SSR Primers and Method for Identifying Rhododendron ovatum, Rhododendron latoucheae and Their Hybrids

Abstract

The present invention discloses SSR primers and a method for identifying Rhododendron ovatum, Rhododendron latoucheae and their hybrids. The SSR primers include: the first pair of SSR primer sequences: AGTGGGAGCAGGATT TGATG; CGAAGAGCTCCAATTCCAAG; the second pair of SSR primer sequences: CGGC CAGAGATGATGAAGAT; CGCTCGAAATTAATCACCGT; the third pair of SSR primer sequences: TGCTTTGTGAACTGAATGCC; ACCGTTCATATCTCCTCCC C; the fourth pair of SSR primer sequences: CTGGTGGTGATGAAGTGGTG; GGAATCAA CCGCTTATGGAA. These pairs of primers, alone or in combination, can clearly distinguish Rhododendron ovatum, Rhododendron latoucheae, and the hybrids of Rhododendron ovatum and Rhododendron latoucheae, achieving early and rapid identification of Rhododendron ovatum, Rhododendron latoucheae, and the hybrids of Rhododendron ovatum and Rhododendron latoucheae, with high identification accuracy.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and particularly relates to an SSR primer and method for identifying Rhododendron ovatum, Rhododendron latoucheae and their hybrids. Background Art

[0002] Rhododendron ovatum and Rhododendron latoucheae belong to the subgenus Azaleastrum of the genus Rhododendron in the family Ericaceae, and are evergreen ornamental flowers suitable for planting in gardens in patches.

[0003] Currently, there is very little research on Rhododendron ovatum and Rhododendron latoucheae. They are rarely artificially cultivated in the market, and no new varieties have been cultivated. They are in an undeveloped state. Each individual plant has its own specific characteristics. Some can be visually identified with the naked eye but it takes a long time, and some cannot be visually identified with the naked eye and new technologies such as molecular marker technology need to be used for identification. If a molecular marker technology that can accurately distinguish Rhododendron ovatum, Rhododendron latoucheae and the hybrid new varieties cultivated based on them can be developed, it will be expected to achieve early and rapid variety identification from a molecular perspective. Summary of the Invention

[0004] The present invention selects excellent individual plants of Rhododendron ovatum and Rhododendron latoucheae from wild rhododendron resources, and uses the method of artificial hybridization to successfully cultivate the hybrid of Rhododendron ovatum and Rhododendron latoucheae for the first time. These two rhododendrons, Rhododendron ovatum and Rhododendron latoucheae, belong to the same subgenus Azaleastrum. The hybrids of the two can bloom after 3 - 5 years of cultivation. The hybrids of Rhododendron ovatum and Rhododendron latoucheae have little difference in phenotype from the parents (Rhododendron ovatum, Rhododendron latoucheae) at the seedling stage, and show differences from the parents in morphological characteristics in the later stage. However, it is still necessary to combine the identification of various organs such as flowers, stems, leaves, and fruits to determine it as a hybrid. This traditional variety identification method often needs to wait until the seedlings grow into adult plants before it can be carried out, and the time experienced is relatively long. To solve the above technical problems, the present invention provides an SSR (Simple Sequence Repeats) primer for identifying Rhododendron ovatum, Rhododendron latoucheae and their hybrids, which is used to distinguish and identify Rhododendron ovatum, Rhododendron latoucheae, and the hybrid of Rhododendron ovatum and Rhododendron latoucheae, and can accurately distinguish these three species at the leaf - unfolding stage, and can quickly carry out early identification of the species.

[0005] An SSR primer for identifying Rhododendron ovatum, Rhododendron latoucheae and their hybrids includes one or more of the following first pair of SSR primer sequences, second pair of SSR primer sequences, third pair of SSR primer sequences, and fourth pair of SSR primer sequences;

[0006] The first pair of SSR primer sequences:

[0007] Forward primer sequence FPr1 (5'-3'): AGTGGGAGCAGGATTTGATG (SEQ ID NO: 1);

[0008] Reverse primer sequence RPr1 (5'-3'): CGAAGAGCTCCAATTCCAAG (SEQ ID NO: 2);

[0009] The second pair of SSR primer sequences:

[0010] Forward primer sequence FPr2 (5'-3'): CGGCCAGAGATGATGAAGAT (SEQ ID NO: 3);

[0011] Reverse primer sequence RPr2 (5'-3'): CGCTCGAAATTAATCACCGT (SEQ ID NO: 4);

[0012] The third pair of SSR primer sequences:

[0013] Forward primer sequence FPr3 (5'-3'): TGCTTTGTGAACTGAATGCC (SEQ ID NO: 5);

[0014] Reverse primer sequence RPr3 (5'-3'): ACCGTTCATATCTCCTCCCC (SEQ ID NO: 6);

[0015] The fourth pair of SSR primer sequences:

[0016] Forward primer sequence FPr4 (5'-3'): CTGGTGGTGATGAAGTGGTG (SEQ ID NO: 7);

[0017] Reverse primer sequence RPr4 (5'-3'): GGAATCAACCGCTTATGGAA (SEQ ID NO: 8).

[0018] In order to be applicable to a fluorescence detector, the SSR primers can be designed into fluorescence SSR marker primers by introducing one or more of existing fluorescence groups such as 6-carboxyfluorescein (FAM), hexachloro-6-methylfluorescein (HEX), 6-carboxytetramethylrhodamine (TAMRA), tetrachloro-6-carboxyfluorescein (TET), etc. Optionally, the fluorescence SSR marker primers are selected from one of FAM fluorescence SSR marker primers, HEX fluorescence SSR marker primers, TAMRA fluorescence SSR marker primers, TET fluorescence SSR marker primers, etc.

[0019] The position where the fluorescent group is incorporated into the SSR primer can be determined according to the existing techniques in the art. Taking the FAM fluorescent SSR labeling of the first pair of primer sequences as an example of routine operation, the following primer sequences are included:

[0020] Forward primer sequence FPr1 (5'-3'): FAM-AGTGGGAGCAGGATTTGATG;

[0021] Reverse primer sequence RPr1 (5'-3'): CGAAGAGCTCCAATTCCAAG.

[0022] The present invention also provides a method for identifying Rhododendron ovatum, Rhododendron latoucheae and their hybrids using the SSR primer. It can perform early identification of species during the leaf expansion period without waiting for a long growth period, which has important significance in production and is an effective method especially for the protection of new plant varieties rights.

[0023] The method for identifying Rhododendron ovatum, Rhododendron latoucheae and their hybrids using the SSR primer includes the steps:

[0024] (1) Extract the DNA of young leaves of each Rhododendron individual to be tested;

[0025] (2) Using the DNA extracted in step (1) as a DNA template, perform PCR amplification using the SSR primer;

[0026] (3) Detect the PCR amplification products by capillary electrophoresis to obtain the PCR amplification product bands of each Rhododendron individual to be tested, and determine the species to which each belongs according to the PCR amplification product bands of each Rhododendron individual to be tested.

[0027] The determination criteria for determining the species to which each belongs according to the PCR amplification product bands of each Rhododendron individual to be tested:

[0028] Judging according to the electrophoresis results of the first pair of SSR primer sequences: Those with a PCR amplification product band length of 196bp are Rhododendron ovatum; those with a PCR amplification product band length of 199bp are Rhododendron latoucheae; those with PCR amplification product band lengths of 196bp and 199bp are hybrids of Rhododendron ovatum and Rhododendron latoucheae;

[0029] Judging according to the electrophoresis results of the second pair of SSR primer sequences: Those with a PCR amplification product band length of 209bp are Rhododendron ovatum; those with a PCR amplification product band length of 197bp are Rhododendron latoucheae; those with PCR amplification product band lengths of 197bp and 209bp are hybrids of Rhododendron ovatum and Rhododendron latoucheae;

[0030] Judgment based on the electrophoresis results of the third pair of SSR primer sequences: The PCR amplification product with a band length of 213bp is Rhododendron ovatum; the PCR amplification product with a band length of 207bp is Rhododendron latoucheae; the PCR amplification product with band lengths of 207bp and 213bp is the hybrid of Rhododendron ovatum and Rhododendron latoucheae;

[0031] Judgment based on the electrophoresis results of the fourth pair of SSR primer sequences: The PCR amplification product with a band length of 271bp is Rhododendron ovatum; the PCR amplification products with band lengths of 265bp and 274bp are Rhododendron latoucheae; the PCR amplification products with band lengths of 265bp and 271bp are the hybrids of Rhododendron ovatum and Rhododendron latoucheae; the PCR amplification products with band lengths of 271bp and 274bp are the hybrids of Rhododendron ovatum and Rhododendron latoucheae.

[0032] The hybrid of the present invention includes the hybrid of Rhododendron ovatum and Rhododendron latoucheae, for example, the hybrid of Rhododendron ovatum as the female parent and Rhododendron latoucheae as the male parent.

[0033] The method for obtaining the SSR primers for identifying Rhododendron ovatum, Rhododendron latoucheae and their hybrids includes: designing SSR primers by transcriptome sequencing technology using the flowers of Rhododendron championiae in the same subgenus, and preliminarily screening out the SSR primers suitable for Rhododendron ovatum from the designed SSR primers; using the preliminarily screened SSR primers, comparing the PCR amplification results of Rhododendron latoucheae, Rhododendron ovatum and their hybrids, and using fluorescent SSR primers, and detecting by capillary electrophoresis after PCR amplification to obtain specific SSR primers or specific fluorescent SSR marker primers for identifying hybrids and parents.

[0034] The design of SSR primers includes: performing SSR analysis on the single sequences of more than 1kb obtained by screening using MISA software, and designing SSR molecular marker primers using Primer3 software.

[0035] All reagents used in the present invention are commercially available products or prepared by existing preparation methods.

[0036] The present invention has the following advantages:

[0037] Several pairs of specific SSR primers or specific fluorescent SSR marker primers of the present invention, alone or in combination, can clearly distinguish three varieties of Rhododendron ovatum, Rhododendron latoucheae, and the hybrid of Rhododendron ovatum and Rhododendron latoucheae, realizing the early and rapid identification of the three varieties of Rhododendron ovatum, Rhododendron latoucheae, and the hybrid of Rhododendron ovatum and Rhododendron latoucheae during the growth period, and the identification accuracy rate can reach 100%. It has important significance in production, especially as an effective method for the protection of new plant varieties.

[0038] The specific SSR primers or specific fluorescent SSR marker primers of the present invention can accurately obtain the size of the target DNA fragment, accurate to 1 bp, and the detection results are stable, accurate and efficient, which are suitable for the detection and analysis of a large number of samples.

[0039] The present invention has successfully constructed the standard DNA fingerprint maps for the identification of Rhododendron ovatum, Rhododendron latoucheae, the hybrid of Rhododendron ovatum and Rhododendron latoucheae by using several pairs of specific SSR primers or specific fluorescent SSR marker primers, which can be used for the early identification of Rhododendron ovatum, Rhododendron latoucheae, the hybrid of Rhododendron ovatum and Rhododendron latoucheae, with high accuracy and convenient for popularization and application. Description of the Drawings

[0040] Figure 1 It is the capillary electrophoresis result diagram of Rhododendron ovatum for the first pair of SSR primer sequences in Example 1;

[0041] Figure 2 It is the capillary electrophoresis result diagram of Rhododendron latoucheae for the first pair of SSR primer sequences in Example 1;

[0042] Figure 3 It is the capillary electrophoresis result diagram of the hybrid of Rhododendron ovatum × Rhododendron latoucheae for the first pair of SSR primer sequences in Example 1;

[0043] Figure 4 It is the capillary electrophoresis result diagram of Rhododendron ovatum for the second pair of SSR primer sequences in Example 1;

[0044] Figure 5 It is the capillary electrophoresis result diagram of Rhododendron latoucheae for the second pair of SSR primer sequences in Example 1;

[0045] Figure 6 It is the capillary electrophoresis result diagram of the hybrid of Rhododendron ovatum × Rhododendron latoucheae for the second pair of SSR primer sequences in Example 1;

[0046] Figure 7 It is the capillary electrophoresis result diagram of Rhododendron ovatum for the third pair of SSR primer sequences in Example 1;

[0047] Figure 8 It is the capillary electrophoresis result diagram of Rhododendron latoucheae for the third pair of SSR primer sequences in Example 1;

[0048] Figure 9 It is the capillary electrophoresis result diagram of the hybrid of Rhododendron ovatum × Rhododendron latoucheae for the third pair of SSR primer sequences in Example 1;

[0049] Figure 10 It is the capillary electrophoresis result diagram of Rhododendron ovatum for the fourth pair of SSR primer sequences in Example 1;

[0050] Figure 11 It is the capillary electrophoresis result diagram of Rhododendron latoucheae for the fourth pair of SSR primer sequences in Example 1;

[0051] Figure 12 It is a capillary electrophoresis result diagram of the Rhododendron ovatum × Rhododendron latoucheae hybrid for the fourth pair of SSR primer sequences in Example 1;

[0052] Figure 13 It is another capillary electrophoresis result diagram of the Rhododendron ovatum × Rhododendron latoucheae hybrid for the fourth pair of SSR primer sequences in Example 1;

[0053] Figure 14 It is an electrophoresis result diagram of each sample for primer B sequence in Comparative Example 2. Specific Embodiments

[0054] The technical solution of the present invention will be further described in detail below in conjunction with specific embodiments, so as to facilitate those skilled in the art to better understand the technical solution of the present invention.

[0055] Example 1

[0056] S1. Cultivate hybrids: Use 1 excellent wild Rhododendron ovatum single plant as the female parent and 1 excellent wild Rhododendron latoucheae single plant as the male parent to perform artificial pollination for the Rhododendron ovatum × Rhododendron latoucheae hybrid combination, obtain a hybrid fruit of 1 hybrid combination, collect the seeds of the hybrid fruit for planting, and obtain hybrid seedlings (hybrids). The hybrid seedlings bloom after 5 years of cultivation, and phenotypic identification is carried out on various organs such as their flowers, stems, leaves, and fruits, and it is determined to be a hybrid of Rhododendron ovatum and Rhododendron latoucheae; This traditional method of identifying specific varieties needs to wait until the seedlings grow into adult plants before it can be carried out, and the time experienced is relatively long (generally more than 5 years).

[0057] S2. Preliminary screening of SSR primers: Perform transcriptome sequencing on the flowers of Rhododendron championiae in the same subgenus (completed by BGI Group Co., Ltd.), use MISA software to perform SSR analysis on the single sequences (Unigene) above 1 kb obtained by screening, and use Primer3 software to design SSR molecular marker primers, and conduct the screening work of SSR primers from them.

[0058] During the leaf expansion period of Rhododendron latoucheae in April and the leaf expansion period of Rhododendron ovatum and hybrids in June, collect the young leaves of the female parent Rhododendron ovatum, the male parent Rhododendron latoucheae, and 9 hybrids of Rhododendron ovatum and Rhododendron latoucheae as samples and store them in liquid nitrogen. Use the cetyltrimethylammonium bromide (CTAB) method to extract the total DNA of each sample in the laboratory. First, use the total DNA of the female parent Rhododendron ovatum sample as the DNA template to screen SSR primers.

[0059] The PCR amplification of SSR molecular markers was carried out using a 10 μL reaction system. The 10 μL reaction system: 1 μL of 10× buffer (Buffer), 1 μL of 2.5 mmol / L dNTP, 1 μL of 5 U / μL Taq DNA polymerase, 1 μL of 10 μmol / L forward and reverse primers each, 1 μL of 20 - 40 ng / μL DNA, and the system was adjusted with sterilized double-distilled water to a final volume of 10 μL.

[0060] PCR amplification reaction procedure: Pre-denaturation at 94 °C for 4 min, then 30 s at 94 °C, 30 s at 54 °C - 56 °C, 60 s at 72 °C, for 35 cycles; finally, extension at 72 °C for 5 min.

[0061] Detection of PCR amplification products: Prepare a 2% agarose gel (the percentage of the grams of agarose gel to the milliliters of 1× TAE buffer) with 1× TAE buffer for the identification of PCR amplification products. Add 2 μL of 6× loading buffer to the 10 μL reaction system that has completed the PCR amplification reaction procedure and mix well as the PCR amplification product loading solution. 1× TAE buffer was used as the electrophoresis buffer; 4 μL of the PCR amplification product loading solution was added to each loading well; electrophoresis was carried out at a voltage of 200 V and a current of 300 mA for 0.5 h. Finally, use a gel imaging system to interpret the electrophoresis pattern and screen out 25 pairs of SSR primers with clear amplification bands and good repeatability.

[0062] S3. Determine SSR specific primers: Using the total DNA of the female parent Rhododendron ovatum sample, the total DNA of the male parent Rhododendron latoucheae sample, and the total DNA of 3 hybrid samples of Rhododendron ovatum and Rhododendron latoucheae (any 3 hybrids selected from 9 hybrids of Rhododendron ovatum and Rhododendron latoucheae) as DNA templates, screen the initially selected 25 pairs of SSR primers again. The reaction system, PCR amplification reaction procedure, and PCR amplification product detection are the same as in S2. Four pairs of SSR specific primers were screened out:

[0063] The sequence of the first pair of SSR primers:

[0064] Forward primer sequence FPr1 (5'-3'): AGTGGGAGCAGGATTTGATG (SEQ ID NO: 1);

[0065] Reverse primer sequence RPr1 (5'-3'): CGAAGAGCTCCAATTCCAAG (SEQ ID NO: 2);

[0066] The sequence of the second pair of SSR primers:

[0067] Forward primer sequence FPr2 (5'-3'): CGGCCAGAGATGATGAAGAT (SEQ ID NO: 3);

[0068] Reverse primer sequence RPr2 (5'-3'): CGCTCGAAATTAATCACCGT (SEQ ID NO: 4);

[0069] The third pair of SSR primer sequences:

[0070] Forward primer sequence FPr3 (5'-3'): TGCTTTGTGAACTGAATGCC (SEQ ID NO: 5);

[0071] Reverse primer sequence RPr3 (5'-3'): ACCGTTCATATCTCCTCCCC (SEQ ID NO: 6);

[0072] The fourth pair of SSR primer sequences:

[0073] Forward primer sequence FPr4 (5'-3'): CTGGTGGTGATGAAGTGGTG (SEQ ID NO: 7);

[0074] Reverse primer sequence RPr4 (5'-3'): GGAATCAACCGCTTATGGAA (SEQ ID NO: 8).

[0075] These four pairs of SSR specific primers can distinguish three types of individuals: the female parent Rhododendron ovatum, the male parent Rhododendron latoucheae, and the hybrid of Rhododendron ovatum and Rhododendron latoucheae.

[0076] S4. Verification of SSR specific primers by capillary electrophoresis

[0077] For the first pair of SSR primer sequences, FAM fluorescent primers were designed for PCR amplification. The reaction system, reaction program, and detection of PCR amplification products were the same as in S2. The PCR products were detected by capillary electrophoresis to obtain the lengths of the PCR amplification bands of the female parent Rhododendron ovatum, the male parent Rhododendron latoucheae, and 9 hybrids. The amplification band with a length of 199 bp was the male parent Rhododendron latoucheae, the amplification band with a length of 196 bp was the female parent Rhododendron ovatum, and the amplification bands with lengths of 199 bp and 196 bp were the hybrids of Rhododendron ovatum × Rhododendron latoucheae. The results showed that using the first pair of SSR primer sequences to distinguish Rhododendron ovatum, Rhododendron latoucheae, and the hybrid of Rhododendron ovatum × Rhododendron latoucheae, the three species of individuals could be clearly distinguished, and the identification results were accurate with an accuracy rate of 100%.

[0078] For the second pair of SSR primer sequences, FAM fluorescent primers were designed and PCR amplification was carried out. The reaction system, reaction program, and detection of PCR amplification products were the same as in S2. The PCR products were detected by capillary electrophoresis to obtain the lengths of the PCR amplification bands of the female parent Rhododendron ovatum, male parent Rhododendron latoucheae, and 9 hybrids. The amplification band length of 197 bp was for the male parent Rhododendron latoucheae, the amplification band length of 209 bp was for the female parent Rhododendron ovatum, and the amplification band lengths of 197 bp and 209 bp were for the Rhododendron ovatum×Rhododendron latoucheae hybrids. The results showed that using the second pair of SSR primer sequences to distinguish the three species of Rhododendron ovatum, Rhododendron latoucheae, and Rhododendron ovatum×Rhododendron latoucheae hybrids, the individuals of these three species could be clearly distinguished, and the identification results were accurate with an accuracy rate of 100%.

[0079] For the third pair of SSR primer sequences, FAM fluorescent primers were designed and PCR amplification was carried out. The reaction system, reaction program, and detection of PCR amplification products were the same as in S2. The PCR products were detected by capillary electrophoresis to obtain the lengths of the PCR amplification bands of the female parent Rhododendron ovatum, male parent Rhododendron latoucheae, and 9 hybrids. The amplification band length of 207 bp was for the male parent Rhododendron latoucheae, the amplification band length of 213 bp was for the female parent Rhododendron ovatum, and the amplification band lengths of 207 bp and 213 bp were for the Rhododendron ovatum×Rhododendron latoucheae hybrids. The results showed that using the third pair of SSR primer sequences to distinguish the three species of Rhododendron ovatum, Rhododendron latoucheae, and Rhododendron ovatum×Rhododendron latoucheae hybrids, the individuals of these three species could be clearly distinguished, and the identification results were accurate with an accuracy rate of 100%.

[0080] For the fourth pair of SSR primer sequences, FAM fluorescent primers were designed and PCR amplification was carried out. The reaction system, reaction program, and detection of PCR amplification products were the same as in S2. The PCR products were detected by capillary electrophoresis to obtain the lengths of the PCR amplification bands of the female parent Rhododendron ovatum, male parent Rhododendron latoucheae, and 9 hybrids. The amplification band lengths of 265 bp and 274 bp were for the male parent Rhododendron latoucheae, the amplification band length of 271 bp was for the female parent Rhododendron ovatum, the amplification band lengths of 265 bp and 274 bp were for the Rhododendron ovatum×Rhododendron latoucheae hybrids, and the amplification band lengths of 271 bp and 274 bp were for the Rhododendron ovatum×Rhododendron latoucheae hybrids. The results showed that using the fourth pair of SSR primer sequences to distinguish the three species of Rhododendron ovatum, Rhododendron latoucheae, and Rhododendron ovatum×Rhododendron latoucheae hybrids, the individuals of these three species could be clearly distinguished, and the identification results were accurate with an accuracy rate of 100%.

[0081] The above results show that: when using one or more combinations of the 4 pairs of SSR specific primers of the present invention to verify the species of Rhododendron ovatum, Rhododendron latoucheae and the hybrid of Rhododendron ovatum and Rhododendron latoucheae, the 3 species individuals of Rhododendron ovatum, Rhododendron latoucheae, and Rhododendron ovatum × Rhododendron latoucheae hybrid can be clearly distinguished, and the identification results are accurate, with an accuracy rate of up to 100%. It can be used for the identification of the new plant variety Rhododendron ovatum × Rhododendron latoucheae, providing a scientific and effective basis for the protection of the new plant variety right of Rhododendron ovatum × Rhododendron latoucheae. The specific identification results are shown in Table 1 - Table 4.

[0082] Table 1 Capillary electrophoresis results of the first pair of fluorescent SSR primers

[0083]

[0084] Table 2 Capillary electrophoresis results of the second pair of fluorescent SSR primers

[0085]

[0086]

[0087] Table 3 Capillary electrophoresis results of the third pair of fluorescent SSR primers

[0088]

[0089] Table 4 Capillary electrophoresis results of the fourth pair of fluorescent SSR primers

[0090]

[0091] Comparative example 1

[0092] Using primer A:

[0093] Forward primer sequence FPr5 (5'-3'): CCATTGCACCAAGAGACAGA (SEQ ID NO: 9);

[0094] Reverse primer sequence RPr5 (5'-3'): GTACCTCCATTCCCCCTTGT (SEQ ID NO: 10).

[0095] For primer A sequence, PCR amplification was carried out. The reaction system and reaction program were the same as those in S2 of Example 1. The DNA in the reaction system was respectively the total DNA of the female parent Rhododendron ovatum sample in Example 1 (extracted from young leaves during the leaf expansion period), the total DNA of the male parent Rhododendron latoucheae sample in Example 1 (extracted from young leaves during the leaf expansion period), and the total DNA of any 3 samples among 9 hybrids of Rhododendron ovatum and Rhododendron latoucheae (extracted from young leaves during the leaf expansion period). The PCR products were subjected to electrophoresis detection. After the PCR amplification reaction of the DNA of each sample, it was found that the total DNA of the Rhododendron latoucheae sample could not be amplified and subsequent detection could not be carried out, indicating that primer A could not distinguish the three species of the female parent Rhododendron ovatum, the male parent Rhododendron latoucheae, and the hybrid of Rhododendron ovatum and Rhododendron latoucheae; the experimental results showed that primer A sequence could not be used to identify the three species of Rhododendron ovatum, Rhododendron latoucheae, and Rhododendron ovatum × Rhododendron latoucheae hybrid.

[0096] Comparative Example 2

[0097] Using primer B:

[0098] Forward primer sequence FPr6 (5'-3'): TTGTGCATTCTCTAGGCACG (SEQ ID NO: 11);

[0099] Reverse primer sequence RPr6 (5'-3'): GACAAGAAAACCACCCGAAA (SEQ ID NO: 12).

[0100] For primer B sequence, PCR amplification was carried out. The reaction system and reaction program were the same as those in S2 of Example 1. The DNA in the reaction system was respectively the total DNA of the female parent Rhododendron ovatum sample in Example 1 (extracted from young leaves during the leaf expansion period) and the total DNA of any other 2 Rhododendron ovatum samples (extracted from young leaves during the leaf expansion period), the total DNA of the male parent Rhododendron latoucheae sample in Example 1 (extracted from young leaves during the leaf expansion period) and the total DNA of any other 2 Rhododendron latoucheae samples (extracted from young leaves during the leaf expansion period), and the total DNA of any 4 hybrid samples of Rhododendron ovatum and Rhododendron latoucheae in Example 1 (extracted from young leaves during the leaf expansion period). The PCR products were subjected to electrophoresis detection, and the electrophoresis results are shown in Figure 14 , where 1-3 are Rhododendron ovatum samples, 4-6 are Rhododendron latoucheae samples, and 7-10 are hybrid samples of Rhododendron ovatum and Rhododendron latoucheae. It shows that the electrophoresis patterns of 3 Rhododendron ovatum samples are unclear and abnormal bands appear, indicating that primer B cannot distinguish the three species of Rhododendron ovatum, Rhododendron latoucheae, and the hybrid of Rhododendron ovatum and Rhododendron latoucheae; the experimental results show that primer B sequence cannot be used to identify the three species of Rhododendron ovatum, Rhododendron latoucheae, and Rhododendron ovatum × Rhododendron latoucheae hybrid.

Claims

1. An SSR primer for identifying Rhododendron ovatum, Rhododendron latoucheae and their hybrids, characterized in that, Including one or more of the following first pair of SSR primer sequences, second pair of SSR primer sequences, third pair of SSR primer sequences, and fourth pair of SSR primer sequences; The first pair of SSR primer sequences: Forward primer sequence FPr1 (5′-3′): AGTGGGAGCAGGATTTGATG; Reverse primer sequence RPr1 (5′-3′): CGAAGAGCTCCAATTCCAAGTCCAAAG; The second pair of SSR primer sequences: Forward primer sequence FPr2 (5′-3′): CGGCCAGAGATGATGAAGAT; Reverse primer sequence RPr2 (5′-3′): CGCTCGAAATTAATCACCGT; The third pair of SSR primer sequences: Forward primer sequence FPr3 (5′-3′): TGCTTTGTGAACTGAATGCC; Reverse primer sequence RPr3 (5′-3′): ACCGTTCATATCTCCTCCCC; The fourth pair of SSR primer sequences: Forward primer sequence FPr4 (5′-3′): CTGGTGGTGATGAAGTGGTG; Reverse primer sequence RPr4 (5′-3′): GGAATCAACCGCTTATGGAA; The SSR primers are used to identify one or more of the rhododendrons selected from the group consisting of Rhododendron sibiricum, Rhododendron rufa, and a hybrid of Rhododendron sibiricum and Rhododendron rufa.

2. The SSR primer according to claim 1, wherein The SSR primer is a fluorescent SSR marker primer.

3. The SSR primer according to claim 2, characterized in that, The fluorescent SSR marker primer is one of a FAM fluorescent SSR marker primer, a HEX fluorescent SSR marker primer, a TAMRA fluorescent SSR marker primer, and a TET fluorescent SSR marker primer.

4. A method for identifying Rhododendron chinense, Rhododendron sibiricum and their hybrids using the SSR primers according to any one of claims 1 to 3, comprising the steps of: (1) extracting DNA from tender leaves of individual rhododendrons to be tested; the rhododendrons to be tested are one or more of Rhododendron sibiricum, Rhododendron sibiricum, or a hybrid of Rhododendron sibiricum and Rhododendron sibiricum; (2) using the DNA extracted in step (1) as a DNA template and performing PCR amplification using the SSR primers; (3) The PCR amplification products are detected by capillary electrophoresis to obtain the PCR amplification product bands of each cuckoo individual to be tested, and the species to which the PCR amplification product bands of each cuckoo individual to be tested are determined; the determination criteria for determining the species to which the PCR amplification product bands of each cuckoo individual to be tested belong are: According to the electrophoresis results of the first pair of SSR primer sequences, the PCR amplification product with a length of 196 bp is from the cypridaceae; the PCR amplification product with a length of 199 bp is from the rhododendron rutaecarpa; the PCR amplification product with a length of 196 bp and 199 bp is from the hybrid of the cypridaceae and the rhododendron rutaecarpa; According to the electrophoresis results of the second pair of SSR primer sequences, the PCR amplification product with a length of 209 bp is from the cypripedium sibiricum; the PCR amplification product with a length of 197 bp is from the rhododendron sibiricum; the PCR amplification product with a length of 197 bp and 209 bp is from the hybrid of the cypripedium sibiricum and the rhododendron sibiricum. Judgment was made based on the electrophoresis results of the third pair of SSR primer sequences: The PCR amplification product with a band length of 213 bp is *Rhododendron ovatum*; the PCR amplification product with a band length of 207 bp is *Rhododendron latoucheae*; the PCR amplification product with band lengths of 207 bp and 213 bp is the hybrid of *Rhododendron ovatum* and *Rhododendron latoucheae*. Judgment was made based on the electrophoresis results of the fourth pair of SSR primer sequences: The PCR amplification product with a band length of 271 bp is *Rhododendron ovatum*; the PCR amplification product with band lengths of 265 bp and 274 bp is *Rhododendron latoucheae*; the PCR amplification product with band lengths of 265 bp and 271 bp is the hybrid of *Rhododendron ovatum* and *Rhododendron latoucheae*; the PCR amplification product with band lengths of 271 bp and 274 bp is the hybrid of *Rhododendron ovatum* and *Rhododendron latoucheae*.

Images