A kit for detecting nutritional iron deficiency in sows and application
By using fluorescence PCR to quantitatively detect biomarkers in sow fecal samples, the problem of early diagnosis of nutritional iron deficiency in sows has been solved, enabling precise regulation of iron nutrition in sows and improving the health and economic performance of sows and piglets.
Patent Information
- Application Number
- CN202310003421.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-03
- Publication Date
- 2026-02-13
- Estimated Expiration
- 2043-01-03
AI Technical Summary
Current technology lacks a simple and accurate method for early diagnosis of nutritional iron deficiency in sows, resulting in untimely iron supplementation and affecting production performance.
A fluorescent PCR quantitative detection method for the recA gene of Lactobacillus johnsonii was adopted. Biomarkers in sow fecal samples were detected using fluorescent reaction solution A and fluorescent reaction solution B. Combined with internal standards and quantitative references, early monitoring and diagnosis of nutritional iron deficiency in sows were achieved.
It enables earlier, more sensitive, and more accurate detection of nutritional iron deficiency in sows, timely supplementation of iron nutrition, improvement of piglet birth weight and litter weight, reduction of weak piglets, and improvement of sow and piglet health and growth performance.
Smart Images

Figure CN116042814B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of quantitative detection of microorganisms, and particularly relates to a kit for detecting and evaluating nutritional iron deficiency in sows through biological markers and application. BACKGROUND
[0002] Iron is an important trace element in the animal body, and iron deficiency in sows will lead to limited development and growth of tissues and organs, such as increased weak piglets, decreased average birth weight and litter weight, and even affect the growth, development and economic performance after birth.
[0003] Early monitoring and diagnosis of iron deficiency in sows can widen the time window for iron supplementation in sows, and timely and efficient iron supplementation can effectively prevent fetal piglet maldevelopment and growth restriction and improve the health and production performance of sows and piglets.
[0004] Developing and applying early monitoring and diagnosis technology can detect nutritional iron deficiency in sows earlier, and combined with timely administration of high-yield sow efficient iron supplementation products, the time window for iron supplementation is grasped, and the iron nutritional needs of fetal piglets are supplemented in time, which can effectively prevent fetal piglet maldevelopment and growth restriction, improve the birth weight and litter weight of piglets, reduce the frequency of weak piglets, and improve the health and growth performance of sows and piglets.
[0005] At present, there is still a lack of early diagnosis products for iron deficiency monitoring at home and abroad. The products currently used for iron deficiency diagnosis at home and abroad include serum iron, hemoglobin (HGB), transferrin, unsaturated iron binding capacity (UIBC) and other index detection kits or test papers. (1) Among them, the detection of serum iron, UIBC and transferrin requires high-priced instrument equipment and reagent kits. (2) Although there is a handheld device for HGB detection, the index itself reacts relatively late to "iron deficiency", which leads to untimely iron supplementation in sows and affects the production performance of sows. (3) The above detection needs to collect blood samples invasively, which is complicated and causes animal stress, and is not suitable for monitoring under the conditions of the whole herd in the pig farm. SUMMARY
[0006] The technical problem to be solved by the present application is to provide a kit for detecting nutritional iron deficiency in sows and application, to improve the accuracy of nutritional iron deficiency detection in sows and provide scientific guidance for sow nutrition.
[0007] The application provides a kit for detecting nutritional iron deficiency of sows, which comprises fluorescent reaction liquid A, fluorescent reaction liquid B, an internal standard, a negative control, a nucleic acid releasing agent and a quantitative reference product, the fluorescent reaction liquid B contains detection primers, the detection primers comprise an upstream primer and a downstream primer, the sequence of the upstream primer is 5'-ATCTGGCTTGTAAACCAACA-3'(SEQ ID NO.1), and the sequence of the downstream primer is 5'-ATCTTAGTTGTGGATTCCGT-3'(SEQ ID NO.2).
[0008] The application adopts a fluorescent PCR quantitative detection method of the recA gene of Lactobacillus johsonii, can detect and quantify biological targets in sample products, and thus provides a simple and easy method for evaluating nutritional iron deficiency of sows in a gestation period.
[0009] The fluorescent reaction liquid B also contains a primer probe, the sequence of the primer probe is 5'-TCACCGTCAATTTCGGCTCT-3'(SEQ ID NO.3), the 5' end is labeled with a reporter fluorescent group, and the 3' end is labeled with a quencher fluorescent group.
[0010] The fluorescent reaction liquid B also contains an internal standard primer and an internal standard probe, the internal standard primer comprises an internal standard upstream primer and an internal standard downstream primer, the sequence of the internal standard upstream primer is 5'-CATAGTTGGACCGCTAGGA-3'(SEQ ID NO.4), the sequence of the internal standard downstream primer is 5'-GAAAGGTCCCGCAAAGAGT-3'(SEQ ID NO.5), and the sequence of the internal standard probe is 5'-CCGGTGATAAACCTTTGGACCCT-3'(SEQ ID NO.6), the 5' end is labeled with a reporter fluorescent group, and the 3' end is labeled with a quencher fluorescent group.
[0011] The kit also contains an internal standard recombinant plasmid, numbered pUC-IPC, and the working concentration is 10 6 copies / ml. The recombinant plasmid contains a random internal standard sequence, has a nucleotide length of 455 bp, and has a nucleotide sequence of:
[0012] CTGGAGACTGAGGGTTGACGCGCATTCGTCATTGAACGCAGACACGGCTGAGAGAACATGGAGCGACTGCACTGCACTTGGTCGATCTGATTAGGAGTGGGGTTTATGCCCGCGGCTTATCCCCCTATCCTTGCGACACGGGAGAAGACAGATTGTCATCGATTTCGCAAGCCATGATATGTTTGGCCCGACCAACCGCGTTTTTCTCGCGCTTGGATAACGACCTATGGTGTGGACAGTGGCTTAGAGGACATGACACGACGGGCTGAAAGTATGTGGTGCTGGGGCCCTTAGATAGCTGCATAGTTGGACCGCTAGGAATTATATCAATTCGAGATCTCCAGCCGACAAAGTAGGCTCCTAACTAACAGGGTCCAAAGGTTTATCACCGGTCCTTACTCTTTGCGGGACCTTTCTACCCATACAATATCGTCCTCCGATGATGGATCACGGAG (SEQ ID NO. 7).
[0013] The reporter fluorescent group is Fam or Hex, and the quenched fluorescent group is BHQ1.
[0014] The fluorescent reaction solution A: 1250 μL / tube, 1 tube / box. It includes PCR-Buffer, dNTPs, hot start Taq enzyme and UNG enzyme. The Tris-HCl concentration in the PCR-Buffer is 125-200 mM, which is higher than the commonly used 10 mM concentration. Only in this way, the PCR reaction will not be affected by the alkaline nucleic acid releasing agent. This is one of the core contents of the nucleic acid free extraction achieved by the kit.
[0015] The dNTPs include dATP, dUTP, dGTP and dCTP four kinds of deoxyribonucleosides, in which dUTP is used instead of the commonly used dTTP. In this way, the amplified band is DNA with U base. This double-stranded structure will be hydrolyzed in the presence of UNG enzyme, so as to reduce the pollution of the residual amplification product (the main source of PCR pollution).
[0016] The final concentration of the hot start Taq enzyme in the fluorescent reaction solution A is 0.2-0.3 U / μL. The enzyme needs to be activated at 95°C to exercise the amplification activity.
[0017] UNG enzyme full name uracil-N-glycosylase, can selectively hydrolysis of the uracil glycosyl bond in the DNA containing U base, and then eliminate the amplification product residue, aerosol pollution, etc., the optimum activity temperature of the enzyme is 50 degrees Celsius, 95 degrees Celsius inactivation, with hot start Taq enzyme together to achieve the effect of inhibiting false positive.
[0018] Fluorescent reaction liquid B: 650 uL / tube, 1 tube / box. The concentrations of upstream primer and downstream primer are 500-750 nM, and the concentration of primer probe is 250-500 nM; The concentrations of internal standard primer and internal standard probe are 250-500 nM, respectively.
[0019] The internal standard contains recombinant plasmid pUC-IPC, which is diluted to a working concentration of 10 6 copies / ml as an internal standard. The negative control is a TE buffer solution, and the nucleic acid releasing agent includes 25-100 mM NaOH, 1-5% PEG6000, and 0.5-1 mM EDTA. The NaOH in the nucleic acid releasing agent can effectively lyse cells or viruses, release the contents and denature them, the non-ionic detergent PEG6000 further disperses proteins and nucleic acids, and EDTA can effectively inhibit the hydrolysis of DNA by nucleases.
[0020] The concentration of the cloned plasmid pUC-LR-gyrB in the quantitative reference is 1.05x10 7 copies / ml, 1.05x10 6 copies / ml, 1.05x10 5 copies / ml, 1.05x10 4 copies / ml. 500 uL / tube, 1 tube / box, which is linearly related within this range.
[0021] The application provides a use of the kit in preparation of a preparation for detecting nutritional iron deficiency of sows.
[0022] The internal standard is added to the sample, and after heating at 85-95 DEG C for a period of time, centrifugation is performed, the supernatant is taken, and PCR-Mix is added, the PCR-Mix is a mixture of fluorescent reaction liquid A and fluorescent reaction liquid B, and the sample to be tested is obtained; The negative control, the quantitative reference, and the sample to be tested are respectively amplified, the Ct value is measured, and it is judged whether the sow is nutritional iron deficiency.
[0023] The cycle parameters of amplification are set as follows:
[0024]
[0025] The beneficial effect of the present application is that the present application aims to develop an early monitoring and diagnosis technology, which can detect sow nutritional iron deficiency earlier, and then give high-yield sows an efficient iron supplement product in time, grasp the time window of iron supplement, and supplement the iron nutritional needs of fetal piglets in time, so as to effectively prevent fetal piglet growth retardation and growth restriction, improve the birth weight and litter weight of piglets, reduce the frequency of weak piglets, and improve the health and growth performance of sow and piglets. The application of the technology can make the sow iron deficiency "visible", the sow iron nutrition "supplemented", and the fetal piglet growth "kept up", realize the precise and personalized prevention and control of sow iron deficiency, significantly improve the economic benefits of farmers, and the product has good market prospect, and provides technical support for precise regulation of sow iron nutrition.
[0026] The technical scheme starts from the detection of biomarkers in biological samples of early iron deficiency sows, and establishes a pig "early iron deficiency" monitoring and diagnosis method, which is earlier, more sensitive and more accurate than traditional monitoring of "serum iron" and "hemoglobin" indicators to reflect the iron nutritional status of the pig population.
[0027] The technical scheme is based on a mature fluorescence quantitative PCR technology platform, and the related equipment and technical personnel in a general pig farm laboratory are matched and mature, which can quickly undertake the detection work of the scheme.
[0028] The technical scheme has been optimized and developed into a kit product, and the sampling, processing, detection and analysis processes are standardized and normalized, which is convenient to use.
[0029] The kit uses nucleic acid extraction-free, internal standard monitoring and standard curve quantitative technologies to realize more convenient and accurate detection.
[0030] The sample detected by the technical scheme is not a serum sample, but a natural fecal sample, which is convenient to collect from the whole group and does not cause animal stress, and is convenient for clinical application. BRIEF DESCRIPTION OF DRAWINGS
[0031] Figure 1 It is the amplification curve of the 1-F, 1-R primer of the present application.
[0032] Figure 2 It is the amplification curve of the 2-F, 2-R primer of the present application.
[0033] Figure 3 It is the amplification curve of the 3-F, 3-R primer of the present application.
[0034] Figure 4 It is the amplification curve of the primer probe 1-P, 1-F, 1-R of the present application.
[0035] Figure 5 It is the amplification curve of the primer probe 2-P, 2-F, 2-R of the present application.
[0036] Figure 6 Amplification curve of the present application when the concentrations of upstream primer, downstream primer and probe are 0.8 / 0.8 / 0.1 respectively.
[0037] Figure 7 Amplification curve of the present application when the concentrations of upstream primer, downstream primer and probe are 0.8 / 0.8 / 0.2 respectively.
[0038] Figure 8 Amplification curve of the present application when the concentrations of upstream primer, downstream primer and probe are 1 / 1 / 0.1 respectively.
[0039] Figure 9 Amplification curve of the present application when the concentrations of upstream primer, downstream primer and probe are 1 / 1 / 0.2 respectively.
[0040] Figure 10 Amplification curve of the present application without internal standard.
[0041] Figure 11 Amplification curve of the present application with internal standard IPC01.
[0042] Figure 12 Amplification curve of the present application with internal standard IPC03.
[0043] Figure 13 Amplification curve of the present application with internal standard IPC05.
[0044] Figure 14 Linear amplification curve and standard curve of the present application. DETAILED DESCRIPTION
[0045] Example 1
[0046] A detection method, the key steps are as follows.
[0047] (1) Sample collection: use the flocked swab to stick the fresh excrement sample of sows, put it into the sample tube with 5ml nucleic acid releasing agent, and mix evenly.
[0048] (2) Internal standard setting: add 10ul internal standard to each sample tube.
[0049] (3) Nucleic acid release: put the sample tube in metal bath or water bath, heat at 85-95℃ for 10min, then centrifuge briefly, take the supernatant for subsequent PCR detection.
[0050] Amplification reagent preparation: Take out the components in the package, and let them stand at room temperature until they are completely dissolved. Shake well and mix thoroughly before use. Take the corresponding amount of reagent according to the proportion (fluorescence reaction liquid A 25 μL / reaction + fluorescence reaction liquid B 15 μL / reaction), mix thoroughly to form PCR-Mix, and centrifuge immediately. Add 40 μL of PCR-Mix to each reaction tube.
[0051] (4) Sample loading: Take 10 μL of negative control / quantitative reference / sample to be tested and add them to the corresponding PCR reaction wells. Cover the tube cap, mix well, and centrifuge briefly. Transfer to the amplification area.
[0052] (5) Machine amplification: Place the PCR reaction tube into the amplification instrument sample slot, and set the negative control, quantitative reference, and sample to be tested in the corresponding order. Select the FAM channel to detect Lactobacillus reuteri nucleic acid, and select the HEX channel to detect the internal standard. Set the reaction system to 50 μL. The cycle parameters are set as follows:
[0053]
[0054]
[0055] After setting, save the file and run the reaction program.
[0056] (6) Quality control: The negative control HEX channel Ct value is ≤35, and the FAM channel has no Ct value or typical amplification curve. The quantitative reference A-DFAM channel detection is all positive, and the standard curve correlation coefficient R 2 ≥0.98.
[0057] (7) Result determination: The sample to be tested HEX channel Ct value is ≤35, otherwise it needs to be retested. According to the instrument calculation value, the corresponding quantitative determination result is reported, and the sow nutritional iron deficiency evaluation is further made according to the determination value range.
[0058] Example 2
[0059] Macro-genome research shows that the index of nutritional iron deficiency during pregnancy in sows is closely related to the content level of characteristic intestinal flora such as Lactobacillus johsonii, Lactobacillus reuteri, and Protellaruminicola. The content of characteristic bacteria can be used as an indicator. In this study, we established a fluorescence PCR quantitative detection method for Lactobacillus johsonii based on recA, pepC, and gyrB genes, which can detect and quantify biological targets in sample products, in order to provide a simple and easy method for evaluating nutritional iron deficiency in sows during pregnancy.
[0060] 1 Materials and methods
[0061] 1.1 Reagents and Instruments
[0062] HotStart Taq enzyme (5 U / μL) was purchased from Tiangen Biotech Co., Ltd.; DEPC-treated water was purchased from Shanghai Bioengineering Co., Ltd.; primers, probes, and sequences were synthesized by Shanghai Jeery Bioengineering Co., Ltd.; 2x PCR Buffer (containing Mg 2+ , dNTP, etc.) was self-prepared.
[0063] Eppendorf BioPhotometer D30 nucleic acid protein detector; Hongshi SLAN-96S fluorescent quantitative PCR instrument; ABI7500 fluorescent quantitative PCR instrument.
[0064] 1.2 Samples and Treatment
[0065] Positive plasmid: according to the full-length sequences of recA, pepC, and gyrB genes of Lactobacillus johsonii GHZ10a strain in NCBI, a cloning plasmid pUC--LJ-3 was synthesized. The concentration of pUC--LJ-3 plasmid was determined using a nucleic acid protein detector, and according to the actual concentration determination value, pUC--LJ-3 was diluted to about 10 9 ~100 copies / ml in a gradient concentration using TE buffer solution.
[0066] Internal standard plasmid: a cloning plasmid pUC-IPC containing a random internal standard sequence was synthesized. The concentration of pUC-IPC plasmid was determined using a nucleic acid protein detector, and according to the actual concentration determination value, pUC-IPC was diluted to about 10 6 copies / ml using TE.
[0067] Specificity test plasmid: Lactobacillus rhamnosus recA clone plasmid pUC-LRh-recA; Lactobacillus reuteri recA clone plasmid pUC-LR-recA; Lactobacillus gasseri recA clone plasmid pUC-LG-recA; Lactobacillus plantarum recA clone plasmid pUC-LP-recA; Lactobacillus vaginalis recA clone plasmid pUC-LV-recA; Lactobacillus jensenii recA clone plasmid pUC-LJe-recA; Protella ruminicola recA clone plasmid pUC-PR-recA.
[0068] 1.3 Primer probe system test
[0069] Through bioinformatics analysis, 28 strains of Lactobacillus johsonii genome recA, pepC, gyrB gene sequence information registered in NCBI were aligned, and sequences conserved within the species and specific between species were selected. OLIGO 7 software was used to design multiple specific primers and probes. According to the random internal standard sequence, multiple internal standard primers and probes were designed. The specific sequence information is shown in Table 1. The dye method and probe method fluorescence PCR test were used to test the amplification performance of each group of gyrB primers and probes for target genes, and the best matching internal standard system was selected.
[0070] Table 1 Sequence information of primers and probes for testing
[0071]
[0072] 1.4 Linear amplification test
[0073] The reaction system was prepared, and 1.05×10 7 copies / ml~1.05×10 2 copies / ml concentration (1:10 dilution) of pUC-LJ-3 positive plasmid was added for amplification. After amplification, the linear amplification range was determined according to the amplification standard curve.
[0074] 1.5 Analysis sensitivity test
[0075] The reaction system was prepared, and 2.10×10 3 copies / ml, 1.05×10 3The positive plasmid at the concentration of 525 copies / ml, 263 copies / ml was amplified, each concentration was repeated 21 times, and the minimum detection limit (analytical sensitivity) was determined according to the detection rate (≥95%). The Ct value detected according to the minimum detection limit was used to calculate the positive and negative judgment interval (gray zone).
[0076] 1.6 Precision test
[0077] The reaction system was prepared, and 1.05×10 7 copies / ml, 1.05×10 5 copies / ml, and 1.05×10 3 copies / ml of positive plasmid were added respectively for amplification, each concentration was repeated 10 times, and the coefficient of variation (CV value) was calculated according to the detection Ct value.
[0078] 1.7 Specificity test
[0079] The reaction system was prepared, and 7 specific test plasmids (diluted to the appropriate concentration with TE) were added respectively for amplification, and a positive control (pUC--LJ-3) and a negative control (TE solution) were set up. The specificity of the method was analyzed according to the detection results.
[0080] 2 Results and analysis
[0081] 2.1 Primer probe system screening
[0082] 2.1.1 Amplification primer screening
[0083] The dye method was used to test the amplification of the template by 3 groups of primers. According to the detection Ct value of the template at different concentrations, combined with the shape of the amplification curve, the results showed that the amplification effect of the primer group (1-LJ-F-574+1-LJ-R-666) and the primer group (2-LJ-F-542+2-LJ-R-734) was better. Figures 1-3 ).
[0084] Amplification system: 2×PCR Buffer 25μL, F / R primer (40μM) 0.5μL each, HotStart Taq enzyme (5U / μL) 0.5μL, Evegreen dye 1μL, template 5μL, ddH2O to 25μL. The fluorescence PCR amplification program is as follows: 95℃ 2min, 1 cycle; 95℃ 15s, 60℃ 30s (read fluorescence), 45 cycles. Only 10 -4 , 10 -5 represent the template concentration of 1.05×10 5 copies / ml, 1.05×10 4 copies / ml.
[0085] 2.1.2 Probe screening
[0086] Based on the results of primer screening, add each group of specific probes, and evaluate the matching of the probes by probe method fluorescence PCR test. According to the detection Ct value of low concentration template, combined with the shape of amplification curve, the third group of primer probe (1-LJ-F-574, 1-LJ-R-666, 1-LJ-P-U611) is preferred. Figures 4-5 ).
[0087] Amplification system: 2x PCR Buffer 25 μL, F / R primer (40 μM) 0.5 μL each, Probe (20 μM) 0.25 μL, HotStart Taq enzyme (5 U / μL) 0.5 μL, template 5 μL, ddH2O to 25 μL. The fluorescence PCR amplification procedure is as follows: 95℃ 2 min, 1 cycle; 95℃ 15 seconds, 60℃ 30 seconds (read fluorescence), 50 cycles. The gradient template concentration is 1.05x10 6 copies / ml, 1.05x10 5 copies / ml, 1.05x10 4 copies / ml, 1.05x10 3 copies / ml.
[0088] 2.1.3 Primer probe concentration optimization
[0089] The above screened (1-LJ-F-574, 1-LJ-R-666, 1-LJ-P-U611) primer probe is optimized for concentration, and four groups of concentration combinations (μL / reaction) are 0.8 / 0.8 / 0.1, 0.8 / 0.8 / 0.2, 1 / 1 / 0.1, 1 / 1 / 0.2. The final concentration combination 0.8 / 0.8 / 0.1 is the optimal ratio. See Figures 6-9 .
[0090] The fluorescence PCR amplification procedure is as follows: 95℃ 2 min, 1 cycle; 95℃ 15 seconds, 60℃ 30 seconds (read fluorescence), 45 cycles. The template concentration is 1.05x10 6 copies / ml~1.05x10 3 copies / ml.
[0091] 2.1.4 Internal standard system screening
[0092] Based on the results of primer and probe screening, different internal standard systems (IPC01, IPC03, IPC05) are added to test the amplification performance difference of each group without internal standard group. The results show that the IPC05 internal standard system has less influence on the amplification of the main channel, and the curve shape is stable, so the two are preferred as a matched internal standard monitoring system. Figures 10-13 )
[0093] Amplification system: 2x PCR Buffer 25 μL, 1-F / 1-R primer (20 μM) 0.8 μL each, 1-P (20 μM) 0.1 μL, IPC01 / IPC03 / IPC05 internal standard system, HotStart Taq enzyme (5 U / μL) 0.5 μL, template 5 μL, ddH2O up to 25 μL. The fluorescence PCR amplification procedure is as follows: 95°C 2 min, 1 cycle; 95°C 15 s, 60°C 30 s (read fluorescence), 45 cycles. The template concentration is 1.05x10 6 copies / ml ~ 1.05x10 3 copies / ml.
[0094] 2.2 Linear amplification range
[0095] As Figure 14 shown, the method amplifies the gradient template normally at 1.05x10 7 ~ 1.05x10 2 copies / ml. Among them, 1.05x10 7 ~ 1.05x10 3 copies / ml shows linear correlation, the correlation coefficient R 2 = 0.99, and the amplification efficiency is more than 94% in this linear amplification range. Combined with the above results, the quantitative range of this method can be determined at 1.05x10 7 ~ 1.05x10 4 copies / ml.
[0096] 2.3 Analysis sensitivity
[0097] The precision test results show (Table 2) that the detection rate of 2.10x10 3 copies / ml template (10.5 copies / reaction) is 100%,
[0098] 1.05x10 3The detection rate of 95.2% was obtained for 5.25 copies / ml template (5.25 copies / reaction), 23.8% for 525 copies / ml template (2.63 copies / reaction), and 14.3% for 263 copies / ml template (1.32 copies / reaction). The lowest detection limit (LOD) was 1.05x103copies / ml. The Ct value range of the gray zone corresponding to the lowest detection limit was calculated to be 35.10 (taking 35) to 38.50 (taking 39) according to the repeated detection of 1.05x103copies / ml template. That is, Ct value ≤ 35 is determined to be positive, 35 < Ct value < 39 is determined to be suspicious, and Ct value ≥ 39 or No Ct is determined to be negative (or lower than the detection limit). The sample can be determined by multiple rechecks.
[0099] Table 2 analysis of sensitivity determination results
[0100]
[0101]
[0102] 2.4 Precision
[0103] The precision test results showed (Table 3) that the detection precision (CV value) of the method was 2.09-2.69%, and the detection repeatability was good.
[0104] Table 3 precision test results
[0105]
[0106] 2.5 Specificity
[0107] The specificity test results (Table 4) showed that Lactobacillus johsonii-recA was not detected in 7 specific plasmid samples under the premise of internal standard detection, indicating that the method would not cross-react with the above-mentioned 7 intestinal flora.
[0108] Table 4 specificity test results
[0109]
[0110] It should be understood by those skilled in the art that the above discussion of any embodiment is only exemplary and is not intended to limit the scope of protection of the present application to these examples; the technical features of the above embodiments or different embodiments can also be combined under the idea of the present application, the steps can be implemented in any order, and there are many other changes of different aspects of one or more embodiments of the present application as described above. In order to be brief, they are not provided in detail.
[0111] It is intended that the embodiments of the application herein described be interpreted to cover all such modifications, alterations, and equivalents as fall within the true spirit and scope of the application. Accordingly, what is desired to be secured by Letters Patent is the subject matter as follows:
Claims
1. A kit for detecting Lactobacillus johnsonii, characterized in that, The reagent includes fluorescent reaction solution A, fluorescent reaction solution B, internal standard, negative control, nucleic acid release agent and quantitative reference. Fluorescent reaction solution B contains detection primers, which include an upstream primer and a downstream primer. The sequence of the upstream primer is 5'-ATCTGGCTTGTAAACCAACA-3', and the sequence of the downstream primer is 5'-ATCTTAGTTGTGGATTCCGT-3'. The fluorescent reaction solution A includes PCR-Buffer, dNTPs, hot-start Taq enzyme and UNG enzyme. The concentration of Tris-HCl in the PCR-Buffer is 125-200 mM. The dNTPs include four deoxyribonucleosides: dATP, dUTP, dGTP, and dCTP. The final concentration of hot-start Taq enzyme in the fluorescent reaction solution A is 0.2-0.3 U / μL. The fluorescent reaction solution B also contains primers and probes with the sequence 5'-TCACCGTCAATTTCGGCTCT-3', wherein the 5' end is labeled with a reporter fluorescent group and the 3' end is labeled with a quencher fluorescent group.
2. The kit according to claim 1, characterized in that, The fluorescent reaction solution B also contains internal standard primers and internal standard probes. The internal standard primers include an internal standard upstream primer and an internal standard downstream primer. The sequence of the internal standard upstream primer is 5'-CATAGTTGGACCGCTAGGA-3', the sequence of the internal standard downstream primer is 5'-GAAAGGTCCCGCAAAGAGT-3', and the sequence of the internal standard probe is 5'-CCGGTGATAAACCTTTGGACCCT-3'. The 5' end is labeled with a reporter fluorescent group, and the 3' end is labeled with a quencher fluorescent group.
3. The kit according to claim 2, characterized in that, The reporting fluorescent group is Fam or Hex, and the quenching fluorescent group is BHQ1.
4. The kit according to claim 2, characterized in that the fluorescence... In reaction solution B, the concentrations of the upstream and downstream primers are 500–750 nM, and the concentrations of the primers and probes are 250–500 nM; the concentrations of the internal standard primers and internal standard probes are 250–500 nM, respectively.
5. The kit according to any one of claims 1-3, characterized in that, The internal standard contains the recombinant plasmid pUC-IPC, and the negative control is TE buffer solution; the recombinant plasmid contains a random internal standard sequence with a nucleotide length of 455 bp and the nucleotide sequence is SEQ ID NO.
7.
6. The kit according to any one of claims 1-3, characterized in that, The nucleic acid releasing agent comprises 25–100 mM NaOH, 1–5% PEG6000, and 0.5–1 mM EDTA.
Citation Information
Patent Citations
Fluorescent PCR (Polymerase Chain Reaction) detection kit for African swine fever virus, preparation method and application method
CN108300808A
Multiplex PCR primers for detection of lactobacillus species, and use thereof
KR102099344B1