A high-throughput screening method for amylase-producing filamentous fungi and its application

Abstract

The present invention discloses a high-throughput screening method for amylase-producing filamentous fungi and its application, belonging to the technical field of high-throughput screening. The method provided by the present invention can sort out three cell groups of saccharomyces cerevisiae, pichia pastoris and filamentous fungi in the same batch, and is not limited to saccharomyces cerevisiae; and the strain with high amylase activity obtained by the present method has a low impact on the microbial community, maintaining the original flavor of the wine. At the same time, the present invention screened a strain of Monascus purpureus, which can increase the alcohol flavor substances other than ethanol in the mash by 4.36 times, and the content of esters by 3.30 times; the content of aldehydes is increased by 3.83 times, effectively reducing the accumulation of acetic acid that affects the balance of the flora by 80%; the newly added flavor substance ketone enhances the floral and herbal aroma of the wine, enriching the flavor of the wine.

Description

Technical Field

[0001] The invention relates to a high-throughput screening method for amylase-producing filamentous fungi and application thereof, belonging to the technical field of high-throughput screening. Background Art

[0002] Daqu is an important saccharifying agent and fermentation agent in wine production. Filamentous fungi such as Aspergillus and Rhizopus in Daqu are important amylase-producing microorganisms in Daqu production. [1] The amylase produced by the fungus can hydrolyze the starch in the brewing raw materials into monosaccharides or polysaccharides, providing a material basis for liquor brewing. In addition, the mycelium of filamentous fungi plays an important role in the fluffy and non-cracked shape of the Daqu blocks and the color and flavor of the blocks. Therefore, filamentous fungi play a vital role in the production of Daqu. [2] Screening filamentous fungi with excellent traits is of great significance for producing enhanced Daqu and improving the quality of Daqu.

[0003] At present, the traditional plate coating method for isolating filamentous fungi is time-consuming, labor-intensive, and inefficient. In addition, due to the well-developed hyphae and easy diffusion of spores of filamentous fungi, the obtained filamentous fungi are difficult to purify. With the continuous progress and development of flow cytometry, flow cytometry has been used for the screening of a variety of microorganisms. [3,4] , which greatly improves the efficiency of microbial screening. At present, most of the flow cytometers used for high-throughput screening are pure strains or single systems. In the solid-state fermentation system, due to the full mixing of microorganisms and complex materials, the material fragmentation is serious, which is easy to cause blockage of the flow pipe. Therefore, it is still difficult to use flow cytometers for high-throughput screening; in addition, the microorganisms in the Daqu system are complex, and even if antibiotics are used, only bacteria and fungi can be distinguished. There is no technology that can directly distinguish yeast and filamentous fungi in such a complex system as Daqu. This study uses flow cytometry to distinguish the morphology and size of the screening objects through enrichment pretreatment, explores reasonable culture conditions and time, and uses flow cytometry to distinguish the morphology and size of the screening objects, so as to achieve direct distinction between yeast and filamentous fungi in Daqu, improve sorting efficiency, and combine with solid culture medium suitable for liquor brewing system, which can directly reflect the contribution of the screened objects to the amylase activity of the brewing system. According to previous studies, in the production of Maotai liquor, abnormal mold enrichment will lead to an increase in the acetic acid content in the mash, which may further lead to the possibility of flora disorder. The mold screened according to this method can better maintain the structure of the bacterial community when used in simulated fermentation, avoiding excessive enrichment that leads to increased acetic acid and affects the stability of the bacterial community.

[0004] [1]CHENB, wuQ, XUY. Filamentous fungal diversity and community structure associated with the solid-state-fermentation of Chinese Maotai flavor liquor

[0005] [2] Fang Cheng, Du Hai, Xu Yan. Species diversity of Daqu filamentous fungi and the synthesis potential of their secondary metabolites[J]. Food and Fermentation Industries, 2019, 45(15): 1-8. DOI: 10.13995 / j.cnki.11-1802 / ts.020601.

[0006] [3] A method for high-throughput screening of red pigment high-yielding strains - CN109825495B

[0007] [4] A method for separating haploid Saccharomyces cerevisiae based on ultra-high throughput flow cytometry - CN109355245A Summary of the invention

[0008] In order to solve the problem of screening molds suitable for Daqu fermentation and improving the quality of fermented grains, the present invention provides a high-throughput screening method different from the screening strains of the peripheral system, and screened a strain of Monascus purpureus. The Monascus purpureus can increase the content of flavor substances in the fermented grains, enrich the types of flavor substances in the fermented grains, reduce the acetic acid content, and reduce the impact on the microbial community, thereby maintaining the original flavor of the wine.

[0009] The first object of the present invention is to provide a method for high-throughput screening of filamentous fungi, the specific steps of the method are as follows:

[0010] (1) Add the Daqu sample into sterile water and activate it for a period of time;

[0011] (2) After the activation is completed, the filtrate is taken through the filter membrane and centrifuged;

[0012] (3) collecting the precipitate after centrifugation, washing it and inoculating it into a modified enrichment medium for enrichment;

[0013] (4) After the enrichment is completed, a certain amount of bacterial liquid is taken through the filter membrane to obtain the filtrate and centrifuge, the bacterial cells are collected, and then PBS buffer is added to resuspend and wash twice. Finally, the collected bacterial cells are resuspended in PBS again to an appropriate concentration;

[0014] (5) The obtained bacterial solution is loaded onto the machine, and the flow cytometer parameters are adjusted to distinguish different cell populations;

[0015] (6) sorting the cells in the selected area into a high-throughput well plate filled with improved enrichment medium;

[0016] (7) placing the sorted cells on a well plate shaker for culture;

[0017] (8) transferring the bacterial solution to a deep-well plate containing sorghum solid culture medium for solid culture;

[0018] (9) Extracting crude enzyme liquid from solid-state fermentation products for corresponding enzyme activity determination, and selecting microorganisms with high enzyme activity for strain identification.

[0019] In one embodiment, in step (1), the type of the Daqu sample is Maotai-flavor Daqu, the mass volume ratio of the Daqu sample to sterile water is 1:2, and the activation time is 4 to 8 hours.

[0020] In one embodiment, in steps (2) and (4), the filter membrane is a 50-75 μm disposable cell filter.

[0021] In one embodiment, in steps (3) and (6), the composition of the improved enrichment medium is 150-250 g of potato, 8-12 g of sorghum amylopectin, 1000 mL of a mixture prepared by distilled water and fermented grains extract, pH = 5.0; the volume ratio of distilled water to fermented grains extract is 8:2.

[0022] In one embodiment, the method for preparing the fermented grains extract is to mix the fermented grains and distilled water in equal proportions, extract for at least 30 minutes, filter, and centrifuge the filtrate to obtain the fermented grains extract.

[0023] In one embodiment, in step (3), the culture temperature is 28-32° C., the shaking speed is 380-420 rpm, and the culture time is 5-7 days.

[0024] In one embodiment, in step (4), the centrifugation condition is 10000g, 10min; the suitable concentration is OD 600 =0.2~0.5.

[0025] In one embodiment, in step (5), the flow cytometer is a BD FACSArica III, using dual channels, the FSC channel parameters are set to 150-200, the SSC channel parameters are set to 300-380, and the total number of cells in the channel is set to 10,000.

[0026] In one embodiment, the FSC channel parameter is set to 180, and the SSC channel parameter is set to 350.

[0027] In one embodiment, in step (6), the high-throughput well plate is a 96-well shallow well plate.

[0028] In one embodiment, in step (7), the plate shaker is rotated at 400 rpm and the culture time is 3 to 5 days.

[0029] In one embodiment, in step (8), the concentration of the bacterial solution is OD 600 >1.0, culture temperature 28~32℃, culture time 3~5d.

[0030] In one embodiment, in step (9), the crude enzyme solution extraction method is: add 4 ml of enzyme activity assay buffer solution to each well, soak for 30 minutes, rotate at 600 rpm for 30 minutes in a well plate shaker; centrifuge at 8000 rpm for 10 minutes, and take the supernatant for assay.

[0031] In one embodiment, when the enzyme activity to be measured is amylase, the enzyme activity measurement buffer is sodium dihydrogen phosphate and disodium hydrogen phosphate buffer, pH 6.0; when the enzyme activity to be measured is saccharifying enzyme or cellulase, the enzyme activity measurement buffer is acetic acid-sodium acetate buffer.

[0032] The second object of the present invention is to provide a strain of Monascus purpureus, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center on August 24, 2022, with a deposit number of GDMCC No: 62734, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0033] The third object of the present invention is to provide a bacterial agent, which contains the above-mentioned Monascus purpureus.

[0034] A fourth object of the present invention is to provide the use of the Monascus purpureus or the bacterial agent in increasing the content and types of flavor substances in Daqu.

[0035] In one embodiment, the application is to add the Monascus purpureus or the bacterial agent to the mash.

[0036] In one embodiment, the application is to inoculate the above Monascus purpureus or the above bacterial agent into a modified PDA medium and culture until OD 600 The concentration of 1.5 to 2.0 is about 2%, and it is inoculated into the newly piled mash at a volume ratio for Daqu fermentation.

[0037] In one embodiment, the composition of the improved PDA culture medium is 150-250g of potato, 8-12g of sorghum amylopectin, 1000mL of a mixture prepared by distilled water and fermented grains extract, pH=5.0; the volume ratio of distilled water to fermented grains extract is 8:2.

[0038] In one embodiment, the method for preparing the fermented grains extract is to mix the fermented grains and distilled water in equal proportions, extract for at least 30 minutes, filter, and centrifuge the filtrate to obtain the fermented grains extract.

[0039] Beneficial effects:

[0040] (1) The present invention provides a high-throughput screening method that is different from the external edge system for screening strains. The method can sort out three cell groups of Saccharomyces cerevisiae, Pichia pastoris and filamentous fungi in the same batch, and is not limited to Saccharomyces cerevisiae. Compared with the strains with high amylase activity screened by the external edge system, which may cause the taste of the liquor to become bland, the strains with high amylase activity obtained by the present method have less impact on the microbial community and maintain the original flavor of the wine.

[0041] (2) The present invention screened a strain of Monascus purpureus. The Monascus purpureus can increase the alcohol flavor substances other than ethanol in the mash by 4.36 times, increase the content of esters (including important fruity and floral flavor substances such as ethyl acetate, ethyl octanoate, ethyl heptanoate, ethyl phenylacetate, etc.) by 3.30 times, increase the content of aldehydes (mainly including phenylacetaldehyde, furfural, etc., which are mainly floral and sweet flavor substances) by 3.83 times, and effectively reduce the accumulation of acetic acid that affects the balance of the bacterial flora by 80%; add the flavor substance ketone, enhance the floral and herbal aroma of the wine, and enrich the flavor of the wine.

[0042] Biological Deposit

[0043] The Monascus purpureus provided by the present invention is taxonomically named Monascus purpureus, and was deposited in the Guangdong Provincial Microbiological Culture Collection Center on August 24, 2022, with a deposit number of GDMCC No: 62734, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Figure 3 shows the fungal sorting diagram (A) and sorting yield (B) after 3 days of culture.

[0045] Figure 2 Figure 2 shows the fungal sorting diagram (A) and sorting yield (B) after 6 days of culture.

[0046] Figure 3 is the amylase activity detected in the well plate.

[0047] Figure 4 This is a comparison of the flavor of the mash with added and non-added strains; J is the experimental group, C is the control group, and G is the high-yield amylase mold screened by the external edge system.

[0048] Figure 5 The distance between microbial communities in different production verification groups; J is the experimental group, C is the control group, and G is the high-yield amylase mold screened by the outer edge system. DETAILED DESCRIPTION

[0049] The culture medium involved in the following examples:

[0050] Enrichment medium (PDA medium): 200 g potato, 20 g glucose, 1000 ml distilled water, 115°C, sterilize for 20 min;

[0051] Improved enrichment medium (improved PDA medium): 200 g potato, 10 g sorghum amylopectin, distilled water and fermented grains extract adjusted to 1000 ml in a certain ratio so that pH = 5.0; the volume ratio of distilled water to fermented grains extract is 8:2;

[0052] Fermented grains extract: Fermented grains (from five rounds of accumulated grains in the brewing workshop of Kweichow Moutai Co., Ltd.) and distilled water are mixed in a volume ratio of 1:1, mixed and soaked for 30 minutes, shaken for 1 to 2 minutes 3 times in the middle, and then filtered with sterile gauze. After filtration, centrifuge at 5000rpm for 10 minutes, and take the supernatant as the fermented grains extract.

[0053] Sorghum solid culture medium: Use red tassel sorghum and grind it with a Foss Tecato 1090 cyclone grain mill. Then add the fermented grains extract in a volume ratio of 1:1, mix well and let it stand for 30 minutes, then divide it into 96 deep-well plates and sterilize it at 121°C for 20 minutes.

[0054] Simulated fermentation tank: a cellar that simulates the production of Maotai-flavor liquor, a 10cm*18cm*10cm glass box with a silicone plastic lid.

[0055] The methods involved in the following embodiments are:

[0056] 1. Determination of α-amylase activity:

[0057] (1) Reagent preparation

[0058] 2% starch solution: 2 g starch was mixed with 100 mL sodium hydrogen phosphate-citric acid buffer and then boiled to dissolve;

[0059] 0.4mol·L -1 NaOH: Mix 1.6 g NaOH with 100 mL distilled water;

[0060] 0.1M disodium hydrogen phosphate-citrate buffer (pH 6.0):

[0061] Liquid A: Weigh 28.4 g Na2HPO4 (31.61 g Na2HPO4·H2O; 35.6 g Na2HPO4·2H2O; 53.63 g Na2HPO4·7H2O; 71.64 g Na2HPO4·12H2O) and add distilled water to make up to 1 L.

[0062] Solution B: Weigh 21.01 g of citric acid and add distilled water to make up to 1 L.

[0063] Take 12.63 mL of liquid A and mix with 7.37 mL of liquid B.

[0064] DNS reagent: At 45°C, add 10g of 3,5-dinitrosalicylic acid to an appropriate amount of water (about 700mL) and stir to dissolve. Then add 10g of sodium hydroxide in small amounts several times (about 1g each time), and then add 200g of potassium sodium tartrate, 2g of phenol and 5g of anhydrous sodium sulfite in sequence. After all are dissolved and cooled to room temperature, dilute to 1L. Store in a brown bottle in a dark place for 7 days before use.

[0065] (2) Determination method:

[0066] The activity of α-amylase was determined by DNS method. 2% starch solution was preheated in a 60℃ water bath. After the enzyme solution was inactivated at 70℃ for 10min, 0.5mL enzyme solution was added to the preheated 0.5mL starch solution. After reacting at 60℃ for 5min, 1mL 0.4mol·L -1 The reaction was terminated with NaOH. After the reaction was completed, 0.5 mL of the reaction solution was mixed with 0.5 mL of DNS solution and reacted in a boiling water bath for 5 min to develop color. The reaction solution after color development was diluted 5 times and the OD was measured. 540 .

[0067] Under the conditions of 60°C and pH 6.0, the amount of enzyme required to decompose soluble starch to produce 1 mg of glucose in 5 min is defined as one enzyme activity unit (U·g -1 ).

[0068] Example 1 Screening and identification of amylase-producing microorganisms in Maotai-flavor Daqu

[0069] 1. Screening of microorganisms

[0070] (1) Weigh 5 g of high-temperature Daqu sample, add 10 mL of sterile water into a 50 mL centrifuge tube, vortex thoroughly for 2 min, and then activate at 30 °C for 6 h;

[0071] (2) After activation, take 5 ml of the activation solution and filter it through a 70 μm filter membrane;

[0072] (3) 3 ml of the filtrate was taken and centrifuged at 10,000 rpm for 2 min. The precipitate was washed with PBS and inoculated into a modified enrichment medium and cultured at 30°C and 400 rpm for 6 days (if the culture time is too short, the filamentous fungal spores cannot be distinguished from yeast; if the culture time is too long, mycelial balls will form, causing pipe blockage).

[0073] (4) Take 10 ml of the enriched bacterial solution, pass it through a 70 μm cell filter membrane, centrifuge the filtrate at 10,000 rpm, and wash it twice with PBS to remove pigments and culture medium interference;

[0074] (5) After washing the cells, resuspend them in PBS buffer and adjust the OD 600 =0.3;

[0075] (6) Use flow cytometry to distinguish the sorted bacterial populations, and sort the cell populations in different areas of the image according to characteristics such as cell morphology and size. Use dual channels, set the FSC channel parameter to 180, the SSC channel parameter to 350, and the total number of cells in the channel to 10,000. Exclude adherent cells and dead cells, and use microfluidic equipment to sort single microorganisms into a high-throughput well plate filled with modified enrichment medium, with a liquid volume of 200 μl; Figure 2 As shown, three cell populations of Saccharomyces cerevisiae, Pichia pastoris and filamentous fungi can be sorted out.

[0076] (7) Incubate the cells in a well plate shaker at 400 rpm and 30°C for 5 days.

[0077] (8) The enriched bacterial solution was inoculated with 100 μl into a well plate containing 2 g / well of sorghum solid culture medium and cultured at 30°C for 3 days. Then, 2 ml of sodium dihydrogen phosphate and disodium hydrogen phosphate buffer (pH = 6.0) were added and soaked for 15 min. After shaking for 15 min, the crude enzyme solution was extracted and the enzyme activity was determined. The results are shown in Figure 3 As shown, a variety of microorganisms with different amylase activities were screened, among which the microorganism with a value of 9.22 was identified.

[0078] 2. Identification of bacterial species

[0079] ITS sequence amplification

[0080] 1 mL of bacterial solution was centrifuged at 6000 rpm for 3 min, the supernatant was discarded, the sample was washed twice, and the supernatant was discarded after centrifugation to obtain bacterial sludge, which was used as a template for PCR amplification. The PCR sample was sent to the company for sequencing. The sequencing results of the amplified nucleotide sequence were as follows:

[0081] ACCTCCCACCCGTGATTATTGTACCTCCTGTTGCTTCGGCGCGGCCCCCTGGGGCCCGCCGGAGACATCTTCTCGAACGCTGTCTTTGAAAAGGATTGCTGTCTGAGTAAACATACCAAATCGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCG GGGGGCATGCCTGTCCGAGCGTCATTACTGCCCCTCAAGCGCGGCTTGTGTGTTGGGCCCCGTCCCCTGCGCCTCCGGGCAACGGGGACGGGCCCGAAAGGCAGTGGCGGCGCCGCGTCCGGTCCTCG AGCGTATGGGGCTTTGTCACCCGCTCAGTAGGTCGGGCCGGGGCCTTTGCCCTCTCCAACCTTTTTTTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA(SEQ IDNO.1).

[0082] After database comparison and analysis and identification, the strain provided by the present invention is Monascus purpureus, and the enzyme activity of α-amylase is 400-600U.

[0083] Example 2 Preparation and verification of enhanced bacterial solution

[0084] The Monascus purpureus screened in Example 1 was inoculated into the modified PDA medium and cultured for 3 days until the OD 600 The concentration of 1.5 to 2.0 is about 2%, and it is inoculated into the newly piled mash at a volume ratio of 2%. After culturing for 2 days, it is transferred to a simulated fermentation tank (10cm*18cm*10cm) for anaerobic fermentation. After anaerobic fermentation for 30 days, it is taken out for flavor and physical and chemical analysis.

[0085] The results are as follows Figure 4As shown, GC-MS was used to analyze the flavor of the fermented mash after fermentation: 3 g of mash was weighed, 10 μl of citronellol (280 ppm) was added, and after thorough mixing, the analysis was performed according to Li H, Lian B, Ding Y, et al. Bacterial diversity in the central black component of Maotai Daqu and its flavor analysis [J]. Annals of Microbiology, 2014, 64 (04): 1659-1669.

[0086] The results showed that when Monascus purpureus was used for culture verification, compared with the control group without Monascus purpureus, it was found that the addition of Monascus purpureus could increase the alcohol flavor substances other than ethanol in the mash by 4.36 times, and the content of esters (including important fruity and floral flavor substances such as ethyl acetate, ethyl octanoate, ethyl heptanoate, ethyl phenylacetate) increased by 3.30 times; the content of aldehydes (mainly including phenylacetaldehyde, furfural and other main floral and sweet flavor substances) increased by 3.83 times, especially the accumulation of acetic acid in the mash was greatly improved (continuous accumulation of acetic acid will affect the balance of the flora), and the accumulation of acetic acid decreased by 80%; in addition, ketone was newly detected, which can enhance the floral and herbal aroma of the wine and enrich the flavor of the wine in Maotai-flavor liquor.

[0087] Generally speaking, when screening strains with high amylase and saccharifying enzyme production for production, the high amylase activity will lead to a simple increase in yield, but the taste will become bland. This application will judge from the effect of the enhanced strain on the microbial community ( Figure 5 ), and the community structure of the mash after simulated fermentation was subjected to phylogenetic tree analysis. The results showed that compared with the strain with high amylase activity screened by the external edge system (screened from Rhizopus of Xiaoqu, α-amylase activity of 1200U), this strain can increase the esters, alcohols, aldehydes and other substances in the mash while minimizing the impact on the microbial community, thereby maintaining the original flavor of the wine.

[0088] The phylogenetic tree analysis was based on UniFrac distances and was calculated and plotted using R language, Vegan and ggplot2.

[0089] Comparative Example 1:

[0090] The implementation method is the same as Example 1, except that in step (3), the improved enrichment medium is adjusted to an enrichment medium. The result is as follows Figure 1As shown, only yeast cell populations could be screened.

[0091] Comparative Example 2

[0092] The implementation method is the same as Example 1, except that in step (6), the flow channel parameters are adjusted to FSC 100, SSC 300. The results show that no suitable bacteria can be screened.

[0093] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A strain of Monascus purpurogenus ( Purple monkfish ), which was deposited in Guangdong Provincial Microbiological Culture Collection Center on August 24, 2022, with the deposit number GDMCC No: 62734, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

2. A bacterial agent, characterized in that The bacterial agent contains the Monascus purpurogenum according to claim 1 ( Monk purple ).

3. The Monascus purpurogenum according to claim 1 ( Purple monkfish ), or the use of the bacterial agent described in claim 2 in increasing the content and types of flavor substances in fermented mash.

4. The use according to claim 3, characterized in that: The Monascus purpurogenum ( Monk purple ) or the bacterial agent described in claim 2 is added to the mash.

Images