SNPs tightly linked to the control of vitamin C content in pepper fruit and their CAPS-specific primers and identification methods
Through the whole genome correlation analysis of the SNP data of pepper resequencing, SNPs closely related to vitamin C content were found, and CAPS-specific primers were designed for identification, which solved the problem of difficult to locate molecular markers closely linked to the vitamin C content of capsicum fruit in the prior art, and achieved efficient identification of pepper varieties with high vitamin C content.
Patent Information
- Application Number
- CN202211340960.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-30
- Publication Date
- 2025-04-18
- Estimated Expiration
- 2042-10-30
AI Technical Summary
The prior art is difficult to effectively locate and develop molecular markers closely linked to the vitamin C content of capsicum fruit, which affects the efficiency of quality breeding of peppers.
Genome-wide association analysis was performed by pepper resequencing SNP data, and it was found that the SNP located at 32482037bp of chromosome 1 was closely related to the vitamin C content, and CAPS-specific primers were designed for identification.
It has achieved efficient identification of pepper varieties with high vitamin C content, and has wide application value. It can identify high vitamin C content varieties during the pepper seedling stage.
Smart Images
Figure CN116042890B_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of molecular detection, and specifically to a SNP in pepper that is closely linked to controlling the vitamin C content of the fruit and its CAPS-specific primers and identification method. Background Art
[0002] Pepper fruit is rich in nutrients, among which vitamin C content ranks among the highest in vegetables. In recent years, with the rapid development of sequencing technology, molecular breeding technology has made rapid progress. Third-generation marker systems based on resequencing data, such as single nucleotide polymorphisms (SNPs) and insertion / deletion polymorphisms (InDels), have been found in large quantities in peppers for genetic positioning, diversity analysis, and marker-assisted selection (MAS).
[0003] The vitamin C content in pepper fruits varies significantly among different pepper varieties. The vitamin C synthesis pathway in peppers is relatively complex and has not yet been fully resolved. By comparing and analyzing the whole genome sequencing data of peppers, researchers found that there are three vitamin C synthesis pathways in peppers, including the main pathway L-galactose pathway (L-Galactose pathway) and the myo-inositol pathway (myo-inositol pathway) and two bypass pathways of uronic acid pathway (L-Galactose pathway). Genetic analysis shows that the vitamin C content in pepper fruits is controlled by additive-dominant-epistatic polygenes, with additive effects being the main factor, and the variance ratio of general combining ability to specific combining ability is large. At present, there are few studies on the positioning of quantitative genes related to the vitamin C content in pepper fruits. As a key trait in pepper quality breeding, it is urgent to continue to develop practical molecular markers that are closely linked to the vitamin C content trait in pepper fruits. Summary of the invention
[0004] The purpose of the present invention is to provide a SNP in pepper that is closely linked to controlling the vitamin C content of the fruit.
[0005] Another object of the present invention is to provide CAPS-specific primers for SNPs in peppers that are closely linked to the control of vitamin C content in fruits.
[0006] Still another object of the present invention is to provide a method for identifying pepper varieties with high fruit vitamin C content.
[0007] According to the SNP in pepper that is closely linked to controlling the vitamin C content of the fruit of the present application, the SNP is located at 32482037bp of chromosome 1, where the genomic base is A and the variant base is G.
[0008] The CAPS-specific primer pair of the SNP closely linked to the control of the vitamin C content of the fruit in pepper according to the present application includes the following primers:
[0009] Forward primer: F: 5'AGGCCCTACAATGTTGAGGT3',
[0010] Rear primer: R: 5'GCAAAGCATGTACCCTAAACTAG3'.
[0011] According to the method for identifying pepper varieties with high fruit vitamin C content of the present application, the method comprises the step of amplifying the sample to be tested using the CAPS specific primers of the SNPs tightly linked to the above-mentioned control of fruit vitamin C content.
[0012] According to the method for identifying pepper varieties with high fruit vitamin C content of the present application, the PCR amplification primers are subjected to VspI digestion. When the SNP site is the variant base G, there is one VspI digestion site in the PCR product, and there are two bright bands (194bp and 117bp) in agarose gel electrophoresis; when the SNP site is the reference genome base A, there are two VspI digestion sites in the PCR product, and the short band of 117bp is digested into short bands of 70bp and 47bp. The short bands are not obvious on the agarose electrophoresis gel, and only the obvious bright band of 194bp is present.
[0013] According to the method for identifying pepper varieties with high fruit vitamin C content in the present application, when the base at the SNP site is A, the count per second (cps) of the ion flow intensity of the vitamin C content of the pepper fruit measured by a broad targeted metabolomics method is greater than 9.0E+6; when the base at the SNP site is C, the vitamin C content of the pepper fruit is less than 9.0E+6 cps.
[0014] This application uses pepper resequencing SNP data to perform genome-wide association analysis (GWAS, Genome Wide Associated Study), and associates chromosome 1 to the site that controls the vitamin C content of pepper fruit. The vitamin C content of 287 pepper materials and the base type at Chr01:32482037 are statistically analyzed. The genotype of this site has a good correspondence with the high and low vitamin C content. CAPS primers are designed based on the SNP variation site and utilized. This application uses a large natural population to perform genome-wide association analysis, and the significantly associated SNP site obtained has a wide range of application value. The development and utilization of this marker can identify strains with high vitamin C content in the pepper seedling stage, with a highly efficient identification effect. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 Manhattan plot of genome-wide association analysis of vitamin C content in pepper fruit;
[0016] Figure 2Agarose gel electrophoresis diagram of PCR products and PCR products after restriction digestion, M, 50bp marker I; P1-P10, PCR products, band is 311bp; E1-E10, PCR products after restriction digestion. DETAILED DESCRIPTION
[0017] Example 1
[0018] 311 annual pepper (Capsicum annuum L.) samples were resequenced using the IlluminaSolexa sequencing platform. The raw data were processed using Trimmomatic v0.33 to remove adapters, poly-N and low-quality fragments to obtain clean data. The clean data were aligned to the Zunla-1 genome data using BWA0.75 with the parameters aln-o 1-e10-t 4-l 32-i 15-q 10. Samtools 0.1.19 was used with the Bayesian algorithm with the parameters -q 1-C50-SDm 2-F 0.002-u. The command mpileup was run to search for SNPs, filter SNPs, and set the minimum gene allele frequency to be greater than 0.01 and the missing rate to be less than 0.1.
[0019] The seeds and stalks of the 311 annual pepper (Capsicum annuum L.) fruits were removed, freeze-dried, and crushed into powder. The metabolome was determined using a broad targeted metabolome method, including the content of vitamin C. The SNPs and vitamin C content data obtained by the above filtration were subjected to genome-wide association analysis. The linear mixed model in Gemma was used for the genome-wide association analysis, as shown in Figure 1 As shown, there is a significant correlation signal on chromosome 1, where the pvalue at 32482037bp is 3.81e-11, the reference genome base is A, and the variant base is G.
[0020] CAPS primers were designed for the SNP site of Chr01: 32482037, the front primer was F: 5'AGGCCCTACAATGTTGAGGT3', and the rear primer was R: 5'GCAAAGCATGTACCCTAAACTAG3'.
[0021] The PCR amplification product of the above primers is 311bp. The PCR product is digested with VspI. When the SNP site is the variant base G, there is one VspI digestion site in the PCR product, and there are two obvious bright bands (194bp and 117bp) in agarose gel electrophoresis; when the SNP site is the reference genome base A, there are two VspI digestion sites in the PCR product, and the short band of 117bp is digested into short bands of 70bp and 47bp. The short band is not obvious on the agarose electrophoresis gel, and there is only an obvious 194bp bright band ( Figure 2 ), among which the 32482037bp site of materials 4, 5, and 9 was base A, and only an obvious 194bp band was found after enzyme digestion; the 32482037bp site of other materials was base G, and after enzyme digestion, two obvious bands of 194bp and 117bp were found.
[0022] The vitamin C content of 287 pepper materials and the base type at Chr01: 32482037 were counted. The genotype of this site has a good correspondence with the content of vitamin C. When the vitamin C content is 9.0E+6cps as the threshold, the base of the material with more than 9.0E+6cps at this site is A, and the base of the material with less than 9.0E+6cps at this site is G.
[0023] The above embodiments are only used to explain the technical solution of the present application and do not limit the protection scope of the present application.
Claims
1. A method for identifying pepper varieties by vitamin C content in fruits, characterized in that: The method comprises the step of amplifying the sample to be tested using CAPS specific primers of SNPs closely linked to the vitamin C content of the fruit, wherein the primer pair comprises the following primers: Forward primer: F: 5'AGGCCCTACAATGTTGAGGT3', Rear primer: R: 5′GCAAAGCATGTACCCTAAACTAG3′; The PCR amplification product was digested with VspI. When the SNP site tightly linked to the vitamin C content of the fruit was G, there was one VspI restriction site in the PCR product, and two bright bands were found in agarose gel electrophoresis, which were 194 bp and 117 bp respectively. When the SNP site tightly linked to the vitamin C content of the fruit was A, there were two VspI restriction sites in the PCR product, and only an obvious bright band of 194 bp was found in agarose gel electrophoresis. When the base of the SNP site that is tightly linked to the vitamin C content of the fruit is A, the ion flow intensity counts per second of the vitamin C content of the pepper fruit measured using a broad targeted metabolomics method is greater than 9.0E+6 cps; when the base of the SNP site that is tightly linked to the vitamin C content of the fruit is G, the ion flow intensity counts per second of the vitamin C content of the pepper fruit measured using a broad targeted metabolomics method is less than 9.0E+6 cps.