C9526, Nd4 G10230, Nd5 G11938, Nd6 G13817, Cytb G14365, Cox1 G5396, Cox2 C7021, Cox3 G8645, Atp6 G8121, Atp8 G7783, the left and right TALE recognition sequences selected by the present invention are as follows:

[0046] Nd1 G2996:

[0047] Left: TACACTAGCTCTAA (SEQ ID NO.1)

[0048] Right: GTTATGGAGTGGGGGAA (SEQ ID NO.2)

[0049] Nd2 G3992:

[0050] Left: CTAGCTCCAACTTACT (SEQ ID NO.3)

[0051] Right: TAACCTTTATTCGGAAAA (SEQ ID NO.4)

[0052] Nd3 C9526:

[0053] Left: CCTCATTTCAATTGCATT (SEQ ID NO.5)

[0054] Right: TGAATATGAGGCTTTTTCG (SEQ ID NO.6)

[0055] Nd4 G10230:

[0056] Left: GACTCTCAGCCAACAAAA (SEQ ID NO.7)

[0057] Right: TGGAGGATGTCGAAAGA (SEQ ID NO.8)

[0058] Nd5 G11938:

[0059] Left: ATATAATTACTAACT (SEQ ID NO.9)

[0060] Right: TTAAGATAATTTGAA (SEQ ID NO.10)

[0061] Nd6 G13817:

[0062] Left: AAAAATAAACCAATT (SEQ ID NO.11)

[0063] Right: GCCCATGAGGAGTCA (SEQ ID NO.12)

[0064] Cytb G14365:

[0065] Left: GCCGAGACGTAAACT (SEQ ID NO.13)

[0066] Right: ATGGATGTGCGGT (SEQ ID NO.14)

[0067] Cox1 G5396:

[0068] Left: CTACCTATTATTTGG (SEQ ID NO.15)

[0069] Right: CATCCCTGTCGAAATTCA (SEQ ID NO.16)

[0070] Cox2 C7021:

[0071] Left: ATATATCTTACATGGCTT (SEQ ID NO.17)

[0072] Right: GAATGTTCTGCGGTGTAG (SEQ ID NO.18)

[0073] Cox3 G864:

[0074] Left: ACCATATAGTAAACCCA (SEQ ID NO.19)

[0075] Right: TTGTCCTCGGGATAG (SEQ ID NO.20)

[0076] Atp6 G8121:

[0077] Left: CCACACACCAAAAGGA (SEQ ID NO.21)

[0078] Right: ATTAACATAGGGATTAA (SEQ ID NO.22)

[0079] Atp8 G7783:

[0080] Left: GCCACAACTAGACACAT (SEQ ID NO.23)

[0081] Right: TTAGTAGAGGAGTTA (SEQ ID NO.24)

[0082] For the selected TALE target sequences above, different DdCBEs were constructed, and the corresponding DdCBEs are as follows:

[0083] Rat Nd1 G2996 Left TALE-G1333C (SEQ ID NO.25);

[0084] Rat Nd1 G2996 Right TALE-G1333N (SEQ ID NO.26);

[0085] Rat Nd1 G2996 Left TALE-G1397C (SEQ ID NO.27);

[0086] Rat Nd1 G2996 Right TALE-G1397N(SEQ ID NO.28);

[0087] Rat Nd1 G2996 Left TALE-G1333N(SEQ ID NO.29);

[0088] Rat Nd1 G2996 Right TALE-G1333C(SEQ ID NO.30);

[0089] Rat Nd1 G2996 Left TALE-G1397N(SEQ ID NO.31);

[0090] Rat Nd1 G2996 Right TALE-G1397C(SEQ ID NO.32);

[0091] Rat Nd2 G3992 Left TALE-G1333C(SEQ ID NO.33);

[0092] Rat Nd2 G3992 Right TALE-G1333N(SEQ ID NO.34);

[0093] Rat Nd2 G3992 Left TALE-G1397C(SEQ ID NO.35);

[0094] Rat Nd2 G3992 Right TALE-G1397N(SEQ ID NO.36);

[0095] Rat Nd2 G3992 Left TALE-G1333N(SEQ ID NO.37);

[0096] Rat Nd2 G3992 Right TALE-G1333C(SEQ ID NO.38);

[0097] Rat Nd2 G3992 Left TALE-G1397N(SEQ ID NO.39);

[0098] Rat Nd2 G3992 Right TALE-G1397C(SEQ ID NO.40);

[0099] Rat Nd3 C9526 Left TALE-G1333C(SEQ ID NO.41);

[0100] Rat Nd3 C9526 Right TALE-G1333N (SEQ ID NO.42);

[0101] Rat Nd3 C9526 Left TALE-G1397C (SEQ ID NO.43);

[0102] Rat Nd3 C9526 Right TALE-G1397N (SEQ ID NO.44);

[0103] Rat Nd3 C9526 Left TALE-G1333N (SEQ ID NO.45);

[0104] Rat Nd3 C9526 Right TALE-G1333C (SEQ ID NO.46);

[0105] Rat Nd3 C9526 Left TALE-G1397N (SEQ ID NO.47);

[0106] Rat Nd3 C9526 Right TALE-G1397C (SEQ ID NO.48);

[0107] Rat Nd4 G10230 Left TALE-G1333C (SEQ ID NO.49);

[0108] Rat Nd4 G10230 Right TALE-G1333N (SEQ ID NO.50);

[0109] Rat Nd4 G10230 Left TALE-G1397C (SEQ ID NO.51);

[0110] Rat Nd4 G10230 Right TALE-G1397N (SEQ ID NO.52);

[0111] Rat Nd4 G10230 Left TALE-G1333N (SEQ ID NO.53);

[0112] Rat Nd4 G10230 Right TALE-G1333C (SEQ ID NO.54);

[0113] Rat Nd4 G10230 Left TALE-G1397N(SEQ ID NO.55);

[0114] Rat Nd4 G10230 Right TALE-G1397C(SEQ ID NO.56);

[0115] Rat Nd5 G11938 Left TALE-G1333C(SEQ ID NO.57);

[0116] Rat Nd5 G11938 Right TALE-G1333N(SEQ ID NO.58);

[0117] Rat Nd5 G11938 Left TALE-G1397C(SEQ ID NO.59);

[0118] Rat Nd5 G11938 Right TALE-G1397N(SEQ ID NO.60);

[0119] Rat Nd5 G11938 Left TALE-G1333N(SEQ ID NO.61);

[0120] Rat Nd5 G11938 Right TALE-G1333C(SEQ ID NO.62);

[0121] Rat Nd5 G11938 Left TALE-G1397N(SEQ ID NO.63);

[0122] Rat Nd5 G11938 Right TALE-G1397C(SEQ ID NO.64);

[0123] Rat Nd6 G13817 Left TALE-G1333C(SEQ ID NO.65);

[0124] Rat Nd6 G13817 Right TALE-G1333N(SEQ ID NO.66);

[0125] Rat Nd6 G13817 Left TALE-G1397C(SEQ ID NO.67);

[0126] Rat Nd6 G13817 Right TALE-G1397N(SEQ ID NO.68);

[0127] Rat Nd6 G13817 Left TALE-G1333N(SEQ ID NO.69);

[0128] Rat Nd6 G13817 Right TALE-G1333C(SEQ ID NO.70);

[0129] Rat Nd6 G13817 Left TALE-G1397N(SEQ ID NO.71);

[0130] Rat Nd6 G13817 Right TALE-G1397C(SEQ ID NO.72);

[0131] Rat Cytb G14365 Left TALE-G1333C(SEQ ID NO.73);

[0132] Rat Cytb G14365 Right TALE-G1333N(SEQ ID NO.74);

[0133] Rat Cytb G14365 Left TALE-G1397C(SEQ ID NO.75);

[0134] Rat Cytb G14365 Right TALE-G1397N(SEQ ID NO.76);

[0135] Rat Cytb G14365 Left TALE-G1333N(SEQ ID NO.77);

[0136] Rat Cytb G14365 Right TALE-G1333C(SEQ ID NO.78);

[0137] Rat Cytb G14365 Left TALE-G1397N(SEQ ID NO.79);

[0138] Rat Cytb G14365 Right TALE-G1397C(SEQ ID NO.80);

[0139] Rat Cox1 G5396 Left TALE-G1333C(SEQ ID NO.81);

[0140] Rat Cox1 G5396 Right TALE-G1333N(SEQ ID NO.82);

[0141] Rat Cox1 G5396 Left TALE-G1397C(SEQ ID NO.83);

[0142] Rat Cox1 G5396 Right TALE-G1397N(SEQ ID NO.84);

[0143] Rat Cox1 G5396 Left TALE-G1333N(SEQ ID NO.85);

[0144] Rat Cox1 G5396 Right TALE-G1333C(SEQ ID NO.86);

[0145] Rat Cox1 G5396 Left TALE-G1397N(SEQ ID NO.87);

[0146] Rat Cox1 G5396 Right TALE-G1397C(SEQ ID NO.88);

[0147] Rat Cox2 C7021 Left TALE-G1333C(SEQ ID NO.89);

[0148] Rat Cox2 C7021 Right TALE-G1333N(SEQ ID NO.90);

[0149] Rat Cox2 C7021 Left TALE-G1397C(SEQ ID NO.91);

[0150] Rat Cox2 C7021 Right TALE-G1397N(SEQ ID NO.92);

[0151] Rat Cox2 C7021 Left TALE-G1333N(SEQ ID NO.93);

[0152] Rat Cox2 C7021 Right TALE-G1333C(SEQ ID NO.94);

[0153] Rat Cox2 C7021 Left TALE-G1397N(SEQ ID NO.95);

[0154] Rat Cox2 C7021 Right TALE-G1397C(SEQ ID NO.96);

[0155] Rat Cox3 G8645 Left TALE-G1333C(SEQ ID NO.97);

[0156] Rat Cox3 G8645 Right TALE-G1333N(SEQ ID NO.98);

[0157] Rat Cox3 G8645 Left TALE-G1397C(SEQ ID NO.99);

[0158] Rat Cox3 G8645 Right TALE-G1397N(SEQ ID NO.100);

[0159] Rat Cox3 G8645 Left TALE-G1333N(SEQ ID NO.101);

[0160] Rat Cox3 G8645 Right TALE-G1333C(SEQ ID NO.102);

[0161] Rat Cox3 G8645 Left TALE-G1397N(SEQ ID NO.103);

[0162] Rat Cox3 G8645 Right TALE-G1397C(SEQ ID NO.104);

[0163] Rat Atp6 G8121 Left TALE-G1333C(SEQ ID NO.105);

[0164] Rat Atp6 G8121 Right TALE-G1333N(SEQ ID NO.106);

[0165] Rat Atp6 G8121 Left TALE-G1397C(SEQ ID NO.107);

[0166] Rat Atp6 G8121 Right TALE-G1397N(SEQ ID NO.108);

[0167] Rat Atp6 G8121 Left TALE-G1333N(SEQ ID NO.109);

[0168] Rat Atp6 G8121 Right TALE-G1333C(SEQ ID NO.110);

[0169] Rat Atp6 G8121 Left TALE-G1397N(SEQ ID NO.111);

[0170] Rat Atp6 G8121 Right TALE-G1397C(SEQ ID NO.112);

[0171] Rat Atp8 G7783 Left TALE-G1333C(SEQ ID NO.113);

[0172] Rat Atp8 G7783 Right TALE-G1333N(SEQ ID NO.114);

[0173] Rat Atp8 G7783 Left TALE-G1397C(SEQ ID NO.115);

[0174] Rat Atp8 G7783 Right TALE-G1397N(SEQ ID NO.116);

[0175] Rat Atp8 G7783 Left TALE-G1333N(SEQ ID NO.117);

[0176] Rat Atp8 G7783 Right TALE-G1333C(SEQ ID NO.118);

[0177] Rat Atp8 G7783 Left TALE-G1397N(SEQ ID NO.119);

[0178] Rat Atp8 G7783 Right TALE-G1397C(SEQ ID NO.120);

[0179] The highly efficient combined L-DdCBE and R-DdCBE were respectively cloned into the PB transposon expression vector for the knockout of rat mtDNA-encoded genes.

[0180] The highly efficient combination of L-DdCBE and R-DdCBE was ligated with P2A and cloned into the PB-HR-CAG-LSL vector to construct the PB-HR-CAG-LSL-DdCBE expression vector for conditional knockout of mtDNA-encoded genes in rats.

[0181] Using the CRISPR / Cas9 technology, the CAG-LSL-DdCBE element was inserted into the Rosa26 locus of rats by microinjection of rat fertilized eggs to construct LSL-DdCBE KI rats.

[0182] Example 1

[0183] Knockout of mtDNA-encoded genes mediated by DdCBE was performed on rat cell lines. According to the conventional operation, gene editing of cell lines (by electroporation or liposome transfection) was carried out, taking electroporation as an example.

[0184] (1) Taking C6 cells as an example, the present invention carried out the culture and transfection of eukaryotic cells: C6 cells were inoculated into a six-well cell culture plate and cultured in DMEM high-glucose culture medium supplemented with 10% FBS, penicillin (100 U / mL), and streptomycin (100 μg / mL).

[0185] (2) Cell transfection was carried out when the cell density reached 70%-80%.

[0186] The plasmid combinations of the DdCBE system are as follows:

[0187] A1: Rat Nd1 G2996 Left TALE-G1333C / Rat Nd1 G2996 Right TALE-G1333N (L1333C+R1333N);

[0188] A2: Rat Nd1 G2996 Left TALE-G1397C / Rat Nd1 G2996 Right TALE-G1397N (L1397C+R1397N);

[0189] A3: Rat Nd1 G2996 Left TALE-G1333N / Rat Nd1 G2996 Right TALE-G1333C (L1333N+R1333C);

[0190] A4: Rat Nd1 G2996 Left TALE-G1397N / Rat Nd1 G2996 Right TALE-G1397C (L1397N+R1397C);

[0191] B1: Rat Nd2 G3992 Left TALE-G1333C / Rat Nd2 G3992 Right TALE-G1333N (L1333C+R1333N);

[0192] B2: Rat Nd2 G3992 Left TALE-G1397C / Rat Nd2 G3992 Right TALE-G1397N (L1397C+R1397N);

[0193] B3: Rat Nd2 G3992 Left TALE-G1333N / Rat Nd2 G3992 Right TALE-G1333C (L1333N+R1333C);

[0194] B4: Rat Nd2 G3992 Left TALE-G1397N / Rat Nd2 G3992 Right TALE-G1397C (L1397N+R1397C);

[0195] C1: Rat Nd3 C9526 Left TALE-G1333C / Rat Nd3 C9526 Right TALE-G1333N (L1333C+R1333N);

[0196] C2: Rat Nd3 C9526 Left TALE-G1397C / Rat Nd3 C9526 Right TALE-G1397N (L1397C+R1397N);

[0197] C3: Rat Nd3 C9526 Left TALE-G1333N / Rat Nd3 C9526 Right TALE-G1333C (L1333N+R1333C);

[0198] C4: Rat Nd3 C9526 Left TALE-G1397N / Rat Nd3 C9526 Right TALE-G1397C (L1397N+R1397C);

[0199] D1: Rat Nd4 G10230 Left TALE-G1333C / Rat Nd4 G10230 Right TALE-G1333N (L1333C+R1333N);

[0200] D2: Rat Nd4 G10230 Left TALE - G1397C / Rat Nd4 G10230 Right TALE - G1397N (L1397C + R1397N);

[0201] D3: Rat Nd4 G10230 Left TALE - G1333N / Rat Nd4 G10230 Right TALE - G1333C (L1333N + R1333C);

[0202] D4: Rat Nd4 G10230 Left TALE - G1397N / Rat Nd4 G10230 Right TALE - G1397C (L1397N + R1397C);

[0203] E1: Rat Nd5 G11938 Left TALE - G1333C / Rat Nd5 G11938 Right TALE - G1333N (L1333C + R1333N);

[0204] E2: Rat Nd5 G11938 Left TALE - G1397C / Rat Nd5 G11938 Right TALE - G1397N (L1397C + R1397N);

[0205] E3: Rat Nd5 G11938 Left TALE - G1333N / Rat Nd5 G11938 Right TALE - G1333C (L1333N + R1333C);

[0206] E4: Rat Nd5 G11938 Left TALE - G1397N / Rat Nd5 G11938 Right TALE - G1397C (L1397N + R1397C);

[0207] F1: Rat Nd6 G13817 Left TALE - G1333C / Rat Nd6 G13817 Right TALE - G1333N (L1333C + R1333N);

[0208] F2: Rat Nd6 G13817 Left TALE - G1397C / Rat Nd6 G13817 Right TALE - G1397N (L1397C + R1397N);

[0209] F3: Rat Nd6 G13817 Left TALE - G1333N / Rat Nd6 G13817 Right TALE - G1333C (L1333N + R1333C);

[0210] F4: Rat Nd6 G13817 Left TALE - G1397N / Rat Nd6 G13817 Right TALE - G1397C (L1397N + R1397C);

[0211] G1: Rat Cytb G14365 Left TALE - G1333C / Rat Cytb G14365 Right TALE - G1333N (L1333C + R1333N);

[0212] G2: Rat Cytb G14365 Left TALE - G1397C / Rat Cytb G14365 Right TALE - G1397N (L1397C + R1397N);

[0213] G3: Rat Cytb G14365 Left TALE - G1333N / Rat Cytb G14365 Right TALE - G1333C (L1333N + R1333C);

[0214] G4: Rat Cytb G14365 Left TALE - G1397N / Rat Cytb G14365 Right TALE - G1397C (L1397N + R1397C);

[0215] H1: Rat Cox1 G5396 Left TALE - G1333C / Rat Cox1 G5396 Right TALE - G1333N (L1333C + R1333N);

[0216] H2: Rat Cox1 G5396 Left TALE - G1397C / Rat Cox1 G5396 Right TALE - G1397N (L1397C + R1397N);

[0217] H3: Rat Cox1 G5396 Left TALE - G1333N / Rat Cox1 G5396 Right TALE - G1333C (L1333N + R1333C);

[0218] H4: Rat Cox1 G5396 Left TALE-G1397N / Rat Cox1 G5396 Right TALE-G1397C (L1397N+R1397C);

[0219] I1: Rat Cox2 C7021 Left TALE-G1333C / Rat Cox2 C7021 Right TALE-G1333N (L1333C+R1333N);

[0220] I2: Rat Cox2 C7021 Left TALE-G1397C / Rat Cox2 C7021 Right TALE-G1397N (L1397C+R1397N);

[0221] I3: Rat Cox2 C7021 Left TALE-G1333N / Rat Cox2 C7021 Right TALE-G1333C (L1333N+R1333C);

[0222] I4: Rat Cox2 C7021 Left TALE-G1397N / Rat Cox2 C7021 Right TALE-G1397C (L1397N+R1397C);

[0223] J1: Rat Cox3 G8645 Left TALE-G1333C / Rat Cox3 G8645 Right TALE-G1333N (L1333C+R1333N);

[0224] J2: Rat Cox3 G8645 Left TALE-G1397C / Rat Cox3 G8645 Right TALE-G1397N (L1397C+R1397N);

[0225] J3: Rat Cox3 G8645 Left TALE-G1333N / Rat Cox3 G8645 Right TALE-G1333C (L1333N+R1333C);

[0226] J4: Rat Cox3 G8645 Left TALE-G1397N / Rat Cox3 G8645 Right TALE-G1397C (L1397N+R1397C);

[0227] K1: Rat Atp6 G8121 Left TALE-G1333C / Rat Atp6 G8121 Right TALE-G1333N (L1333C+R1333N);

[0228] K2: Rat Atp6 G8121Left TALE-G1397C / Rat Atp6 G8121 Right TALE-G1397N (L1397C+R1397N);

[0229] K3: Rat Atp6 G8121 Left TALE-G1333N / Rat Atp6 G8121 Right TALE-G1333C (L1333N+R1333C);

[0230] K4: Rat Atp6 G8121 Left TALE-G1397N / Rat Atp6 G8121 Right TALE-G1397C (L1397N+R1397C);

[0231] L1: Rat Atp8 G7783 Left TALE-G1333C / Rat Atp8 G7783 Right TALE-G1333N (L1333C+R1333N);

[0232] L2: Rat Atp8 G7783 Left TALE-G1397C / Rat Atp8 G7783 Right TALE-G1397N (L1397C+R1397N);

[0233] L3: Rat Atp8 G7783 Left TALE-G1333N / Rat Atp8 G7783 Right TALE-G1333C (L1333N+R1333C);

[0234] L4: Rat Atp8 G7783 Left TALE-G1397N / Rat Atp8 G7783 Right TALE-G1397C (L1397N+R1397C);

[0235] (3) Transfection is exemplified by electroporation. According to the operation manual of SF Cell Line 4D-Nucleofector Ⅹ Kit (V4XC-2024, Lonza), taking combination A1 as an example, 400 ng of Rat Nd1 G2996 Left TALE-G1333C (L1333C) plasmid and 400 ng of Rat Nd1 G2996 Right TALE-G1333N (R1333N) plasmid were mixed and co-transfected into 2×10 5 cells. Then the cells were seeded into a 12-well plate for culture. After 24 hours, puromycin (final concentration 0.6 μg / mL) was added, and the cells were harvested after 72 hours.

[0236] (4) Genotype analysis

[0237] A. After collecting some cells and lysing and digesting them with 100 μg / ml proteinase K in lysis buffer (10 μM Tris-HCl, 0.4 M NaCl, 2 μM EDTA, 1% SDS), they were extracted with phenol-chloroform and dissolved in 50 μl of deionized water.

[0238] B. Use primers rND1KO-Fwd (ATGGCCTTCCTCACCCTAGT), rND1KO-Rev (AATAGGGCGAATGGTCCTGC); rND2KO-Fwd (GGCCCATACCCCGAAAATGT), rND2KO-Rev (TCCTTGGGTGACTTCGGGTA); rND3KO-Fwd (CGCAGCATGATACTGACACT), rND3KO-Rev (GTGCAGAACTTGTTGGGTCG); rND4KO-Fwd (TGCGAAGCAGCAGTAGGTTTA), rND4KO-Rev (AAGCGTTCTGTTTGGTTGCC); rND5KO-Fwd (ACCTTGGTGCAACTCCAAAT), rND5KO-Rev (CGGTTAATGTGGGGATCAGAGT); rND6KO-Fwd (GCATCCTAGCAGGCTTCCTT), rND6KO-Rev (GGTTGTCTAGGGTTGGCGTT); rCYTBKO-Fwd (CCCGCCCCATCTAACATCTC), rCYTBKO-Rev (AGAAGCGTGTTAGGGTTGCT); rCOX1KO-Fwd (AGGCGGGAGAAGCCTTAGTA), rCOX1KO-Rev (AGATAGAAGACACCCCGGCT); rCOX2KO-Fwd (AGCCTTCGCATCAAAACGAG), rCOX2KO-Rev (TAGGTGATGTGGCGTCTTGT); rCOX3KO-Fwd (TTCTTACCGCAAGGAACCCC), rCOX3KO-Rev (TGGTGGCCTTGGTATGTTCC); rATP6KO-Fwd (TCCCAAACCTTTCCTGCACC), rATP6KO-Rev (TCCTTGCGGTAAGAAGTGGG); rATP8KO-Fwd (CCCGCCCCATCTAACATCTC), rATP8KO-Rev (AGAAGCGTGTTAGGGTTGCT); perform PCR amplification, and purify to obtain the PCR recovery product using the AxyPrep PCR cleanup kit (AXYGEN, AP-PCR-250G). The PCR reaction system is as follows:

[0239] 300 - 400 ng genomic DNA

[0240] 25 μL 2×Buffer

[0241] 1 μL dNTP mix

[0242] 2 μL Fwd (20 μM)

[0243] 2 μL Rev (20 μM)

[0244] 1 μL DNA Polymerase (Vazyme, P505 - d3)

[0245] Add H2O to make a 50 μL system.

[0246] C. Ligate the obtained PCR - recovered product to a cloning vector - Blunt Cloning Kit (TransGen, CB 101), and the ligation reaction system is as follows:

[0247] 2 μL PCR product

[0248] 1 μL - Blunt Cloning vector

[0249] Gently mix and react at room temperature (20 - 37 °C) for 5 minutes. After the reaction, place the centrifuge tube on ice.

[0250] Transform the ligation product into Trans5α competent cells (TransGen, CD201).

[0251] D. Pick colonies and sequence the target gene mutations with the universal primer M13 - F. The sequencing results are as follows (italicized, bold, gray, underlined represent mutated bases):

[0252] Mutation situation of Nd1 G2996 target:

[0253] Wt: tatgaat

[0254] Mut:

[0255] Mutation situation of Nd2 G3992 target:

[0256] Wt: tatgagt

[0257] Mut:

[0258] Mutation situation of Nd3 C9526 target:

[0259] Wt: cctcaaa

[0260] Mut:

[0261] Mutation situation of Nd4 G10230 target:

[0262] Wt: tctgaac

[0263] Mut:

[0264] Mutation situation of Nd5 G11938 target:

[0265] Wt: attgact

[0266] Mut:

[0267] Mutation situation of Nd6 G13817 target:

[0268] Wt: cttgagg

[0269] Mut:

[0270] Mutation situation of Cytb G14365 target:

[0271] Wt: gctgact

[0272] Mut:

[0273] Mutation situation of Cox1 G5396 target:

[0274] Wt: cctgagc

[0275] Mut:

[0276] Mutation situation of Cox2 C7021 target:

[0277] Wt: tttcaac

[0278] Mut:

[0279] Mutation situation of Cox3 G8645 target:

[0280] Wt: catgacc

[0281] Mut:

[0282] Mutation situation of Atp6 G8121 target:

[0283] Wt: cctgagc

[0284] Mut:

[0285] Mutation situation of Atp8 G7783 target:

[0286] Wt: catgatt

[0287] Mut:

[0288] The optimal combination of mitochondrial gene DdCBE is as follows ( Figure 3 ):

[0289] Nd1 G2996: L1333C + R1333N

[0290] Nd2 G3992: L1333C + R1333N

[0291] Nd3 C9526: L1397C + R1397N

[0292] Nd4 G10230: L1333C + R1333N

[0293] Nd5 G11938: L1333C + R1333N

[0294] Nd6 G13817: L1333N + R1333C

[0295] Cytb G14365: L1333C + R1333N

[0296] Cox1 G5396: L1333C + R1333N

[0297] Cox2 C7021: L1333N + R1333C

[0298] Cox3 G8645: L1333C + R1333N

[0299] Atp6 G8121: L1333C + R1333N

[0300] Atp8 G7783: L1333C + R1333N

[0301] (5) Protein expression detection

[0302] A. Take part of the cells and lyse them on ice for 30 minutes in RIPA lysis buffer (P0013B, Beyotime) containing protease inhibitor (P1006, Beyotime), then centrifuge at 13000 rpm at 4°C for 30 minutes, and collect the supernatant.

[0303] B. Determine the protein concentration using the Coomassie Brilliant Blue method and adjust its concentration to 5 μg / μL with the lysis buffer. Take 40 μL and transfer it to a 0.6 mL EP tube, add 10 μL of 5× loading buffer, mix well, boil in boiling water for 10 min, and mix well for standby.

[0304] C. Perform 10% SDS-PAGE, and add 10 μL of the sample and 5 μL of the prestained Marker to each well. Electrophorese at a constant voltage of 80 V for 30 min, and adjust the voltage to 120 V for constant voltage electrophoresis after the Marker is separated; according to the position of the Marker, stop electrophoresis when the electrophoresis indicating band reaches the lower 1 / 3 of the separating gel.

[0305] D. Transfer the membrane by wet transfer method, transfer at a constant current of 300 mA for 60 min, place ice packs in the electrotransfer device, and replace the ice packs every 45 min.

[0306] E. Block with 5% non-fat milk powder at room temperature for 1 h, and incubate with the primary antibody overnight at 4 °C. The next day, incubate with the secondary antibody after washing for 1 h at room temperature.

[0307] anti-ND1: 19703-1-AP, Proteintech; 1:1000

[0308] anti-ND2: 19703-1-AP, Proteintech; 1:1000

[0309] anti-NDUFA9: ab14713, Abcam; 1:1000

[0310] anti-beta ACTIN: HRP-60008, Proteintech; 1:5000

[0311] F. Detect with ECL (P0018S, Beyotime) luminescent solution, and perform imaging analysis with GelDoc XR+ gel imaging system.

[0312] The results show that: the method of the present invention was successfully applied to establish the knockout of ND1 and ND2 in C6 cells (see Figure 4 ).

[0313] (6) Detection of oxidative phosphorylation level

[0314] A. Inoculate 2×10 4 cells into a seahorse XF96 cell culture plate and culture for 24 hours.

[0315] B. Perform OCR detection with Seahorse XFe96 Extracellular Flux Analyzer. The reagents used in the analysis are as follows: 1 μM oligomycin; 1.5 μM FCCP and 0.5 μM rotenone + 0.5 μM antimycin A.

[0316] The results showed that knocking out ND1 and ND2 in C6 cells could lead to a significant decrease in the mitochondrial oxidative phosphorylation level ( Figure 5 ).

[0317] Example 2

[0318] Taking Nd1 as an example, a conditional knockout rat of Nd1 was established.

[0319] The LSL-DdCBE-Nd1 fragment was knocked into the Rosa26 locus of rats to establish a conditional knockout rat model of Nd1 ( Figure 6 ). Hybridization with tissue- or cell-specific Cre rats was performed to achieve tissue- or cell-type-specific knockout. Taking heart tissue-specific Cre (α-MHC-Cre) as an example, the specific knockout of Nd1 in the heart tissue of this model was verified.

[0320] Rat embryo collection, microinjection, embryo culture, embryo transfer, etc. were carried out according to conventional operations.

[0321] (1) Microinjection: The fertilized eggs were injected with a mixed sample of gRNA + Cas9 protein + PB-HR-CAG-LSL-DdCBE-Nd1 Donor, and embryo transfer was carried out routinely;

[0322] (2) Genotype analysis:

[0323] A. Genomic DNA was extracted by conventional tail clipping / tissue sampling: After lysing and digesting with 100 μg / mL proteinase K in the lysis solution (10 μM Tris-HCl, 0.4 M NaCl, 2 μM EDTA, 1% SDS), it was extracted with phenol-chloroform and dissolved in 50 μL of deionized water.

[0324] B. PCR amplification was performed using the primers Rat-Up-Fwd (GGGTGGCGAAGGTAATGTCT) + Rat-Up-Rev (GCTATGAACTAATGACCCCGTAATT); Rat-Down-Fwd (GCATCTGACTTCTGGCTAATAAAG) + Rat-Down-Rev (CATTAACAGGAAATGGCTCAGTTTATAAATG); Halves Fwd (TTGCGGAGACTCACCCCTT) + HalvesRev (TGTAAACCCATGGCCGAC); rND1KO-Fwd (ATGGCCTTCCTCACCCTAGT) + rND1KO-Rev (AATAGGGCGAATGGTCCTGC). The PCR reaction system was:

[0325] 300 - 400 ng genomic DNA

[0326] 25 μL 2×Buffer

[0327] 1 μL dNTP

[0328] 2 μL Fwd (20 μM)

[0329] 2 μL Rev (20 μM)

[0330] 1 μL DNA Polymerase (Vazyme, P505-d3)

[0331] Make up to a 50 μL system with water.

[0332] C. The PCR products amplified by the Up combination, Down combination, and ND1KO combination were purified using the AxyPrep PCR cleanup kit (AXYGEN, AP-PCR-250G) to obtain PCR recovery products. Connect to the cloning vector -Blunt Cloning Kit (TransGen, CB101). The ligation reaction system is as follows:

[0333] 2 μL PCR product

[0334] 1 μL -Blunt Cloning vector

[0335] Gently mix and react at room temperature (20 - 37 °C) for 5 minutes. After the reaction, place the centrifuge tube on ice.

[0336] Transform the ligation product into Trans5α competent cells (TransGen, CD201).

[0337] D. Pick colonies and use the universal primer M13 for sequencing to detect the homologous arm recombination and target site mutation conditions.

[0338] Mutation situation of the Nd1 G2996 target site:

[0339] Wt: tatgaat

[0340] Mut:

[0341] The results showed that among the 16 founder mice, 14 were LSL-DdCBE-Nd1 KI rats with correct genotype identification ( Figure 7)。We crossed LSL-DdCBE-Nd1 KI rats with wild-type rats and performed genotype identification on the offspring. The results showed that LSL-DdCBE-Nd1 could be stably passed on, and we detected the mutation status of the Nd1 G2996 site in various tissues of the F1 generation animals during passage, but no target mutation was detected( Figure 8 )。

[0342] (3) Crossed the identified LSL-DdCBE-Nd1 KI rats with heart tissue-specific Cre (α-MHC-Cre) rats, and extracted genomic DNA, performed PCR, sequencing analysis, and WB detection on the tissues of the offspring rats. The results showed that only the heart tissue of the rats with double-positive genotypes had the target mutation, and the expression of ND1 in the heart tissue decreased significantly( Figure 9 )。

[0343] (4) Phenotype analysis of heart tissue-specific Nd1 knockout rats

[0344] A. Survival rate analysis

[0345] For the obtained heart tissue-specific Nd1 knockout rats, record their survival time, draw a survival curve, and analyze the effect of heart tissue-specific Nd1 knockout on the lifespan of rats.

[0346] The results showed that compared with wild-type rats, the lifespan of heart tissue-specific Nd1 knockout rats was significantly shortened( Figure 10 )。

[0347] B. Heart function analysis

[0348] For the obtained heart tissue-specific Nd1 knockout rats (7 days old), use echocardiography to detect and analyze the parameters related to the heart structure and function of heart tissue-specific Nd1 knockout rats.

[0349] M-mode echocardiography: Anesthetize the rats with isoflurane and use a small animal micro-ultrasound imaging system (Vevo3100) to observe echocardiograms. Record at least three consecutive cardiac cycles, and then perform parameter measurement and calculation.

[0350] The results of heart structure and function evaluation showed that compared with wild rats, heart tissue-specific Nd1 knockout rats showed heart failure, with an enlarged left ventricular diameter and volume, and a decreased left ventricular systolic function( Figure 11 )。

[0351] In summary, the Nd1 conditional knockout rats established by the method of the present invention can achieve heart tissue-specific Nd1 knockout.

Claims

1. A method for knocking out rat mtDNA-encoded genes, comprising: Linking the L-DdCBE and R-DdCBE sequences through the P2A sequence to construct an L-DdCBE-P2A-R-DdCBE element; Cloning the L-DdCBE-P2A-R-DdCBE element into the Rosa26-HR-CAG-LSL vector to construct a Rosa26-HR-CAG-LSL-DdCBE expression vector; Using the CRISPR / Cas9 technology to insert the CAG-LSL-DdCBE element into the rat Rosa26 locus to construct an LSL-DdCBE KI rat; Selecting the base G in the codon TGA or the base C in the codon CAA near the 5' end of the gene coding frame of rat mtDNA as the target site; Selecting a TALE recognition target sequence respectively upstream and downstream of the target mutant base G / C position. The spacer sequence between the two TALE recognition target sequences is 7-18 bp and does not contain base G / C other than the target mutant base G / C. The two TALE recognition target sequences together with the spacer sequence define the target mutant sequence; Screening for a DdCBE combination that can accurately target the target site and cause efficient C•G-to-T•A conversion, thereby introducing a stop codon TAA into the rat mtDNA-encoded gene, causing premature termination of protein translation, where the target sites and DdCBE combinations for achieving knockout of rat mtDNA-encoded genes are as follows: The target site is: Nd1 G2996, and the two TALE recognition target sequences selected are: the left recognition target sequence is TACACTAGCTCTAA; the right recognition target sequence is GTTATGGAGTGGGGGAA; The selected DdCBE combinations are: Rat as shown in SEQ ID NO.25 in the Sequence Listing Nd1 G2996 LeftTALE-G1333C and Rat Nd1 G2996 Right TALE-G1333N as shown in SEQ ID NO.26 in the Sequence Listing.

2. The method according to claim 1, characterized in that, The knockout is carried out in the rat cell line C6.

3. The method according to claim 1, characterized in that, This method is carried out in rat fertilized eggs.

Images