Electrochemical biosensor for detecting ctDNA EGFR L858R and preparation method thereof

Abstract

The present invention discloses an electrochemical biosensor for detecting ctDNA EGFR L858R and a preparation method thereof, wherein the sensor comprises: a signal amplification system based on PER-CRISPR Cas14a, a biological signal to electrical signal conversion part and an electrode part; the signal amplification system comprises: a target, a hairpin H1, a hairpin H2, a cleaning sequence, a Bst polymerase, tracrRNA, crRNA, and a Cas14a protein; the biological signal to electrical signal conversion part comprises tracrRNA, crRNA, and a Cas14a protein; and the electrode part comprises a gold electrode, ssDNA-MB, and MCH. The sensor of the present invention is safe and reliable, and realizes rapid, specific, and highly sensitive detection of ctDNA EGFR L858R.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an electrochemical biosensor for detecting ctDNA EGFR L858R and a preparation method thereof. Background Art

[0002] Liquid biopsy, as a non-invasive in vitro diagnostic test, is a breakthrough technology for detecting tumors and cancers and for adjuvant therapy. As the most rapidly developing marker for liquid biopsy, ctDNA is a DNA fragment that is released by tumor tissue into the human blood system and carries its own genes. These tumor DNAs often contain gene mutations unique to the tumor genome, which can truly reflect the frequency of gene burst patterns in solid tumor tissues and are important monitoring indicators for evaluating treatment effects and clinical follow-up after treatment. At present, most of the standard detection technologies for gene mutations mainly include: next-generation sequencing (NGS), quantitative polymerase chain reaction (qPCR) with probes that recognize specific cancer-related mutations, and droplet digital polymerase chain reaction (ddPCR). However, these traditional technologies have the disadvantages of cumbersome operation, high cost, long processing time, low sensitivity, and susceptibility to interference from the biological environment, which limits their detection applications. Therefore, there is an urgent need to construct a simple, efficient, highly sensitive, and highly selective detection method to meet the detection requirements for ctDNA and provide possibilities for future on-site detection.

[0003] Mutations in the epidermal growth factor receptor (EGFR) are a major form of ctDNA gene mutation. More than 80% of EGFR mutations occur in exons 19-21, and exon 21 amino acid substitutions (EGFR L858R) account for 41% of them. EGFR expression mutations are common in liver cancer, non-small cell lung cancer, pancreatic cancer, intestinal cancer, etc., and are related to the occurrence and development of these tumors. They are valuable biomarkers for the clinical diagnosis of diseases such as non-small cell lung cancer. Detection of EGFR deletion mutations helps to intuitively understand the gene mutation status of non-small cell lung cancer tumors, which is beneficial for targeted treatment and efficacy evaluation. At present, EGFR gene mutation detection often uses human EGFR gene mutation detection kits (fluorescence PCR method) and sequencing methods. These methods are costly, laborious, low in sensitivity, and cannot achieve instant detection.

[0004] In order to solve the above problems, some emerging technologies have been gradually developed in recent years, among which electrochemical biosensors have attracted particular attention. Electrochemical biosensors are biosensors with low cost, high sensitivity, fast signal readout and large concentration response range. As a favorable technology, electrochemical detection technology has been used to detect and quantify different analytes and has become one of the most widely used technologies in biosensors.

[0005] Isothermal amplification technology can improve the sensitivity of electrochemical biosensor detection, and because it is isothermal amplification, mild reaction conditions, and low instrument dependence, it is more suitable for instant detection. Primer exchange reaction (PER) is a robust amplification mechanism first proposed in 2018, that is, under the action of Bst DNA polymerase, the single-stranded primer is autonomously extended on the hairpin template to form a long single-stranded DNA containing countless repeating sequences. Since it only involves a single-stranded primer and a hairpin, the reaction has the characteristics of simple design, high specificity, and mild reaction conditions.

[0006] Clustered regularly interspaced short palindromic repeats (CRISPR) and its related nucleases (Cas) originate from the adaptive immune systems of natural archaea and bacteria. The CRISPR Cas14a system can be used as an endonuclease, which, under the guidance of tracrRNA:crRNA, specifically binds to the target single-stranded DNA and cuts exogenous ssDNA with high specificity, sensitivity and cutting efficiency. The Cas14a protein has a smaller molecular weight (62kDa), has higher recognition and fidelity for ssDNA sequences, and is not restricted by PAM sites in the target sequence, which helps to establish a high-fidelity molecular detection platform and expand its application. We chose ssDNA-MB as the electrochemical signal and achieved signal output through the interface cutting of nucleic acids on the surface of the electrochemical biosensor platform by the Cas14a system. Summary of the invention

[0007] The object of the present invention is to provide a safe and reliable electrochemical biosensor for detecting ctDNA EGFR L858R, which can achieve rapid, specific and highly sensitive detection of ctDNA EGFR L858R and a preparation method thereof.

[0008] The technical solution of the present invention is:

[0009] An electrochemical biosensor for detecting ctDNA EGFR L858R, the sensor comprising: a signal amplification system based on PER-CRISPR Cas14a, a biological signal to electrical signal conversion part and an electrode part. The signal amplification system comprises: a target, a hairpin H1, a hairpin H2, a cleaning sequence, a Bst polymerase, a tracrRNA, a crRNA, and a Cas14a protein; the biological signal to electrical signal conversion part comprises tracrRNA, crRNA, and a Cas14a protein; the electrode part comprises a gold electrode, ssDNA-MB, and MCH. When a single-stranded target (ctDNA EGFR L858R) is present in the test solution, the hairpin H1 will be opened, and the target will bind to the loop chain of H1 to expose the stem chain of H1. The stem chain of H1 is complementary to the protruding stem chain of the hairpin H2. Under the action of the Bst polymerase, the complementary chain undergoes an extension reaction. When it extends to the end of the H2 stem chain, there is a base pair termination point (CG) at the end of the H2 stem chain, which will block the continuation of the extension reaction. Because the base binding force between the H2 stem chains is higher than the base binding force between the newly synthesized extended chain and the H2 stem chain, the extended primer can spontaneously dissociate from H2. Due to the design of the sequence, the extended primer is complementary to the protruding stem chain of H2, so it can continue to complement the protruding stem chain of H2, thereby continuing the above-mentioned extension reaction and dissociation reaction, so that the PER reaction cycle continues. Only when the reaction raw materials in the solution are exhausted can the PER reaction stop. Finally, a reaction product containing countless repeating sequences, namely the activator (ATCTCTTATT), is generated. When the activator (ATCTCTTATT) is present, it binds to crRNA and activates the trans-cutting activity of Cas14a. ssDNA-MB is fixed and modified on the surface of the gold electrode through Au-S bonds, and MCH is used to block non-specific sites on the surface of the gold electrode. After the trans-cleavage activity of CRISPR Cas14a is activated, the ssDNA-MB on the electrode surface is cut, resulting in the occurrence of electrochemical label electron transfer. Therefore, the purpose of quantitative detection of ctDNA EGFR L858R is achieved by detecting the changes in the electrochemical signal of the ssDNA-MB modified on the electrode surface.

[0010] Furthermore, the nucleotide sequence of the target is:

[0011] 5'-GATTTTGGGCGGGCCAAACTG-3'.

[0012] Furthermore, the nucleotide sequence of the hairpin H1 is:

[0013] 5'-AATAAGAGATCAGTTTGGCCCGCCCAAAATCATCTCTTAT T-3'.

[0014] Furthermore, the nucleotide sequence of the hairpin H2 is:

[0015] 5'-ATCTCTTATTGGGCCTTTGGCCCAATAAGAGATAATAAG AGAT-3'.

[0016] Further, the nucleotide sequence of the cleaning sequence is:

[0017] 5'-CCCCGAAAGTGGCCTCGGGCCTTTGGCCCGAGGCCAC TTTCG-3'.

[0018] Further, the nucleotide sequence of the tracrRNA is:

[0019] 5'-CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGC UGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCU UGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUGGAAUGCAAC-3'.

[0020] Further, the nucleotide sequence of the crRNA is:

[0021] 5'-GAAUGAAGGAAUGCAACUAATAAGAGAT-3'.

[0022] Furthermore, the nucleotide sequence of the fluorescent reporter probe is:

[0023] 5′-FAM-TTATTTTATT-BHQ1-3′.

[0024] Furthermore, the nucleotide sequence of the ssDNA-MB is:

[0025] 5'-SH-(CH 2 ) 6 -TTTTTTTTTTTTTTTTTT-MB-3'.

[0026] Further, the nucleotide sequence of the crRNA-activator is:

[0027] 5′-ATCTCTTATT-3′.

[0028] Furthermore, the working electrode is a gold electrode.

[0029] Furthermore, the method further includes using a silver / silver chloride electrode as a reference electrode and a platinum wire as a counter electrode.

[0030] 2. To achieve the above objectives, the second aspect of the present invention provides a method for preparing the electrochemical biosensor for detecting ctDNA EGFR L858R as described in the first aspect.

[0031] PER reaction: Before the experiment, hairpin H1 and hairpin H2 were heated to 95°C in DNA hybridization buffer for annealing for 5 min, then cooled to room temperature and diluted to 1 μM for use as sensor assembly probes. Subsequently, target, H1 (1 μM), H2 (1 μM), cleaning sequence (1 μM), dNTP (1 mM, N = A, T, C), Bst polymerase (0.1 U), MgSO 4 (1mM) were mixed in an EP tube, and then the mixture was kept at 37°C overnight to allow the PER reaction to complete. Before mixing with CRISPR Cas14a, the PER final reaction product needed to be heated to 80°C for 5min to terminate the reaction.

[0032] CRISPR Cas14a reaction: 1 μM Cas14a and 1 μM (tracrRNA:crRNA mixture) were pre-incubated in DNA hybridization buffer at 37°C for half an hour, and then mixed with the activator solvent or PER final reactant. The total volume of the reaction solution was 20 μL, and the reaction was continuously shaken at 37°C for 1 hour.

[0033] Electrode modification and electrochemical measurements: Gold disk electrodes (Φ = 2 mm) were polished with 0.3 μm and 0.05 μm alumina suspensions and then electrochemically cleaned in multiple steps (in 0.5 M NaOH, 0.5 M H 2 SO 4 , 0.01M KCl / 0.1MH 2 SO 4 and 0.05MH 2 SO 4 A series of oxidation and reduction cycles were performed in the reaction mixture. The cleaned gold electrode was modified with 6 μL of 1 μM ssDNA-MB and incubated at room temperature for 1 hour. The ssDNA-MB was diluted with DNA fixation buffer and treated with TCEP for 30 minutes. Subsequently, the modified surface was rinsed with buffer and then passivated with 1 mM MCH for 20 minutes. The electrode was rinsed with buffer solution. Then, 6 μL of the activator and the reactant of CRISPR Cas14a or 6 μL of the final reactant of PER and the reactant of CRISPR Cas14a were modified and reacted at 37°C for 1 hour. After the reaction, electrochemical measurements were performed.

[0034] Both the PER reaction and the trans-cleavage activity of Cas14a contribute to signal amplification, and the combination of the two greatly enhances the detection performance of the established electrochemical sensor. A detection limit of 0.34fM can be achieved, and the dynamic detection range can reach 1fM-1μM. Compared with the existing technology, the realization of this reaction does not require expensive instruments, has high sensitivity, and mild reaction conditions.

[0035] The present invention combines PER with CRISPR Cas14a to construct an electrochemical biosensor platform for ctDNA EGFRL858R detection. When the target exists, hairpin H1 can be opened, and then hairpin H2 is opened, and under the action of Bst polymerase, PER occurs between primer (stem chain of H1) and hairpin H2, so as to produce a long-chain product containing an activator (repetitive sequence). The activator then activates the endonuclease activity of Cas14a protein by combining with crRNA, non-specifically cutting the ssDNA-MB modified on the surface of the gold electrode, and the quantitative analysis of the target is realized by the change of the redox signal of the electrochemical substance on the electrode surface. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0037] Figure 1 It is a schematic diagram of the PER-CRISPR Cas14a electrochemical sensor for ctDNA EGFR L858R detection of the present invention.

[0038] Figure 2 It is a schematic diagram showing that the feasibility of PER was confirmed by polyacrylamide electrophoresis (PAGE).

[0039] Figure 3 Schematic diagram of the feasibility verification of activator-mediated CRISPR Cas14a reaction.

[0040] In the figure: (A) Fluorescence spectrum. (Cleavage time: 1h) (B) ACV reaction. (C) CV reaction. (D) EIS response.

[0041] Figure 4 This is a schematic diagram of the feasibility verification of PER-mediated CRISPR Cas14a reaction.

[0042] Wherein: (A) Fluorescence spectrum. (Cleavage time: 1h) (B) ACV reaction.

[0043] Figure 5 Schematic diagram of CV (A) and EIS (B) characterization of the PER-CRISPR Cas14a electrochemical biosensor.

[0044] Table 1 Sequences involved in PER reaction, fluorescence experiment and CRISPR Cas14a reaction.

[0045] Table 1

[0046]

[0047] DETAILED DESCRIPTION

[0048] 1.PER reaction:

[0049] Before the experiment, hairpin H1 and hairpin H2 were heated to 95°C in DNA hybridization buffer for annealing for 5 min, then cooled to room temperature and diluted to 1 μM for use as assembled probes for sensing. Subsequently, target, H1 (1 μM), H2 (1 μM), cleaning sequence (1 μM), dNTP (1 mM, N = A, T, C), Bst polymerase (0.1 U), MgSO 4 (1mM) were mixed in an EP tube, and then the mixture was kept at 37°C overnight to allow the PER reaction to complete. Before mixing with CRISPR Cas14a, the PER final reaction product needed to be heated to 80°C for 5min to terminate the reaction.

[0050] 2. CRISPR Cas14a reaction:

[0051] 1 μM Cas14a and 1 μM (tracrRNA:crRNA mixture) were pre-incubated in DNA hybridization buffer at 37°C for half an hour, and then mixed with the activator solvent or PER final reactant. The total volume of the reaction solution was 20 μL, and the reaction was continuously shaken at 37°C for 1 h.

[0052] 3. Electrode modification:

[0053] The gold disk electrode (Φ = 2 mm) was polished with 0.3 μm and 0.05 μm alumina suspensions and then electrochemically cleaned in multiple steps (0.5 M NaOH, 0.5 M H 2 SO 4 , 0.01M KCl / 0.1MH 2 SO 4 and 0.05MH 2 SO 4 A series of oxidation and reduction cycles were performed.

[0054] The cleaned gold electrode was modified with 6μL 1μM ssDNA-MB and incubated at room temperature for 1h. The ssDNA-MB was diluted with DNA fixation buffer and treated with TCEP for 30min. Subsequently, the modified surface was rinsed with buffer and then passivated with 1mM MCH for 20min. The electrode was rinsed with buffer solution. Then, 6μL of activator and CRISPR Cas14a reactants or 6μL of PER final reactants and CRISPR Cas14a reactants were modified and reacted at 37°C for 1h. After the reaction, electrochemical measurements were performed.

[0055] 4. Verify that the target sequence triggers the production of PER:

[0056] 15% PAGE was used for analysis, and 5 μL of each sample was mixed with 6× loading buffer (1 μL). Then, the different mixtures (6 μL) were injected into a native polyacrylamide gel electrophoresis apparatus (PAGE). Using the samples prepared above, a 15% gel (30% polyacrylamide, 5× tris borate buffer (TBE), 10% ammonium persulfate (APS), TEMED) was run at a constant voltage of 100 V for 40 min. The gel was stained with silver stain for 20 min and then visualized on a gel imaging system. Figure 2 As shown. Bands 1, 2, 3, and 4 correspond to the four components participating in the PER reaction (target, hairpin H1, hairpin H2, and cleaning sequence). Because of their different base numbers, their migration rates are different. When the target and H1 coexist, the target can open H1 to form a new band with a higher base number than the target and H1, and a slower migration rate than the target and H1. Unreacted target and H1 remain in the solution (band 5). When only H1 and H2 exist in the solution and the target does not exist, the PER reaction will not occur. H1 and H2 can coexist stably in the solution without reacting with each other and presenting two clear and distinct bands (band 6). When the target, H1, and H2 are all present, the PER reaction can occur, and a product with a high relative molecular mass is produced. Unreacted H1 and H2 remain in the solution (band 7) ( Figure 2 ). Therefore, the feasibility of the PER reaction was confirmed by PAGE electrophoresis.

[0057] 5. Verify the feasibility of the CRISPR Cas14a reaction:

[0058] Fluorescence experiments were performed to analyze the reaction solution (activator and CRISPR Cas14a reactants or PER final reactants and CRISPR Cas14a reactants), and 5 μL of 1 μM fluorescent reporter probe (FAM-ssDNA) was added to the reaction solution (activator and CRISPR Cas14a reactants or PER final reactants and CRISPR Cas14a reactants), and DEPC water was added to make the final volume 200 μL. At an excitation wavelength of 490 nm, the emission spectrum of 510-600 nm was recorded. In addition, the slit width of the fixed excitation and emission fluorescence spectra was 3 nm. Electrochemical measurement: crRNA-activator as promoter. In the presence of all molecules at the same time, the addition of the activator activated the side branch cutting activity of Cas14a, which is reflected in the strong fluorescence characteristic peak (e curve in the figure). If any element is missing, the trans-cutting activity of Cas14a will be silenced, the fluorescent reporter probe will not be cut, and there will be no fluorescent signal (a, b, c, d curves in the figure) (Fig. 3A). Then, electrochemical measurement technology was used to verify the feasibility of CRISPR Cas14a action. The ACV current signal was used to estimate the current signal of MB. The ACV response of the gold electrode modified with MCH has no peak (curve a). When ssDNA-MB is modified, a sharp MB high oxidation characteristic peak (-0.3 to -0.2V) is clearly presented (curve b). However, when the activator mediates the action of CRISPR Cas14a, it leads to the degradation of ssDNA-MB on the electrode and a significant decrease in the current signal (curve c) (Fig. 3B). The intensity value of the peak obtained by CRISPR Cas14a reaction treatment is lower than that of the result without CRISPR Cas14a reaction treatment, which confirms the feasibility of CRISPR Cas14a reaction.

[0059] 6. Verify that electrode modification is successful

[0060] The electrochemical process of the activator-mediated action of CRISPR Cas14a was characterized using CV and EIS. The electrochemical measurement used a three-electrode system with a gold electrode as the working electrode, Ag / AgCl (3M KCl) as the reference electrode, and a platinum wire as the counter electrode. CV was performed in 1M KCl + 10mM K 3 [Fe(CN) 6 ] solution. The CV experimental parameters were -0.2V-0.7V, and the scanning frequency was 0.1V / s. EIS was performed in 1M KCl+10mM K 3 [Fe(CN) 6 ] / K 4 [Fe(CN) 6 ] solution, the amplitude is 0.01V; the frequency range is 0.01Hz~1×10 5 Hz. ACV test solution is 0.1M PB and 0.1M NaNO 3The ACV experimental conditions are voltage of -0.5V-0V, amplitude of 0.025C, and frequency of 100Hz. ΔI%=(I 0 -I) / I 0 , I 0 and I represent the current intensity in the absence and presence of the target, respectively.

[0061] like Figure 3 As shown in C, the bare gold electrode exhibits a sharp symmetrical redox peak (curve a), reflecting good electrochemical conductivity. After ssDNA-MB was immobilized on the surface of the bare gold electrode, the current decreased significantly (curve b). This phenomenon can be explained by the fact that DNA has a negatively charged backbone that repel the negatively charged redox probe, thereby increasing the electron transfer distance of the probe in the electrochemical reaction. MCH modification further reduced the current because the dense self-assembled layer hindered the electron transfer on the surface (curve c). In the presence of the activator-mediated CRISPR Cas14a action, the Cas14a single-stranded DNA enzyme activity was activated, cutting the ssDNA-MB from the gold electrode surface. Therefore, the current increased (curve d). These results are consistent with those obtained by EIS. (Fig.3D) This proves the successful assembly of ssDNA-MB on the sensor surface and the successful cutting action induced by the activator.

[0062] 7. Verify PER-mediated CRISPR Cas14a cleavage:

[0063] When the PER product induced by the introduction of the target (ctDNA EGFR L858R) is produced, the side chain cleavage activity of CRISPR Cas14a is activated, and the exogenous chain fluorescent reporter probe in the solution can be cleaved, thereby generating high-intensity fluorescence (e curve). However, when the target is not present, the side chain cleavage activity of CRISPR Cas14a is inhibited, and no fluorescence is generated (b curve). The results are the same when other components (fluorescent reporter probe, tracrRNA:crRNA, Cas14a) are missing (a, c, d curves). The results show that each component plays an important role in the successful production of PER-CRISPR Cas14a (Fig. 4A). These results are consistent with the results obtained by ACV response (Fig. 4B). Only when the target induces PER successfully will CRISPR Cas14a mediate the cutting of ssDNA-MB modified on the electrode surface. The significant decrease in current confirms the successful construction of the PER-CRISPR Cas14a electrochemical biosensor (e curve), while the current does not decrease when the reaction components are missing. This proves the successful cutting effect of target-induced.

[0064] 8. Electrochemical detection:

[0065] CV and EIS were used to simultaneously monitor the construction of the PER-CRISPR Cas14a electrochemical biosensor. Figure 5 As shown in A, the bare gold electrode presents a sharp symmetrical redox peak, showing the excellent conductivity of the bare gold electrode (curve a). When ssDNA-MB is modified on the upper electrode, the current decreases, which is because the negatively charged phosphate backbone in ssDNA-MB promotes K 3 [Fe(CN) 6 ] / K 4 [Fe(CN) 6 ] electrostatic repulsion between (b curve). When MCH is further modified, the current continues to decrease, because MCH can prevent electrons from penetrating into the electrode surface (c curve). However, when PER-CRISPR Cas14a is present, ssDNA-MB will be cut and washed away from the electrode surface by the buffer, the number of electrochemical labels on the electrode surface will change, and the current will increase (d curve). The EIS curve consists of two parts, a semicircular part reflecting the electron transfer resistance and a linear part related to electron diffusion. With the modification of ssDNA-MB (b curve, 758Ω), MCH (c curve, 944Ω), and PER-CRISPR Cas14a (d curve, 299Ω) on the surface of the bare gold electrode (a curve, 99.3Ω), the Ret value experienced a trend of first increasing and then decreasing, which is due to the successful modification of ssDNA-MB and the successful cleavage of PER-CRISPR Cas14a (Fig.5B). The above results prove that the construction of the PER-CRISPR Cas14a electrochemical biosensor is successful.

Claims

1. An electrochemical biosensor for detecting ctDNA EGFR L858R, Its characteristics are: include: The signal amplification system based on PER-CRISPRCas14a, the part that converts biological signals into electrical signals, and the electrode part; The signal amplification system includes: a target, a hairpin H1, a hairpin H2, a cleaning sequence, a Bst polymerase, tracrRNA and crRNA; the biological signal to electrical signal conversion part includes tracrRNA, crRNA and Cas14a protein; the electrode part includes: a gold electrode, ssDNA-MB and MCH; ssDNA-MB is fixed and modified on the surface of the gold electrode through an Au-S bond, and MCH is used to block non-specific sites on the surface of the gold electrode; The nucleotide sequence of the target is: 5’-GATTTTGGGCGGGCCAAACTG-3’; the nucleotide sequence of the hairpin H1 is: 5’-AATAAGAGATCAGTTTGGCCCGCCCAAAATCATCTCTTATT-3’; the nucleotide sequence of the hairpin H2 is: 5’-ATCTCTTATTGGGCCTTTTGGCCCAATAAGAGATAATAAGAGAT-3’; the nucleotide sequence of the cleaning sequence is: 5’-CCCCGAAAGTGGCCTCGGGCCTTTTGGCCCGAGGCCACTTTCG-3’; the nucleotide sequence of the tracrRNA is: 5’-CUUCACUGAUAAAGUGGAGAACCGCUUCACCAAAAGCUGUCCCUUAGGGGAUUAGAACUUGAGUGAAGGUGGGCUGCUUGCAUCAGCCUAAUGUCGAGAAGUGCUUUCUUCGGAAAGUAACCCUCGAAACAAAUUCAUUUGGAAUGCAAC-3’; the nucleotide sequence of the crRNA is: 5’-GAAUGAAGGAAUGCAACUAATAAGAGAT-3’; the nucleotide sequence of the ssDNA-MB is: 5’-SH-(CH 2 ) 6 -TTTTTTTTTTTTTTTTTTTT-MB-3’; The PER reaction is a primer exchange reaction; the MCH is 6-mercapto-1-hexanol.

2. A method for preparing an electrochemical biosensor for detecting ctDNA EGFR L858R as claimed in claim 1, Its characteristics are: The following steps are involved: PER reaction: First, heat hairpin H1 and hairpin H2 in DNA hybridization buffer to 95°C for annealing for 5 min, then cool to room temperature, and dilute the annealed hairpin H1 and hairpin H2 to 1 μM, respectively, for use as assembly probes for sensing; Then, the target, 1 μM H1, 1 μM H2, 1 μM cleaning sequence, 1 mM dNTP, 0.1 U Bst polymerase and 1 mM MgSO 4 Mix in an EP tube, and then keep the mixture at 37°C overnight to allow the PER reaction to complete; before mixing with CRISPRCas14a, the PER final reaction product needs to be heated to 80°C for 5 minutes to terminate the reaction; finally, a reaction product containing countless repeat sequences, namely the activator ATCTCTTATT, is generated; N in the dNTP is A, T or C; CRISPR Cas14a reaction: A mixture of 1 μM Cas14a, 1 μM tracrRNA and crRNA was pre-incubated in DNA hybridization buffer at 37 °C for half an hour, and then mixed with the PER final reaction. The total volume of the reaction solution was 20 μL, and the reaction was continuously shaken at 37 °C for 1 h. Electrode modification and electrochemical measurement: A Φ=2 mm gold disk electrode was polished with 0.3 μm and 0.05 μm alumina suspensions and then prepared by an electrochemical cleaning step; the cleaned gold electrode was modified with 6 μL 1 μM ssDNA-MB and incubated at room temperature for 1 h; the ssDNA-MB was diluted with DNA fixation buffer and treated with TCEP for 30 min; then, the modified surface was rinsed with buffer and then passivated with 1 mM MCH for 20 min; the gold electrode was rinsed with buffer solution; then 6 μL PER final reactant and CRISPR Cas14a reactant were modified and reacted at 37 °C for 1 h, and electrochemical measurements were performed after the reaction.

3. The method according to claim 2, Its characteristics are: The electrochemical cleaning step was carried out in 0.5M sodium hydroxide, 0.5M 2 SO 4 , 0.01M KCl / 0.1MH 2 SO 4 and 0.05MH 2 SO 4 Oxidation and reduction cycles occur.

Images