Diabetes diagnostic kit for GCKR gene mutation and its application

Abstract

The present invention discloses a diabetes diagnostic kit for GCKR gene mutation and its application. Two new gene mutation sites that lead to the phenotype of type 2 diabetes were identified: GCKR gene c.718C>T and c.1551G>T mutations. The present invention further expands the GCKR gene mutation diabetes diagnostic sites based on the Chinese hereditary endocrine and metabolic disease cohort and reported GCKR mutation case information, and further extracts the phenotypic characteristics of the new type of diabetes caused by GCKR gene mutation, constructs a diagnostic scoring model for diagnosing the new type of diabetes caused by GCKR gene mutation - GCKR score, and performs receiver operating curve verification to obtain an effective GCKR score diagnostic model. The present invention further constructs a precise diabetes typing diagnostic system. After obtaining the mutation information, the patient is scored and re-typed in combination with the patient's clinical phenotype for accurate diagnosis of diabetes. According to the precise diabetes typing, patients are treated, complications are monitored and prevented, and eugenics and prenatal care are provided with graded guidance.

Description

Technical Field

[0001] The present invention relates to the technical field of establishment of a genetic diagnosis kit for diabetes typing and prognosis prediction, specifically to the establishment and subsequent clinical prediction application of a novel diabetes typing diagnosis kit based on GCKR gene inactivation mutation. Background Art

[0002] Diabetes is a heterogeneous, chronic systemic disease characterized by elevated blood sugar levels. Its complications lead to high rates of disability and mortality. The World Health Organization and the International Diabetes Federation categorize diabetes based on its clinical features and etiology into three main types: type 1 diabetes, type 2 diabetes, mixed diabetes, and other special types. Currently, numerous genomic association studies and cluster studies have confirmed that diabetes requires more precise classification, as its clinical features and prognosis vary significantly. There is an urgent need to identify new markers for more accurate diagnosis and prognosis of diabetes.

[0003] Most studies have shown that genes highly associated with diabetes primarily encode molecules involved in insulin synthesis, secretion, and insulin action pathways. Genes directly encoding molecules involved in hexose metabolism are extremely rare. The GCK gene is the most important one discovered to date. It encodes glucokinase, and inactivating mutations in the GCK gene can cause maturity-onset diabetes of the young type 2 (MODY2). GCKR, a post-transcriptional regulator of GCK, can bind to GCK and inhibit its cytoplasmic kinase activity. GCK-GCKR binding is reversible. Unlike GCK, GCKR can also act as a sensor, binding to metabolites such as fructose-1-phosphate, fructose-6-phosphate, and glucose, undergoing conformational changes that regulate its binding to GCK and further participate in glucose metabolism. The GCKR gene is located on chromosome 2, consists of 19 exons, and the cDNA is 2189 bases long. It is primarily expressed in hepatocytes. In recent years, more and more clinical studies have shown that single nucleotide polymorphisms located on GCKR, such as rs1260326 and rs780094, are closely related to the phenotype of metabolic glycolipid diseases, but have not directly determined the causal relationship between GCKR gene inactivating mutations and metabolic diseases, especially diabetes.

[0004] In summary, in order to further explore the role of GCKR in glucose and lipid metabolism disorders and explore new diagnostic and predictive markers for diabetes, the present invention, based on clinical, animal, and cell validation, has clarified that GCKR gene inactivation mutations can lead to a new subtype of diabetes with clinical manifestations tending towards type 2 diabetes. A diagnostic kit for clinical detection of GCKR mutations was further constructed, and a new diabetic subtype diagnostic model caused by GCKR gene mutations was established, in order to accurately diagnose diabetes in patients. Based on GCKR mutations, a new diabetes analysis, diagnosis, prediction, and intervention system was constructed to predict the complications and prognosis of patients with different types of diabetes. This will enable accurate diagnosis and treatment of hundreds of millions of diabetic patients, with broad prospects for clinical application. Summary of the Invention

[0005] The primary purpose of the present invention is to provide a diabetes molecular marker for GCKR gene mutation, thereby achieving accurate diagnosis and prognosis prediction of diabetes.

[0006] GCKR gene mutations are molecular markers for diabetes; including at least one of the c.718C>T and c.1551G>T mutations.

[0007] A secondary purpose of the present invention is to provide a reagent for detecting at least one of the GCKR gene c.718C>T and c.1551G>T mutations for use in preparing a diabetes diagnostic preparation for GCKR gene inactivating mutations.

[0008] The third object of the present invention is to provide a diabetes diagnostic kit for GCKR gene inactivation mutations, comprising reagents for detecting at least one of the GCKR gene c.718C>T and c.1551G>T mutations.

[0009] The fourth object of the present invention is to provide a reagent for detecting gene combination mutations in the preparation of a diabetes diagnostic preparation for GCKR gene mutations; the gene combination mutations are: c.230A>G, c.1250C>T, c.307G>A, c.1748C>T, c.754G>A, c.581G>A, c.1551G>T, c.718C>T, c.679C>T, c.69delG, c.869+3A>T, c.1241-10C>T, c.1423-22C>T, c.1619G>A, c.1834C>T, c.395C>T, c .940G>T, g.4378G>A, g.4780G>A, c.750+144C>G, c.354+1G>A, c.152G>A, c.548_549del, c.655A>G, c.919T>G, c.1135dup, c.1147C>A, c.1187T>A, c.1433G>A, c.1499T>G, c.1555G>A, c.1618C>T; patients carrying at least one of the above heterozygous, homozygous, or compound heterozygous inactivating mutations with a maximum allele frequency (MAF) <1% were diagnosed with GCKR mutation-type diabetes.

[0010] (Variant naming conventions follow HGVS Recommendations for the Description of Sequence Variants: 2016 Update; cDNA reference sequence: NM_001486.4, gDNA reference sequence: NG_028024.1.)

[0011] Furthermore, diabetic patients who do not carry any of the above-mentioned heterozygous, homozygous, or compound heterozygous inactivating mutations but carry at least one of the single nucleotide polymorphisms with MAF>5% in the GCKR gene, including rs1260326 (c.1337T>C) and rs780094 (g.26532T>C) (both sites are T-to-C and are diseased), are considered to have diabetes carrying GCKR polymorphism sites.

[0012] A diabetes diagnostic kit for GCKR gene mutations comprises a detection reagent for the above-mentioned mutations or polymorphisms.

[0013] The fifth object of the present invention is to provide a combination detection reagent for diabetes complications indicators for use in preparing a preparation for diagnosing GCKR gene mutation-type diabetes in diabetic patients; the diabetes complications indicators include: obesity, dyslipidemia, hyperuricemia, proteinuria and fatty liver.

[0014] Furthermore, according to the GCKR scoring formula:

[0015] GCKR score = P (obesity) × 7.3 + P (dyslipidemia) × 7.91 + P (hyperuricemia) × 3.59 + P (proteinuria) × 2.67 + P (fatty liver) × 4.44; the P value is the frequency of occurrence of complication indicators in each diabetic patient, with the presence of this complication indicator being 1 and the absence of this complication being 0; when the score is greater than 14.69 points, GCKR gene mutation-type diabetes is diagnosed.

[0016] In the present invention, obesity or overweight in Chinese adults is defined as BMI greater than or equal to 24 kg / m 2 Dyslipidemia is defined according to the standards of the Chinese Guidelines for the Prevention and Treatment of Dyslipidemia in Adults (revised in 2016), hyperuricemia is defined according to the Chinese Guidelines for the Diagnosis and Treatment of Hyperuricemia and Gout (2019), proteinuria is defined according to the urine microalbumin / urine creatinine ratio greater than or equal to 30 mg / g and positive urine protein in routine urine test, and fatty liver is defined according to abdominal color ultrasound, CT, MRI imaging methods indicating fat deposition or fatty liver, or liver puncture pathology results indicating fatty liver.

[0017] The sixth object of the present invention is to provide a kit for diagnosing GCKR gene mutation diabetes in diabetic patients, comprising reagents for detecting diabetic complications in diabetic patients including obesity, dyslipidemia, hyperuricemia, proteinuria and fatty liver.

[0018] Based on the inventors' previously constructed Chinese cohort of inherited endocrine and metabolic diseases, the present invention identified a previously unidentified genetic mutation that can cause a type 2 diabetes phenotype through whole-exome sequencing combined with candidate gene mutation validation: the c.718C>T, c.1551G>T mutations in the GCKR gene. The wild-type cDNA of the GCKR gene is shown in SEQ ID NO. 1. Furthermore, fluorescent cDNA plasmids carrying the GCKR gene cDNA and the c.718C>T, c.1551G>T mutations and a FLAG-tagged plasmid were constructed and transfected into target cells. Subcellular localization of the mutated GCKR protein, GCK-GCKR binding ability, and GCK activity were tested, further confirming that the c.718C>T, c.1551G>T mutations in the GCKR gene are inactivating mutations and can clinically cause a type 2 diabetes phenotype.

[0019] The present invention uses CRISP-Cas9 technology to construct GCKR c.718C>T mutant mice. By raising them in an SPF-level environment, it was found that compared with their wild-type littermates, GCKRc.718C>T mutant mice showed increased glycated hemoglobin, decreased glucose tolerance, decreased insulin sensitivity, obesity, increased blood lipids, and increased uric acid, which are consistent with the clinical phenotype, further clarifying that GCKR mutations can lead to the above-mentioned diabetes-related phenotypes.

[0020] The present invention further constructs a kit for detecting GCKR gene inactivating mutations. This kit utilizes the MassARRAY method, namely matrix-assisted laser desorption / ionization time of flight mass spectrometry (MALDI-TOF-MS). This kit includes reagents and primers suitable for detecting GCKR gene mutants, along with subsequent analytical procedures. It is applicable to the detection and classification of all clinically diagnosed diabetic patients, and the accuracy of the kit's detection has been validated using a receiver operating curve.

[0021] The present invention further conducted high-throughput sequencing in a population of newly diagnosed diabetics and discovered that multiple missense mutations and loss-of-function mutations caused by large deletions can lead to monogenic diabetes with a type 2 diabetes phenotype. The present invention also collected information on previously reported GCKR mutation cases, further extracted the phenotypic characteristics of new types of diabetes caused by GCKR gene mutations, weighted them according to the frequency of clinical features, assigned clinical feature scores, and constructed a diagnostic scoring model for diagnosing new types of diabetes caused by GCKR gene mutations—the GCKR score. Receiver operating curve validation was performed to obtain an effective GCKR score diagnostic model. Undiscovered GCKR inactivating variants are also included in the scope of protection of the present invention.

[0022] The precise diabetes typing diagnostic system constructed by this invention involves testing DNA samples from diabetic patients using a novel diabetes typing diagnostic kit based on GCKR gene mutations. After obtaining mutation information, the patient's clinical phenotype is combined with a score and re-typing to accurately diagnose diabetes. Based on this precise diabetes typing, patients are provided with tiered guidance on treatment, complication monitoring and prevention, and prenatal and postnatal care.

[0023] The present invention aims at the first type of diabetes classification based on GCKR gene mutation, i.e., patients carrying GCKR gene inactivating mutations, and constructs a diagnostic model based on clinical phenotype, in order to provide theoretical and technical support for the early and accurate diagnosis and classification of severe diabetes that is prone to complications. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is the pedigree of 2 families that were collected that were consistent with autosomal dominant diabetes;

[0025] (A) Family 1, carrying the GCKR c.718C>T p.Gln240* mutation; (B) Family 2, carrying the GCKR c.1551G>T p.Trp517Cys mutation; squares represent males, circles represent females, filled boxes represent patients, arrows represent probands, and slashes represent deaths.

[0026] Figure 2 Verify the peak map of the first-generation GCKR gene sequencing for the two families;

[0027] (A) In family 1, the proband II-4 carries the GCKR c.718C>T p.Gln240* mutation, while the younger son of the proband III-3 does not carry this mutation. (B) In family 2, the proband III-4 carries the GCKR c.1551G>T p.Trp517Cys mutation, while the younger sister of the proband III-5 does not carry this mutation.

[0028] Figure 3 The diagram shows the structure of the vector containing the fluorescent GFP sequence and the GCKR sequence;

[0029] The red box represents the GCKR cDNA insertion site, which is XhoI / KpnI.

[0030] Figure 4 The results of GCK enzyme activity detection showed that GCKR p.Gln240* and p.Trp517Cys led to decreased GCK activity.

[0031] (A) Localization of GCKR wild-type mutant vector and GCK fluorescent vector in cells. Red fluorescence indicates GCK, and green fluorescence indicates GCKR wild-type or mutant protein. (B) GCK activity detection after plasmid transfection into HepG2 cells. ***p<0.001.

[0032] Figure 5 The results showed that the phenotype of GCKR-GLN240* heterozygous mutant mice was consistent with that of clinical patients carrying the GCKR gene c.718C>T heterozygous mutation;

[0033] (A) Appearance of wild-type mice (left) and heterozygous mice (right); (B) HbA1c levels of wild-type mice (WT) and heterozygous mice (Het); (CD) IPGTT and ITT of wild-type mice and heterozygous mice; (EF) Serum uric acid and triglyceride levels of wild-type mice and heterozygous mice; *p<0.05.

[0034] Figure 6 This is the result of a receiver operating curve analysis of the accuracy of the GCKR gene diabetes detection kit in 49 subjects; the gold standard was first-generation sequencing.

[0035] Figure 7 The results of receiver operating characteristic curve analysis were performed on 17 patients with GCKR gene mutations and 33 patients without GCKR gene mutations. DETAILED DESCRIPTION

[0036] The following describes in detail the implementation of the present invention using specific embodiments. Examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and are intended to be used to explain the present invention, but should not be understood as limiting the present invention. All other embodiments obtained by others in the field without creative work are within the scope of protection of the present invention.

[0037] The present invention provides a novel diabetic mutant caused by an inactivating mutation of the GCKR gene, a mutant mouse model, a mutation detection kit, and a diagnostic system for diabetes caused by GCKR mutation, thereby achieving accurate diagnosis and prognosis prediction of diabetes.

[0038] 1. A new type of diabetes caused by GCKR gene mutation

[0039] The inventors collected two cases of autosomal dominant diabetes pedigrees. Figure 1 The pedigree diagram of the above-mentioned family is shown. ○ represents normal females; □ represents normal males; ● represents female patients; ■ represents male patients; arrows point to the probands. Both probands were clinically diagnosed with type 2 diabetes. The inventors collected whole blood from diabetic and non-diabetic patients in the two families for the next step of genetic testing. The specific process is as follows:

[0040] (1) Genomic DNA sample fragmentation

[0041] The qualified and non-degraded genomic DNA samples were randomly fragmented using a highly focused ultrasonic disruptor (Covaris) to form fragments of about 180-280 bp in length.

[0042] (2) Paired-end adapter ligation reaction

[0043] Add adapters at a ratio of 1:10 between the molecular weight of genomic DNA and adapters, and use T4 DNA ligase to connect the Illumina or other company sequencing adapters to both ends of the library DNA.

[0044] (3) Construction of genomic DNA fragment amplification library and hybridization reaction

[0045] DNA libraries were constructed from genomic DNA after ligation using ligation-mediated PCR (LM-PCR). Qualified samples were hybridized and amplified using the SureSelect Target Enrichment System (Agilent Technologies, Inc., Santa Clara, CA, USA) kit.

[0046] (4) High-throughput sequencing and bioinformatics analysis of sequencing results

[0047] The captured DNA library was sequenced using the Illumina Hiseq X Ten sequencing platform (Illumina, San Diego, CA). The resulting sequencing results were converted into base reads using Illumina base calling software, resulting in paired-end reads of approximately 150 bp in length. After sequencing, the raw sequences were analyzed and the data quality was assessed to determine if they met the standards. If they met the standards, the samples were then tested for variants, including SNPs, indels, and CNVs, and annotations were performed. If they did not meet the standards, additional testing or a new library was required based on the actual situation.

[0048] (5) Data statistics and analysis

[0049] The raw sequencing data is converted into raw sequencing sequences (i.e., Raw Data) through base calling analysis using the raw image data files obtained by the Illumina sequencing platform. The reads are aligned with the reference genome using SOAPaligner alignment software, and the total number of bases, number of reads, read length, coverage, sequencing depth, and other information are counted to determine the validity of the data.

[0050] (6) Sequencing result variant screening

[0051] Mutation screening is performed according to specific filtering criteria, including the following: removing low-quality sequencing results and continuous low-quality fragments, and removing linker sequences; classifying mutations into four types of mutations based on inheritance: recessive, dominant, X-linked, and Y-linked, with mutations within one type prioritized based on family status; removing polymorphic and synonymous mutations, leaving relatively rare non-synonymous mutations, splice site mutations, and indels (insertions and deletions); detecting mutations in the 1000 Genomes Projects and dbSNP databases and their allele frequencies; predicting the pathogenicity of mutations using bioinformatics websites such as SIFT, MutationTaster, and PolyPhen-2; comprehensively screening suspected mutations based on the patient's clinical symptoms and related gene functions for mutation verification and family analysis; and assessing the pathogenicity of variants according to the American College of Medical Genetics and Genomics (ACMG) guidelines.

[0052] (7) First-generation sequencing verification

[0053] Mutation confirmation and family analysis were performed in the proband and his parents using PCR-Sanger sequencing. Based on the human GCKR gene sequence in GenBank (NG_028024.1), primers targeting exons 9 and 17 of the GCKR gene and their flanking sequences were designed using Premier 5.0 software as follows:

[0054] GCKR-9F: 5'-GGGACACAGTGCCTCTAAAAGT-3', see SEQ ID NO.4;

[0055] GCKR-9R: 5'-TTTGAGAGAGAGGGTTGGAATGA-3', see SEQ ID NO.5;

[0056] GCKR-17F: 5'-TAAACGCTGGGCTGCTCAAA-3', see SEQ ID NO.6;

[0057] GCKR-17R: 5'-TAAGCATTGAGGCCAGGTCC-3', see SEQ ID NO.7;

[0058] The specificity was analyzed using the Primer_BLAST software from NCBI.

[0059] PCR reaction system:

[0060]

[0061]

[0062] PCR reaction conditions: 95°C pre-denaturation for 90 seconds; 94°C denaturation for 40 seconds, 57-60°C annealing for 40 seconds, 72°C extension for 40 seconds, for a total of 35 cycles; 72°C extension for 5 minutes. 2 μL of PCR product was subjected to 20 g / L agarose gel electrophoresis. After product size was determined, bidirectional sequencing analysis was performed using an ABI377 DNA sequencer. Sequencing results were compared with normal sequence BLAST analysis. For specific sequencing peaks, see Figure 2 .

[0063] (8) Family co-segregation analysis

[0064] The present invention is based on the autosomal dominant inheritance model Z value (also known as Likelihood ratio) recommended by ACMG for evaluation. The specific formula is:

[0065]

[0066] Family co-segregation analysis was performed on two families carrying the GCKR gene c.718C>T and c.1551G>T mutations, respectively. The results were Z(family 1)=1.5 and Z(family 2)=0.6, indicating that the two mutations of the GCKR gene co-segregated with the diabetic phenotype.

[0067] According to the above process, clinical diagnosis of diabetic patients can be achieved. Steps 2 and 3 below are only verification work before the preparation of this kit, and are not necessary steps for clinical testing.

[0068] 2. Construction and functional verification of GCKR gene mutants

[0069] (1) Construction of GCKR construct with fluorescent GFP sequence: The commercial GV230 vector (purchased from Shanghai Jikai) was used. The specific structure is shown in Figure 3 , designed primers for upstream and downstream amplification of the full-length open frame of the GCKR gene. The upstream primer has an XhoI restriction site, and the downstream primer has a KpnI restriction site. The primers contain the 5' end sequence of the target gene for PCR to fish for the target gene. The following PCR reaction system was prepared and amplified in a PCR instrument under the conditions of 98°C for 5 min per cycle, 98°C for 10 s, 55°C for 10 s, and 72°C for 90 s for a total of 30 cycles, and 72°C for 8 min per cycle:

[0070]

[0071] The amplification primer sequences are:

[0072] GCKR (cDNA sequence see SEQ ID NO.1)

[0073] Upstream primer: TACCGGACTCAGATCTCGAGCGCCACCATGCCAGGCACAAAACGGTTTCAAC, see SEQ ID NO.8;

[0074] Downstream primer: GATCCCGGGCCCGCGGTACCGTCTGAACGTCAGGCTCTAGGATCTC, see SEQ ID NO.9;

[0075] GCKR c.718C>T (SEQ ID NO.2)

[0076] Upstream primer: TACCGGACTCAGATCTCGAGCGCCACCATGCCAGGCACAAAACGGTTTCAAC, see SEQ ID NO. 10;

[0077] Downstream primer: GATCCCGGGCCCGCGGTACCGTTTTCTCCTGCATTTTCTGCATCC, see SEQ ID NO.11;

[0078] GCKR c.1551G>T (SEQ ID NO.3)

[0079] Upstream primer: TACCGGACTCAGATCTCGAGCGCCACCATGCCAGGCACAAAACGGTTTCAAC, see SEQ ID NO.12;

[0080] Downstream primer: GATCCCGGGCCCGCGGTACCGTCTGAACGTCAGGCTCTAGGATCTC, see SEQ ID NO.13.

[0081] Prepare a vector enzyme digestion system and incubate at 37°C for 3 hours or overnight. Perform agarose gel electrophoresis on the vector digestion products to recover the target bands. Ligate the PCR products to the recovered enzyme digestion bands using ligase. Transform the ligation products into DH5α competent cells and plate them on kanamycin-resistant LB agar plates. Incubate at 37°C overnight. Pick a single colony for Sanger sequencing to identify the GFP-tagged construct sequence containing the target band (GFP-GCKR-WT represents the wild-type plasmid without the mutation, Gln240* in GFP-GCKR-Gln240* represents the plasmid carrying c.718C>T, and Trp517Cys in GFP-GCKR-Trp517Cys carries c.1551G>T).

[0082] ② GCKR construct transfected into HEK293T cells

[0083] HEK293T cells were passaged and grown to 65-70% confluency. Complete medium was then replaced. Opti-MEM (Thermo) was used to prepare Solution A: a mixture of plasmid and P300 (1 μg of plasmid was added to 2 μL of P300) (Thermo) and Solution B: a diluent of Lipo3000 (Thermo) (equal to Solution A). Solution B was added to Solution A and thoroughly mixed by pipetting. The cells were allowed to stand at room temperature for 20-30 minutes before being added to a culture dish and gently shaken. The cells were then cultured in a 37°C, 5% CO2 incubator. After 6 hours, the complete medium was replaced. After 48 hours of culture, the cells were replaced with low-glucose DMEM (5 mmol / L) and high-glucose DMEM (25 mmol / L), respectively. Fluorescence distribution and changes were observed under an inverted fluorescence microscope at 2 and 8 hours after the intervention.

[0084] ③ Detection of GCK activity after GCKR transfection into human hepatoma cell lines

[0085] When HepG2 cells were passaged to 70%, they were switched to Opti-MEM. Plasmids and transfection reagent (polyfect) were prepared in Opti-MEM, mixed thoroughly by pipetting, allowed to stand at room temperature for 20-30 minutes, added to a culture dish, gently shaken, and incubated in a 37°C, 5% CO2 incubator. Complete medium was replaced after 6 hours. Transfection efficiency and status were observed under an inverted fluorescence microscope 48 hours later. Cells were harvested and lysed by sonication. NADPH absorbance at 340 nm was measured using a glucose-6-phosphate dehydrogenase-coupled assay. GCK activity was calculated based on cell count to determine changes in GCK activity following GCKR mutation.

[0086] The above experimental results confirmed that: in HEK293T cells transfected with GFP-GCKR-WT, green fluorescence was mainly distributed in the cell nucleus, while in cells transfected with GFP-GCKR-Gln240*, fluorescence showed that the nuclear localization ability of GCKR GLN240* was lost, and in cells transfected with GFP-GCKR-Trp517Cys, fluorescence showed that GCKR Trp517Cys was nuclear localized. GCK enzyme activity detection suggested that GCKR Gln240* and Trp517Cys led to decreased GCK activity. Specific results are shown in Figure 4 The results suggest that the GCKR gene c.718C>T and c.1551G>T mutations are inactivating mutations.

[0087] 3. Construction and validation of GCKR mutation mouse model

[0088] Based on the results of the first and second parts, a nonsense mutation was selected as the target to construct a mouse animal model. The specific process is as follows:

[0089] A C57BL6J mouse strain was constructed using CRISPR / Cas9 genome engineering technology. The GLN240* (CAG-TAG) mutation site in a donor oligonucleotide was introduced into fertilized mouse eggs via homology-directed repair for site-directed mutagenesis. After F0 generation mice matured, tissues were collected for PCR amplification and sequencing. The mice that achieved the point mutation were then mated with wild-type mice to generate the F1 generation. The GCKRGLN240* mutant mice were quarantined and housed in a SPF enclosure at the Department of Zoology, Central South University, at a temperature of 25°C and a humidity of 50%-55%, under a 12-hour light:12-hour dark cycle. Heterozygous males and females were mated in a 1:1 or 1:2 ratio. After extensive breeding, wild-type and heterozygous littermates were obtained for validation. Mice were grown to 16 weeks of age and their urine was collected in metabolic cages. The mice were anesthetized with isoflurane, and their eyeballs were removed to collect blood. The blood was allowed to stand at room temperature for 1 hour and then centrifuged to collect serum. The blood glucose, triglyceride (TG), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), free fatty acids (NEFA), and uric acid (UA) of the mice were measured using an automatic biochemical analyzer.

[0090] The results showed that compared with wild-type mice of the same litter, GCKR p.Gln240* heterozygous mutant mice gained weight faster and were larger. The 16-week-old mice also showed that the glycosylated hemoglobin level was higher in heterozygous mice than in wild-type mice. In addition, the results of glucose tolerance test and insulin tolerance test also showed that heterozygous mice had impaired glucose tolerance and insulin resistance. Serum biochemistry results showed that heterozygous mice had dyslipidemia and elevated uric acid. This is consistent with the phenotype of patients carrying GCKR gene c.718C>T heterozygous mutation clinically. The specific results are shown in Figure 5 .

[0091] 4. Construction of GCKR gene mutation diagnostic kit

[0092] The present invention uses the MassARRAY method, i.e., matrix-assisted laser desorption / ionization time of flight mass spectrometry (MALDI-TOF-MS), to detect 32 sites in total, including 12 pathogenic mutation sites of the GCKR gene discovered in the previous clinical cohort study of this research center, 18 GCKR gene mutation sites that have been reported to cause disease phenotypes, and two single nucleotide polymorphism sites in the GCKR gene multi-gene synergistic mode. The present invention has the same protective effect on other sites to be discovered for phenotypes such as diabetes, obesity, dyslipidemia, hyperuricemia, and fatty liver caused by GCKR gene mutations. The specific steps are:

[0093] (1) First, primers were designed for the following mutation sites including but not limited to: GCKR c.230A>G, c.1250C>T, c.307G>A, c.1748C>T, c.754G>A, c.581G>A, c.1551G>T, c.718C>T, c.679C>T, c.69delG, c.869+3A>T, c.1241-10C>T, c.1423-22C>T, c.1619G>A, c.1834C>T, c.395C>T, c.940G>T, g.4378G>A, g.4780G>A, c.750+144C>G, c.354+1G>A, c.152G>A, c.548_549del, c.655A>G, c.919T>G, c.1135dup, c.1147C>A, c.1187T>A, c.1433G>A, c.1499T>G, c.1555G>A, c.1618C>T; the specific design principle is: design mutation point primers for alleles, with a 10mer tag (ACGTTGGATG, see SEQ ID NO.14) at the 5' end of the primer, so that the PCR amplification product is larger than 30bp. (2) Multiple PCR amplification of mutation sites

[0094] Dilute the gDNA sample to 10 ng / μL and prepare the following reaction reagents: 100 mM dNTPs, 25 mM MgCl2, ultrapure water, 1 μM final concentration of the primers from step (1), 5 U / μL HotStarTaq Plus DNA polymerase, 10× PCR buffer, and a 384-well plate. Add the above reagents to the 384-well plate, mix thoroughly, seal the plate, and centrifuge at room temperature for 1 minute at 425 g. PCR amplification was performed using the following conditions: one cycle at 94°C for 2 minutes, followed by 45 cycles of 94°C for 20 seconds, 56°C for 30 seconds, and 72°C for 60 seconds, followed by one cycle at 72°C for 3 minutes, and finally cooling to 4°C.

[0095] (3) Shrimp alkaline phosphatase (SAP) removal

[0096] Use SAP to remove unreacted dNTPs and remove excess enzyme, buffer, mg 2+ Add 1x SAP buffer and 1.7 U / μL SAP, mix well, incubate at 37°C for 40 min, then at 85°C for 5 min, and finally cool to 4°C.

[0097] (4) Primer single base extension or iPLEX reaction

[0098] For each target site, a single-base extension primer was designed immediately adjacent to the mutation site. Using iPLEX enzyme and extension buffer, the primer was added to a final concentration of 10 μM. Using the first-round PCR product as a template, extension was performed under the following conditions: one cycle at 94°C for 30 seconds, followed by 45 cycles of 94°C for 5 seconds, 52°C for 5 seconds, and 80°C for 5 seconds, followed by one cycle at 72°C for 3 minutes, followed by a final cooling to 4°C. The final product was a primer extension product that terminated at the mutation site after extending the primer by one base.

[0099] (5) Resin purification and mass spectrometry analysis

[0100] SpectroCLEAN-grade resin is diluted with ultrapure water to form a resin suspension, which is then plated. The second-round PCR product is mixed with the resin, and ions adsorbed on the DNA fragments in the liquid are removed through ion exchange. Mass spectrometry analysis is then performed on the system to obtain a peak map, thereby further analyzing the allele mutation status of the specific mutation site and obtaining the mutation site.

[0101] (6) The kit can also use second-generation sequencing methods and above to detect GCKR mutations that have not yet been discovered and reported, and further analyze them using the process in step 2 and incorporate them into the system of the present invention.

[0102] 5. Diabetes precision typing kit based on GCKR mutation for diagnosis of diabetic patients

[0103] The GCKR genotypes of 48 diabetic patients who met the 1999 WHO guidelines were determined by first-generation sequencing. The GCKR gene mutation detection kit constructed in the previous step was then used to detect 32 sites in all subjects. Among them, the results of all subjects detected by the kit were consistent with the first-generation sequencing results. Using first-generation sequencing as the gold standard for genetic diagnosis, the diagnostic accuracy of the kit was analyzed. The results are shown in Figure 6 The area under the curve was 1.000, the p-value was 0.00001, and the accuracy was 100%.

[0104] According to the above sequencing results, diabetic patients were divided into the following three categories:

[0105] ① Carrying heterozygous, homozygous, or compound heterozygous inactivating mutations in the GCKR gene with a maximum allele frequency (MAF) of <1%. Including but not limited to GCKR c.230A>G, c.1250C>T, c.307G>A, c.1748C>T, c.754G>A, c.581G>A, c.1551G>T, c.718C>T, c.679C>T, c.69delG, c.869+3A>T, c.1241-10C>T, c.1423-22C>T, c.1619G>A, c.1834C>T, c.395C>T, c.940G>T, g.4378 G>A, g.4780G>A, c.750+144C>G, c.354+1G>A, c.152G>A, c.548_549del, c.655A>G, c.919T>G, c.1135dup, c.1147C>A, c.1187T>A, c.1433G>A, c.1499T>G, c.1555G>A, c.1618C>T; those carrying at least one of the above mutations are diagnosed with GCKR mutation-type diabetes.

[0106] ② Patients with diabetes who do not carry the variants listed in ① above but carry at least one of the single nucleotide polymorphisms (SNPs) with a MAF > 5% in the GCKR gene, including rs1260326 (c.1337T>C) and rs780094 (g.26532T>C) (a T-to-C change at both sites indicates disease), are considered to carry GCKR polymorphisms, demonstrating a polygenic effect.

[0107] ③ Diabetic patients who do not carry the above-mentioned ① and ② GCKR gene mutations, that is, do not carry.

[0108] An analysis of the clinical information of the above three categories shows that the first category presents a monogenic diabetes phenotype, which is often accompanied by obesity, dyslipidemia, hyperuricemia, fatty liver, and is prone to early-onset diabetic nephropathy and easy to enter the uremia stage. Therefore, for the first category of patients, clinical guidance will be provided according to the above phenotypes: regular monitoring of urine protein, liver and kidney function and abdominal color ultrasound is recommended, diet and blood sugar should be strictly controlled, and the screening time threshold for diabetic nephropathy should be advanced. If proteinuria occurs, renal function protection and urine protein reduction treatment should be carried out as soon as possible. For fertility, prenatal diagnosis can be actively carried out, and specific testing for GCKR gene mutations can be performed to prevent diabetes in offspring.

[0109] The second category has been confirmed by genomic association studies to be associated with phenotypes such as dyslipidemia, fatty liver, and elevated uric acid. Considering the high frequency of the second category mutations and the existence of linkage disequilibrium, it is recommended that carriers of either or both of the second category mutations undergo strict lifestyle interventions, including: a balanced diet, weight control, reduction of high-sugar and high-fat diets, proper exercise, and regular treatment of diabetes.

[0110] The third type was tested and found not to carry GCKR gene-related mutations. The incidence of diabetic nephropathy, comorbidities and complications in diabetic patients was not significantly different from that in other types of diabetes. It is recommended to be treated according to the rules for other types of diabetes and receive routine follow-up.

[0111] 6. Establishment and validation of a GCKR mutation diabetes diagnostic model

[0112] Based on the first five aspects, the inventors found that diabetic patients carrying GCKR gene inactivating mutations (i.e., the first type of patients mentioned above) have a more severe phenotype and are prone to complications of diabetic nephropathy. Therefore, early screening of diabetic patients who need genetic testing in clinical practice has guiding significance for the prognosis and treatment of such patients. Therefore, a frequency-weighted diagnostic model for GCKR gene mutation diabetes was established - the GCKR score (the result obtained by this score is consistent with the mutation judgment result of the first type mentioned above, and the scoring formula can be directly used to determine whether a diabetic patient carries a GCKR gene inactivating mutation). The specific example operation is as follows:

[0113] A total of 39 patients and probands with GCKR gene mutations were screened from the previous cohort of hereditary glycolipid diseases. 35 cases of GCKR gene inactivation mutations were reported in the literature. The frequency of seven major symptoms, including hypertension, dyslipidemia, ketosis, obesity or overweight, hyperuricemia, proteinuria, and fatty liver, was statistically analyzed. The weight was then assigned based on the frequency percentage divided by 10 (see Table 1), resulting in the GCKR score formula:

[0114] GCKR score = P (obesity) × 7.3 + P (dyslipidemia) × 7.91 + P (hyperuricemia) × 3.59 + P (proteinuria) × 2.67 + P (fatty liver) × 4.44; the P value is the frequency of occurrence of complication indicators in each diabetic patient, with the presence of this complication indicator being 1 and the absence of this complication being 0; when the score is greater than 14.69 points, GCKR gene mutation-type diabetes is diagnosed.

[0115] In the present invention, obesity or overweight in Chinese adults is defined as BMI greater than or equal to 24 kg / m 2 Dyslipidemia is defined according to the standards of the Chinese Guidelines for the Prevention and Treatment of Dyslipidemia in Adults (revised in 2016), hyperuricemia is defined according to the Chinese Guidelines for the Diagnosis and Treatment of Hyperuricemia and Gout (2019), proteinuria is defined according to the urine microalbumin / urine creatinine ratio greater than or equal to 30 mg / g and positive urine protein in routine urine test, and fatty liver is defined according to abdominal color ultrasound, CT, MRI imaging methods indicating fat deposition or fatty liver, or liver puncture pathology results indicating fatty liver.

[0116] According to this formula, each patient clinically diagnosed with diabetes and with a family history was scored. The inventors conducted a receiver operating curve analysis on 20 patients with GCKR gene mutations and 33 patients without GCKR gene mutations. The results are shown in Figure 7 The area under the receiver operating characteristic curve (AUC) of the GCKR score reached 0.800, with a p-value of 0.0003, indicating strong diagnostic value. The Youden index analysis indicated an appropriate cutoff value of 14.69 points, which is a cumulative score based on the seven symptoms of the GCKR score. When the score was greater than 14.69 points, the sensitivity was 75% (95% CI: 53.13%–88.81%) and the specificity was 84.9% (95% CI: 69.08%–93.35%).

[0117] Table 1 GCKR score

[0118]

[0119] SEQ ID NO.1:

[0120]

[0121] SEQ ID NO.2:

[0122]

[0123] SEQ ID NO.3:

[0124]

Claims

1. Use of a reagent for detecting diabetes molecular markers of GCKR gene mutations in the preparation of a diabetes diagnostic reagent for GCKR gene inactivation mutations, characterized in that: The diabetes molecular marker of the GCKR gene mutation is c.1551G>T mutation.

2. Use of a reagent for detecting gene mutations in the preparation of a diabetes diagnostic preparation for GCKR gene mutations; the gene mutation is GCKR c.1551G>T; individuals carrying heterozygous, homozygous, or compound heterozygous inactivating mutations of GCKR c.1551G>T with a maximum allele frequency (MAF) < 1% are diagnosed with GCKR mutation-type diabetes.

Images