A starch-hydrolyzing food-like lactobacillus strain derived from liquor Daqu and its application

By isolating the lactic acid bacteria strain Lactobacillus paralimentarius LBM12001 with high starch utilization ability from liquor Daqu, the shortcomings of the existing lactic acid bacteria in starch utilization were solved, and the effect of efficient hydrolysis of starch and fermentation and acid production without adding artificial enzyme preparations is achieved, which is suitable for the needs of the modern food industry.

CN116064305BActive Publication Date: 2025-06-06JIANGNAN UNIV +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211190530.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-28
Publication Date
2025-06-06
Estimated Expiration
2042-09-28

AI Technical Summary

Technical Problem

The existing lactic acid bacteria have shortcomings in their starch utilization ability, especially without adding artificial amylase preparations, which makes it difficult to effectively hydrolyze and ferment starch, which cannot meet the needs of modern industrial scale production.

Method used

By isolating a new lactic acid bacteria strain Lactobacillus paralimentarius LBM12001 from Baijiu Daqu, this strain has high starch utilization ability and excellent extracellular maltose amylase ability.

Benefits of technology

This strain can efficiently hydrolyze starch and ferment and produce acid without adding artificial enzyme preparations, which significantly improves the utilization rate of starch and the ability to produce lactic acid. It is suitable for the industrial production of foods such as sourdough.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116064305B_ABST
    Figure CN116064305B_ABST
Patent Text Reader

Abstract

The invention discloses a new starch hydrolyzing food-like lactic acid bacteria strain Lactobacillus paralimentarius LBM12001 derived from liquor daqu, with the deposit number of GDMCC 62232. The strain has high starch utilization ability and excellent extracellular amylase secretion ability, especially the extracellular maltogenic amylase secretion ability.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to a lactic acid bacteria, in particular to a starch hydrolyzing food-like lactic acid bacteria derived from white wine Daqu, and also to the application of the starch hydrolyzing food-like lactic acid bacteria. Background Art

[0002] Lactic acid bacteria is a general term for microorganisms that can produce a large amount of lactic acid by fermenting carbohydrates. It has important applications in fermented flour products in both the East and the West, such as the "starter" used in the fermentation of steamed bread in the East and the traditional sourdough in the West. The total number of lactic acid bacteria in sourdough is 10 7 ~10 9 cfu / g, which is the most abundant microorganism in sourdough. The presence of lactic acid bacteria can improve the nutritional value of finished bread, enhance the flavor of finished bread, improve the rheological properties and functional properties of dough, and extend the shelf life of bread.

[0003] However, lactic acid bacteria in nature usually give priority to using sugars such as glucose and maltose, and have a weak ability to utilize starch. Therefore, the current sourdough industry uses the method of adding artificial amylase preparations for industrial production. The addition of lactic acid bacteria with high starch hydrolysis activity can achieve starch hydrolysis and fermentation acid production in one step without adding artificial enzyme preparations. Although studies have found that some lactic acid bacteria have the ability to hydrolyze starch, the current research on starch-utilizing lactic acid bacteria is still in its initial stage and has not met the needs of modern industrial-scale production. It is urgent to breed lactic acid bacteria strains with better starch utilization ability.

[0004] At present, the total number of lactic acid bacteria isolated from sourdoughs in various countries exceeds 60, but the research on starch-utilizing lactic acid bacteria, especially maltogenic amylase-producing lactic acid bacteria, is still in its early stages. Since 2000, the research on maltogenic amylase has almost entirely focused on Bacillus, with only 4 papers involving lactic acid bacteria: Lactobacillus gasseri ATCC 33323 [1] , Lactobacillus plantarum ST-III [2] , Lactobacillus plantarum WCFS1 [3] , Lactobacillus plantarum S21 [4] These four strains of lactobacillus were reported to have maltogenic amylase genes. However, studies have found that the expression of maltogenic amylase-producing lactic acid is low. For example, although lactobacillus gasseri ATCC 33323 has enzyme activity when heterologously expressed in Escherichia coli, the strain does not produce effectively expressed amylase. [1]Therefore, screening lactic acid bacteria strains with better starch utilization ability is of great significance for the direct utilization of starch. References are as follows:

[0005] 1.Cho,MH,et al.,Extracellular Secretion of a Maltogenic Amylasefrom Lactobacillus gasseri ATCC33323 in Lactococcus lactis MG1363 and itsApplication on the Production of Branched Maltooligosaccharides.J MicrobiolBiotechnol,2007.17(9):p.1521-1526.

[0006] 2.Jeon,HY,et al.,Correction to Characterization of a Novel Maltose-Forming alpha-Amylase from Lactobacillus plantarum subsp.plantarum ST-III.JAgric Food Chem, 2016.64(50):p.9570.

[0007] 3. Bomrungnok, W., et al., Structure characterization and moleculardocking studies of α-amylase family-13glycosyl hydrolases from Lactobacillus plantarum complexed with maltoheptaose: a novel feature of α-amylase catalyticmechanism. Thai Journal of Agricultural ence, 2011: p.534-541.

[0008] 4.Khanongnuch,et al.,Characterization of a maltose-forming alpha-amylase from an amylolytic lactic acid bacterium Lactobacillus plantarumS21.Journal of Molecular Catalysis B Enzymatic,2015.120:p.1-8. Summary of the invention

[0009] The first object of the present invention is to provide a new strain of starch hydrolyzing food-like lactobacillus (Lactobacillus paralimentarius) LBM12001 derived from liquor Daqu, and its deposit number is GDMCC 62232. The inventor found through amplicon sequencing that the abundance of lactobacillus is high in the late storage period of Daqu, and then obtained a lactobacillus enrichment system by batter passage, from which the new strain was obtained. The strain has high starch utilization ability and excellent extracellular secretion ability of amylase, especially the ability of extracellular secretion of maltogenic amylase.

[0010] The food-like lactobacillus (Lactobacillus paralimentarius) LBM12001 provided by the present invention has been sent to the Guangdong Provincial Microbiological Collection Center for preservation on January 21, 2022, and received the preservation registration number GDMCC 62232. The preservation address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0011] Another object of the present invention is to relate to the use of the above-mentioned food-like Lactobacillus paralimentarius LBM12001.

[0012] Specifically, it relates to the application of food-like lactic acid bacteria LBM12001 as a lactic acid bacteria starter for sour dough and the application of food-like lactic acid bacteria LBM12001 for preparing maltogenic amylase, wherein the food-like lactic acid bacteria LBM12001 is placed in starch for fermentation to obtain maltogenic amylase. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is the community structure composition under continuous generation of Daqu.

[0014] Figure 2 To screen lactic acid bacteria with excellent growth performance under starch substrate;

[0015] (A) Growth of strains obtained in primary screening; (B) Lactic acid production and pH changes of strains obtained in secondary screening.

[0016] Figure 3 Growth, lactic acid production and carbohydrate utilization ability of food-like Lactobacillus LBM12001.

[0017] Figure 4 This is a sequence comparison of the amylase encoding gene amyA from the food-like Lactobacillus LBM12001 and the α-amylase protein from Lactobacillus plantarum.

[0018] Figure 5 This is a sequence comparison of the maltogenic amylase encoding gene lpaMA of the food-like Lactobacillus LBM12001 and the maltogenic amylase protein sequence from Lactobacillus plantarum.

[0019] Figure 6 This is the temporal transcription level of the α-amylase encoding gene amyA and the maltogenic amylase encoding gene lpaMA of the food-like Lactobacillus LBM12001.

[0020] Figure 7 It is the extracellular amylase activity of food-like Lactobacillus strain LBM12001 under the culture conditions of water-soluble starch as the carbon source.

[0021] Figure 8 is the colonization ability of strain LBM12001 in raw batter;

[0022] The data shown are the community structures of 16S rRNA gene amplicon sequencing.

[0023] Fig. 9 The specific enzyme activity of food-like Lactobacillus maltogenic amylase His6-LpaMA changes with pH;

[0024] The left picture shows water-soluble starch as the substrate; the right picture shows G2-β-CD as the substrate.

[0025] Fig.10 It is the maltogenic amylase sequence of food-like Lactobacillus LBM12001. DETAILED DESCRIPTION

[0026] Example 1: Enrichment method for obtaining lactic acid bacteria using Daqu as seed source

[0027] Weigh 10g of Luzhou-flavor liquor koji and 90g of flour as raw materials, add 160mL of sterile water, mix evenly in a 250mL sterile beaker, seal with plastic wrap, and incubate at 37℃ for 24h. Repeat the transfer 3 times, transfer 10g of the previous generation fermentation batter, add 84g of flour and 154mL of sterile water, mix evenly, and incubate at 37℃ for 24h.

[0028] At the end of each generation of fermentation, 20 mL of the sample was frozen in a -20 ° C refrigerator, and the fermentation was frozen and thawed uniformly. Take 5 mL of the sample, add 3 g of glass beads, and vortex 15 mL of saline for 30 min. Centrifuge at 300 r / min for 5 min, collect the supernatant, and add 15 mL of saline and repeat once. The collected supernatant was centrifuged at 8000 r / min to collect cells, and the sample genome was extracted using the PowerSoil DNA kit (MO BIO, USA). Primers 16s-v4-515F (sequence: GTGYCAGCMGCCGCGGTAA) and 16s-v4-806R (sequence: GGACTACNVGGGTWTCTAAT) were selected for amplicon sequencing of the fermentation samples.

[0029] The results are as follows Figure 1 As shown in the figure, the analysis of the changes in the bacterial flora during the passage sequence shows that the abundance of Lactobacillus increases with the passage sequence through continuous passage. After three passages, the genera with relative abundance > 1% are mainly Lactobacillus and Pediococcus, among which the abundance of Lactobacillus is as high as 67%. The abundance of Lactobacillus is high in the later stage of Daqu storage, and a Lactobacillus enrichment system can be obtained based on the batter passage method.

[0030] Example 2 Screening of lactic acid bacteria strains with high starch utilization ability

[0031] Take 10mL of the batter after the third fermentation, add 10mL of sterile saline and vortex for 3min, and let it stand for 20min at room temperature. Take the upper bacterial suspension, dilute it 10 times with sterile saline, and take 100uL to spread on the MRS screening plate containing CaCO3 (glucose 20g / L, peptone 10g / L, beef extract 10g / L, yeast extract 5g / L, diammonium hydrogen citrate 2g / L, Tween 80 1ml / L, sodium acetate 5g / L, dipotassium hydrogen phosphate 2g / L, magnesium sulfate 0.58g / L, manganese sulfate 0.25g / L, agar powder 20g / L; after sterilization, add 10g / L calcium carbonate and mix evenly and pour the plate). Culture in a 37℃ constant temperature incubator for 24h. When milky white or light yellow colonies appear and hydrolysis circles appear around them, it is preliminarily determined to be lactic acid bacteria. Pick a single colony for separation and purification, and then identify the genus. The species type of lactic acid bacteria strains was identified by 16s rRNA gene sequencing. The identified lactic acid bacteria strains were inoculated into test tubes filled with MRS liquid culture medium, and the seed solution was obtained by overnight culture. 5% was inoculated into water-soluble starch culture medium (water-soluble starch 20g / L, diammonium hydrogen citrate 2g / L, Tween 80 1ml / L, sodium acetate 5g / L, dipotassium hydrogen phosphate 2g / L, magnesium sulfate 0.58g / L, manganese sulfate 0.25g / L), and cultured at 37°C for 24h. After mixing evenly, 2mL of bacterial solution was drawn into a spectrophotometer, and the growth of the strain was measured at an absorbance of 600nm. The lactic acid bacteria that could not grow under the starch mechanism were filtered out by the high and low biomass of microbial growth, and the lactic acid bacteria with OD600>0.8 were selected for rescreening.

[0032] The strains with significantly increased OD600, i.e., OD600 values ​​higher than 0.8, were transferred to water-soluble starch medium and cultured at 37°C for 48 h. The fermented bacterial solution was vortexed for 30 s, and 5 mL was centrifuged at 8000 r / min for 5 min to collect the supernatant. The lactic acid concentration was detected using an SBA-40E three-channel biosensor analyzer (Key Laboratory of Biosensors, Shandong Province, China).

[0033] The results of strain screening are as follows Figure 2 As shown in the results, about 88% of the strains screened had an OD600 < 0.6 at the fermentation endpoint, 12% had an OD600 between 0.6 and 0.8 at the fermentation endpoint, and only 6% had an OD600 > 0.8 at the fermentation endpoint. Figure 2 A). This indicates that firstly enriching lactic acid bacteria from batter and then screening pure culture strains in water-soluble starch medium can effectively screen out strains with good growth ability in starch matrix.

[0034] The nine strains of lactic acid bacteria that were screened to have good growth ability in starch matrix were Lactobacillus plantarum and Lactobacillus quasicola. The fermentation test again showed that the lactic acid production capacity of these nine strains of lactobacillus in 20g / L water-soluble starch medium was >7g / L.

[0035] A strain with a lactic acid production capacity as high as 14 g / L was selected from the 9 lactobacilli strains, and was identified as Lactobacillus paralimentarius by 16s rRNA gene sequencing, with strain number LBM12001.

[0036] Example 3 Application of high starch food-like lactobacillus in batter fermentation

[0037] (1) Test of strain fermentation performance

[0038] The strain LBM12001 was activated in MRS medium overnight, inoculated into MRS and water-soluble starch medium at 5% (V / V), cultured at 37°C for 48 h, sampled and frozen every 2 h, and freeze-thawed to test OD600 and lactic acid production after fermentation.

[0039] After activation, the strain was inoculated into MRS medium at 5%, and the bacterial sludge was collected when it reached the logarithmic phase. The bacterial sludge was washed with sterile saline and inoculated into the dilute batter system at 107 CFU / g, and fermented at 37°C for 36 hours. After fermentation, 1 mL of batter was placed in a 1.5 mL centrifuge tube, centrifuged at 12000 r / min for 10 minutes, and the supernatant was collected to measure the lactic acid production and pH changes.

[0040] The experimental results are as follows Figure 3 As shown in AD, when glucose is used as the carbon source, the lactic acid bacteria quickly enter the logarithmic phase, with a maximum OD600 of 5.2 and a maximum specific growth rate of 0.58. In the water-soluble starch as the carbon source medium, the maximum OD600 is 0.89, which is only 17.1% of that when glucose is the carbon source. The maximum specific growth rate is 0.038, which is only 4.75% of that when glucose is the carbon source. However, from the trend of lactic acid and pH changes, it can be seen that although the biomass of the strain is much lower than that of glucose when starch is the carbon source, it has a higher lactic acid production capacity.

[0041] (2) Starch hydrolysis ability test

[0042] The strain LBM12001 was activated overnight in MRS medium, inoculated into water-soluble starch medium at 5% (V / V), fermented at 37°C for 72 hours, and sampled every 12 hours. The samples were centrifuged at 12000 r / min for 1 minute to obtain the supernatant, and the reducing sugar was measured by DNS method, and the total sugar was measured by sulfuric acid phenol method.

[0043] The total sugar determination method is as follows: take 2.0 mL of supernatant, add 1.0 mL of 6% phenol and 5.0 mL of concentrated sulfuric acid, shake well, cool and place at room temperature for 30 minutes, then measure the optical density at 490 nm (6% phenol: take 75 ul of 80% phenol in a beaker, add 960 ul of water). Reducing sugar determination method: take 400 ul of supernatant, add 600 ul of DNS reagent, boil in boiling water for 5 minutes, then immediately cool in an ice water bath, then add 3 ml of distilled water to each tube and mix well, and measure the optical density OD540 under an enzyme marker. (DNS reagent: 185g sodium tartrate was dissolved in 500mL ultrapure water (dissolved in a 50°C water bath); 24g sodium hydroxide was dissolved in 300ml water to prepare a 2M sodium hydroxide solution; 262mL 2M sodium hydroxide solution was added to 500mL sodium tartrate solution (50°C water bath), and then 6.3g 3,5-dinitrosalicylic acid (DNS), 5g phenol, and 5g sodium sulfite were added.

[0044] Starch content (g / L) = total sugar content (g / L) - reducing sugar content (g / L).

[0045] The experimental results are as follows Figure 3 As shown in EG, the initial starch content in the culture medium was about 15 g / L, the residual starch content at the end of fermentation was about 5 g / L, and the total starch consumption during the fermentation process was about 10 g / L, that is, the starch utilization rate of strain LBM12001 was as high as 66%, indicating that the strain LBM12001 has efficient starch hydrolysis ability.

[0046] (3) Amylase transcription

[0047] Through whole genome comparison, it was found that strain LBM12001 has a relatively complex starch utilization enzyme encoding gene cluster, which contains two amylase encoding genes: amyA, encoding α-amylase; lpaMA, encoding maltogenic amylase. The α-amylase protein sequence is 99% similar to the α-amylase protein from Lactobacillus plantarum ( Figure 4 ); the maltogenic amylase protein sequence is 45% similar to the protein from Lactobacillus plantarum ( Figure 5 ).

[0048] The strain LBM12001 was activated overnight in MRS medium, inoculated into water-soluble starch medium at 5% (V / V), fermented at 37°C for 48 h, and frozen immediately after sampling. RNA was extracted using MolPure Bacterial RNA kit (Yesen Biotechnology, Shanghai), and reverse transcribed using Takara 6210A kit (Takara Biotechnology, Dalian). Fluorescence quantitative PCR used 16srRNA gene as internal reference gene, and amplified α-amylase sequence with specific primers AmyA-F and AmyA-R; LpaMA-F and LpaMA-R amplified maltogenic amylase encoding gene sequence, and 2 -△△Ct The expression changes of α-amylase gene and maltogenic amylase gene during fermentation were analyzed and calculated by this method.

[0049] AmyA-F:ACATCCAGGCTGGTTCTTACG;

[0050] AmyA-R: CAGGCGGCGGGTATATTAAGT.

[0051] LpaMA-F: ATCGTTTCAAGGCACCAGAGT;

[0052] LpaMA-R:GTCGCCAAAGGCTGGATCTA.

[0053] RT-qPCR data showed Figure 6 As shown. In the water-soluble starch medium, the relative expression levels of the two amylase genes increased slowly in the first 18 hours; the relative expression levels of the amyA gene increased rapidly at 18-24 hours, and the lpaMA gene increased rapidly at 18-36 hours. The amyA gene reached a peak at 24 hours and maintained high expression until 42 hours of fermentation. The lpaMA gene reached a peak at 36 hours and gradually decreased after 36 hours. It can be inferred from the data results that in the water-soluble starch medium, the lactic acid bacteria used a small amount of reducing sugar in the medium to grow in the first 18 hours, and were in a starch hydrolysis state from 18 hours to 36 hours.

[0054] (4) Determination of crude enzyme activity

[0055] The strain LBM12001 was activated overnight in MRS medium and inoculated into water-soluble starch medium at 5% (V / V). The water-soluble starch was cultured to the logarithmic phase and centrifuged at 4°C, 8000r / min for 3min. The supernatant was the crude enzyme solution of extracellular enzyme. The precipitated bacterial sludge was washed with 50mM citric acid buffer and broken by a freezing press. The supernatant was taken as the crude enzyme solution of intracellular enzyme by centrifugation at 300r / min for 10min. The crude enzyme activity was studied using water-soluble starch and G2-β-CD as substrates. The substrate and crude enzyme solution were shaken and placed in a water bath at 37°C for 2h. DNS solution was added to the reaction solution, boiled for 5min, taken out and cooled on ice, and colorimetrically determined at a wavelength of 540nm.

[0056] The experimental results are as follows Figure 7 As shown in the figure, when water-soluble starch was used as the substrate, the intracellular enzyme activity was 31U / mL and the extracellular enzyme activity was 364U / mL, which was 12 times the intracellular enzyme activity. When G2-β-CD was used as the substrate, the intracellular enzyme activity was 36U / mL and the extracellular enzyme activity was 167U / mL, which was about 5 times the intracellular enzyme activity. The results showed that strain LBM12001 could not only hydrolyze ɑ-1,4 glycosidic bonds, but also ɑ-1,6 glycosidic bonds, and the two hydrolysis abilities were mainly manifested as extracellular hydrolysis activity.

[0057] The strain LBM12001 was activated overnight in MRS medium and inoculated into MRS medium at 5% (V / V). The strain was cultured in MRS until the logarithmic phase and the bacterial sludge was collected. The experimental group strains were inoculated at 10 7 CFU / g was inoculated in a dilute batter system and fermented at 37℃ for 36h. The blank control group was not inoculated with strains and the batter was fermented naturally. The experimental group and the blank group were sampled at 0h and the end point, and 20mL was frozen in a -20℃ refrigerator. After the fermentation, the samples were frozen and thawed uniformly. After freezing and thawing, 5mL of sample was taken, 3g of glass beads were added, and 15mL of normal saline was vortexed for 30min. Centrifuged at 300r / min for 5min, the supernatant was collected, and 15mL of normal saline was added and repeated once. The collected supernatant was centrifuged at 8000r / min to collect cells, and the sample genome was extracted using the PowerSoil DNA kit (MO BIO, USA). Primers 16s-v4-515F (GTGYCAGCMGCCGCGGTAA) and 16s-v4-806R (GGACTACNVGGGTWTCTAAT) were selected for amplicon sequencing of the fermentation samples to study the growth of inoculated lactic acid bacteria in batter.

[0058] The experimental results are as follows Figure 8 As shown, the relative content of food-like lactobacillus in the inoculated group was 30% at the start of fermentation, and the relative content increased to 47% at 36h. In the control group without exogenous inoculation, the main lactic acid bacteria that grew during the fermentation process was Lactobacillus plantarum, indicating that this strain can colonize well in the batter.

[0059] Example 4 Specific enzyme activity characteristics of food-type Lactobacillus amylase

[0060] The maltogenic amylase sequence was amplified with primers pET28a-lpaMA-F and ET28a-lpaMA-R.

[0061] pET28a-lpaMA-F:

[0062] AAGGAGATATACCATGGGCAATACACCAGCAATTTATCAT;

[0063] pET28a-lpaMA-R:

[0064] GATCTCAGTGGTGGTGGTGGTGGTGTTTAACTAATGCAAATCCTTTA.

[0065] The pET28a plasmid was linearized and amplified using primers pET28a-F and pET28a-R.

[0066] pET28a-F: CACCACCACCACCACCACTGAGATC;

[0067] pET28a-R: GCCCATGGTATATCTCCTTCTTAAAGTTAAAC.

[0068] BeyoMag TM The product was purified using a magnetic bead gel recovery kit (Biyuntian Biotechnology, Shanghai). The fragments were connected using a Seamless Cloning Kit (Biyuntian Biotechnology, Shanghai) to obtain gene fragment recombinant bacteria.

[0069] The recombinant bacteria were inoculated into LB medium containing kanamycin (0.5 g / L yeast powder, 10 g / L peptone, 10 g / L NaCl, 50 mg / L kanamycin), and cultured overnight at 37°C, 200 r / min shaking. The culture was expanded to OD600 of about 0.6, and 0.1 mmol / L IPTG was added to induce protein expression, and the culture was transferred to 17°C, 200 r / min shaking for 24 hours. The precipitate was collected by centrifugation at 8000 r / min for 3 minutes, resuspended in citric acid buffer (pH = 3), and the cells were ultrasonically disrupted. The supernatant obtained by centrifugation of the disrupted liquid at 300 r / min for 10 minutes was the crude protein liquid.

[0070] The crude protein solution was purified using an AKTA avant 25 protein purifier (GE Healthcare, USA) and a Ni NTA Unionrose 6FF metal chelate chromatography column (Yonglian Biotechnology Co., Ltd., Shanghai). The size of the target protein was determined by SDS-PAGE. The enzyme activity of the pure enzyme solution under different pH (3.0-5.0) environments was determined, and the reaction conditions were the same as in Example 3.

[0071] The results of enzyme activity test are as follows Fig. 9 As shown, when G2-β-CD is used as a substrate, the highest specific enzyme activity (3400U / mg) is obtained at pH 3.0, and the enzyme activity gradually decreases with the increase of pH; when water-soluble starch is used as a substrate, the highest specific enzyme activity (1240U / mg) is obtained at pH 3.5, and the enzyme activity gradually decreases with the increase of pH. The above results show that the specific activity of amylase gradually increases with the decrease of pH, and it exhibits better activity in an acidic environment. The extracellular pH of the lactic acid bacteria gradually decreases to 3.0 during the logarithmic growth period. Combined with the above extracellular crude enzyme activity determination, it shows that the extracellular maltose amylase activity of the food-like Lactobacillus strain LBM12001 is higher than that in the cell. The amylase is secreted from the cell to the extracellular environment and can perform the function of hydrolyzing starch in the low pH extracellular environment.

Claims

1. A starch-hydrolyzing food-like lactobacillus strain derived from liquor Daqu ( Lactobacillus paralimentarius )LBM12001, whose deposit number is GDMCC 62232, has the ability to secrete amylase extracellularly.

2. Application of the food-like lactobacillus LBM12001 according to claim 1 as a sourdough lactic acid bacteria starter.

3. Use of the food-like lactobacillus LBM12001 according to claim 1 in the preparation of maltogenic amylase, Its characteristics are: The nucleotide sequence of the gene encoding the maltogenic amylase is shown in SEQ ID NO.

11.

4. Use of the food-like lactobacillus LBM12001 according to claim 3 in the preparation of maltogenic amylase, Its characteristics are: The food-like lactobacillus LBM12001 is placed in a culture medium containing water-soluble starch for fermentation to obtain the maltogenic amylase.