Genetically engineered bacteria for high-yield L-cysteine, construction method and application

Abstract

The present invention relates to a genetically engineered bacterium with high yield of L-cysteine, a construction method thereof, and an application thereof in the preparation of L-cysteine by microbial fermentation. By constructing a DECR-CYS dynamic regulation system capable of responding to intracellular L-cysteine, different engineered promoters are used to drive an efficient L-cysteine transport system composed of the effectively screened L-cysteine transporters YdeD, YfiK, YeaS, AlaE and TolC, so as to obtain an engineered Escherichia coli strain with high yield of L-cysteine. The engineered strain constructed by the present invention can respond to the accumulation level of L-cysteine, dynamically activate the L-cysteine transport system, reduce the toxic effect of L-cysteine on cells, and has good production application value.

Description

(1) Technical Field

[0001] The present invention belongs to the field of metabolic engineering, and particularly relates to a genetically engineered bacterium capable of producing high-yield L-cysteine, a construction method thereof, and an application thereof in the preparation of L-cysteine by microbial fermentation. (2) Background Art

[0002] L-cysteine is the only amino acid with an active sulfhydryl group in organisms. Due to its unique physiological properties, it is closely related to many physiological processes in organisms. At the same time, L-cysteine is also widely used in industries such as food, medicine, and cosmetics.

[0003] In the food industry, L-cysteine is often used as a food flavoring agent, a dough property improver, etc.; in the pharmaceutical industry, because L-cysteine contains an active sulfhydryl group, it can be used as an antidote for various harmful substances, including diseases such as formaldehyde poisoning, inflammation, and leukopenia, as well as treating and preventing the harm caused by radiation to humans; in the cosmetics industry, due to the reducing property of the sulfhydryl group in the structure of L-cysteine, it can be used to regulate the production of melanin, effectively reduce the melanin produced by the cells in the lower layer of the skin surface, and maintain the normal metabolism of the skin, having the effect of whitening the skin.

[0004] The main production methods of L-cysteine include hair hydrolysis method, enzyme catalysis method, chemical synthesis method, and microbial fermentation method. The hair hydrolysis method is one of the main methods for producing L-cysteine at present, but this method will be accompanied by waste gas and waste liquid such as hydrogen sulfide; the chemical synthesis method has complex operations and high difficulty in resolution; the substrate of the enzyme catalysis method is expensive, and the economic benefit of industrial production is poor; the microbial fermentation method is one of the industrial production methods with great prospects, having the advantages of being environmentally friendly and having high economic benefits. However, at present, the toxicity of L-cysteine to cells and the complex metabolic pathway are the main reasons hindering the major breakthrough of the microbial fermentation method.

[0005] Metabolic engineering is crucial for the production of valuable chemicals by microorganisms. In recent years, with the rapid development of synthetic biology, dynamically regulating the flux of metabolic pathways has become a feasible method. Dynamic metabolic engineering can effectively improve key fermentation indexes, including yield, productivity, etc. By using a series of metabolite sensors and inducers, the flux of the cell's metabolic pathway can be greatly optimized to improve the production potential of the cell. (3) Summary of the Invention

[0006] In view of the above problems, the present invention constructs a DECR-CYS dynamic control system capable of responding to the intracellular L-cysteine concentration, and applies it to an engineered Escherichia coli strain for producing L-cysteine, thereby obtaining a genetically engineered bacterium capable of producing high-yield L-cysteine.

[0007] To achieve the above object of the present invention, the technical solution adopted by the present invention is as follows:

[0008] A genetically engineered bacterium with high-yield L-cysteine is constructed by the following method:

[0009] (1) Using the strain E.coil W3110 EYC as the chassis strain, replace the promoters of its transport proteins ydeD, yfiK, yeaS and alaE with P yhaO promoter to obtain the strain E.coliW3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE;

[0010] (2) Construct a P yhaO -apFAB689 expression cassette, and replace the promoter of the transport protein tolC of the strain E.coliW3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE with P yhaO -apFAB689 to obtain the strain E.coliW3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC;

[0011] (3) Prepare the strain obtained in step (2) into chemically competent cells, and transform the fermentation plasmid pE to obtain EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC / pE, which is the genetically engineered bacterium with high-yield L-cysteine.

[0012] The DecR protein is a transcriptional regulator in Escherichia coli and plays an important role in the L-cysteine detoxification process. Functionally, the DecR protein can bind to the promoter P yahOM in the presence of L-cysteine and activate the promoter P yhaOTranscription. Based on the function of the DecR protein, the present invention engineers it and designs a set of DECR-CYS dynamic control systems that can respond to the intracellular L-cysteine concentration, and applies it to the construction of high-yield L-cysteine strains of Escherichia coli. By using RBS engineering to modify the promoter P yhaO modification was carried out to obtain engineered promoters with different transcriptional intensities to meet the expression requirements of different target genes. At the same time, in order to further improve the level of L-cysteine production by Escherichia coli, an efficient L-cysteine outer transport system was screened and constructed, which was combined with the DECR-CYS dynamic control system to construct a genetically engineered strain capable of high-yield L-cysteine. The application of the DECR-CYS dynamic control system effectively couples the expression of the L-cysteine outer transport protein with the concentration of L-cysteine. The higher the L-cysteine concentration, the stronger the expression level of the transport protein, which efficiently promotes the extracellular accumulation of L-cysteine in the engineered strain.

[0013] Among them, the sequence of the promoter P yhaO is shown in SEQ ID NO.1, the sequence of apFAB689 is shown in SEQ ID NO.2, and the sequence of the DecR gene is shown in SEQ ID NO.3.

[0014] The present invention also relates to a method for constructing the genetically engineered bacterium capable of high-yield L-cysteine, and the method is as follows:

[0015] (1) Using the strain E.coil W3110 EYC as the chassis strain, applying the CRISPR-Cas9 gene editing technology, replacing the promoters of its transport proteins ydeD, yfiK, yeaS and alaE with P yhaO promoter to obtain the strain E.coliW3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE;

[0016] (2) Construct the P yhaO -apFAB689 expression combination, apply the CRISPR-Cas9 gene editing technology, and replace the promoter of the transport protein tolC of the strain E.coliW3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE with P yhaO -apFAB689 to obtain the strain E.coliW3110EYC::P yhaO-ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689 - tolC;

[0017] (3) Prepare the strain obtained in step (2) into chemically competent cells, and transform the fermentation plasmid pE to obtain EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689 - tolC / pE, which is the genetically engineered bacterium for high - yield L - cysteine.

[0018] The promoter P yhaO has the sequence shown in SEQ ID NO.1, the sequence of apFAB689 is shown in SEQ ID NO.2, and the sequence of the DecR gene is shown in SEQ ID NO.3.

[0019] The present invention also relates to the application of the above - mentioned genetically engineered bacterium in the microbial fermentation for preparing L - cysteine.

[0020] Specifically, the application is as follows: inoculate the genetically engineered bacterium into a fermentation medium, and ferment and culture it at 26 - 37°C and 200 - 800 rpm for 60 - 72 h. After the fermentation is completed, take the supernatant of the fermentation broth and separate and purify it to obtain L - cysteine.

[0021] The composition of the fermentation medium is as follows: glucose 30 g / L, (NH 4 ) 2 SO 4 10 g / L, KH 2 PO 4 1 g / L, Na 2 S 2 O 3 10 g / L, yeast extract 5 g / L, Na 2 HPO 4 1 g / L, peptone 1 g / L, 1 ml / L trace element solution, and the solvent is deionized water with the pH value being natural; the composition of the trace element solution is: 0.15 g / L Na 2 MoO 4 ·2H 2 O, 2.5 g / L H 3 BO 3 0.7 g / L CoCl 2 ·6H 2O, 0.25 g / L CuSO 4 ·5H 2 O, 1.6 g / L MnCl 2 ·4H 2 O, 0.3 g / L ZnSO 4 ·7H 2 O, and the solvent is deionized water.

[0022] Before the fermentation of the genetically engineered bacteria, they are usually first inoculated into a 10 ml test tube of LB medium and cultured on a shaker at a temperature of 37 °C and a rotation speed of 180 rpm for 12 h. Then, they are inoculated into 100 ml of the secondary seed liquid fermentation medium at an inoculation amount of 1% by volume and cultured on a shaker at a temperature of 30 °C and a rotation speed of 180 rpm for 12 h. Then, they are inoculated into the fermentation medium in a fermenter at an inoculation amount of 10% by volume for culture.

[0023] The present invention constructs a DECR-CYS dynamic regulation system capable of responding to intracellular L-cysteine, and uses different engineered promoters to drive an efficient L-cysteine transport system composed of the effectively screened L-cysteine transporters YdeD, YfiK, YeaS, AlaE, and TolC to obtain an Escherichia coli engineering strain with high-yield L-cysteine.

[0024] The beneficial effects of the present invention are mainly reflected in that the engineering strain constructed by the present invention can respond to the accumulation level of L-cysteine and dynamically activate the L-cysteine transport system. The higher the concentration of L-cysteine, the stronger the transcriptional level of the transporter protein in the L-cysteine transport system, which can effectively avoid the disordered overexpression or insufficient expression of the transport system: too high an expression level may cause waste of metabolic resources; too low an expression level may lead to insufficient external transport capacity. The DECR-CYS dynamic control system can enable the L-cysteine in the cell to be reasonably and effectively converted to the outside of the cell, reduce the toxic effect of L-cysteine on the cell, and has good production application value. (IV) Description of the Drawings

[0025] Figure 1 is the light intensity of the strain WT / pR under different concentrations of cysteine added externally;

[0026] Figure 2 is the fluorescence intensity of the series of strains WT / pR-X under the condition of 20 mM cysteine;

[0027] Figure 3 is the OD 600 and the L-cysteine content in the supernatant of the fermentation broth of the engineered bacteria constructed in Example 4;

[0028] Figure 4The OD of the engineered bacteria constructed in Example 5 600 and the L-cysteine content in the supernatant of the fermentation broth;

[0029] Figure 5 The OD of the engineered bacteria constructed in Example 6 600 and the L-cysteine content in the supernatant of the fermentation broth;

[0030] Figure 6 The OD of the engineered bacteria constructed in Example 7 600 and the L-cysteine content in the supernatant of the fermentation broth;

[0031] Figure 7 The OD of the engineered bacteria constructed in Example 8 600 and the L-cysteine content in the supernatant of the fermentation broth;

[0032] Figure 8 The OD of the engineered bacteria constructed in Example 9 600 and the L-cysteine content in the supernatant of the fermentation broth;

[0033] Figure 9 The OD of the engineered bacteria constructed in Example 10 600 and the L-cysteine content in the supernatant of the fermentation broth. (V) Specific implementation manners

[0034] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0035] The parental E. coli strain of the present invention is from the China Center for Type Culture Collection, with the preservation number CCTCC NO: M20191026, which has been disclosed in CN 111019877A.

[0036] The strain E. coli W3110 is from the Coli Genetic Stock Center of Yale University, with the preservation date of August 5, 1975 and the preservation number CGSC#4474, which has been disclosed in the patents US 2009 / 0298135A1 and US2010 / 0248311A1.

[0037] In the examples, the final concentration of kanamycin in the medium is 0.05 mg / L, the final concentration of spectinomycin in the medium is 0.05 mg / L, and the final concentration of ampicillin in the medium is 0.10 mg / L.

[0038] LB medium: peptone 10 g / L, yeast extract 5 g / L, sodium chloride 5 g / L, the solvent is deionized water, and the pH value is natural. The LB plate is prepared by adding agar with a final concentration of 2 g / L to the LB liquid medium.

[0039] Example 1: Determination of L-cysteine content

[0040] (1) Take 1 mL of the bacterial solution and place it in a 2 mL EP tube. Centrifuge at 12,000×g for 1 min to separate the supernatant and the precipitate. The supernatant is used for the detection of L-cysteine and other metabolites.

[0041] (2) Weigh 0.27 g of CNBF and dissolve it in 10 mL of acetonitrile as Solution I; use 0.2 M boric acid solution and 0.05 M borax solution as the stock solutions, and mix them in a volume ratio of 4:1 to prepare a pH = 9.0 standard buffer solution, denoted as Solution II. Dilute the sample to a concentration of 0 to 5 g / L. Mix 100 μL of the sample, 300 μL of Solution I, and 500 μL of Solution II, and react in a constant temperature oscillator at 60°C and 600 rpm for 1 h. The sample is filtered through a membrane and placed in a liquid phase bottle for testing.

[0042] (3) The instrument is a Thermo Fisher UPLC ultra-high pressure liquid chromatograph. The chromatographic column is a C18 column (4.6×250 mm, 5 μm); the detection wavelength of the ultraviolet detector is 260 nm; the injection volume is 10 μL; the column temperature is 30°C; the flow rate is 0.8 mL / min; the mobile phase uses two phases, A and B. Phase A is pure acetonitrile, and Phase B is a 50 mM HAc-NaAc buffer solution: acetonitrile: triethylamine = 82.8:17:0.2, pH = 4.9. The gradient elution program is shown in Table 1.

[0043] Table 1: Gradient elution program

[0044] Serial number Time (min) A(％) B(％) 1 0 18 82 2 3 20 80 3 5 35 65 4 8 35 65 5 10 50 50 6 12 50 50 7 13 80 20 8 15 70 30 9 18 18 82 10 23 18 82

[0045] Example 2: Construction of an L-cysteine dynamic response regulation system

[0046] (1) Using the pTrc99a plasmid as a template (99aline-F and 99aline-R), amplify by PCR to obtain a linearized vector. Using the E. coli W3110 genome as a template (primers Pyhao-F and Pyhao-R), amplify to obtain the promoter P yhaO fragment. Using the pET28a-eGFP plasmid as a template (primers eGFP-F and eGFP-R), amplify to obtain the eGFP fragment. Digest the PCR products with DpnI. Detect all PCR products by 1.0% agarose gel electrophoresis and purify the PCR fragments. The two recovered DNA fragments are fused into a complete DNA fragment P yhaO -eGFP. According to the instructions of the One step clone kit (Vazyme Biotech, Nanjing, China), ligate the linearized vector with the fusion fragment P yhaO-Linked with eGFP, transformed into E. coli DH5α, spread on ampicillin-resistant plates, and single colonies were picked and verified by colony PCR (primers 99a-VF and 99a-VR), and sequencing verification yielded pTrc99a-P yhaO -eGFP (pR) reporter plasmid. Promoter P yhaO The sequence is shown in SEQ ID NO.1. The primers are shown in Table 2

[0047] Table 2: Primers for Example 2

[0048] Primer name Sequence (5’-3’) <![CDATA[P yhao -F]]> aaatattctgaaatgagctgGAAAGCAGTAAACGCCGCG <![CDATA[P yhao -R]]> tttgctcaccatGGTCTGTTTCCTGTGTGAAATCCAGCACGACCCGCCGG eGFP-F gtgctggaTTTCACACAGGAAACAGACCATGGTGAGCAAAGGCGAGG eGFP-R tctcatccgccaaaacagccTCACTTGTACAGTTCGTCCATACCC 99aline-F GGCTGTTTTGGCGGATGAG 99aline-R CAGCTCATTTCAGAATATTTGCC 99a-VF GTTTGACAGCTTATCATCGACTGC 99a-VR AGACCGCTTCTGCGTTCTG

[0049] (2) Prepared E. coli W3110 into competent cells for transformation, and transformed the constructed pR plasmid into E. coli W3110 competent cells by chemical transformation method to obtain WT / pR strain

[0050] (3) Inoculated WT / pR into 10 mL of LB medium and cultured overnight at 37 °C and 180 rpm. Inoculated 1 mL of the pre-culture into a 250 mL shake flask containing 50 mL of LB medium, and added different concentrations of L-cysteine (1, 2.5, 5, 10, 20, 40, 60, 80, 100 mM) externally, and cultured at 37 °C and 180 rpm. Sampled every 2 h, and detected the fluorescence intensity using a microplate reader (excitation wavelength: 488, emission wavelength: 520). The change in fluorescence intensity is as Figure 1 shown

[0051] The said promoter P yhaO has the sequence shown in SEQ ID NO.1, and the sequence of the DecR gene is shown in SEQ ID NO.3

[0052] From Figure 1 it can be seen that after adding different concentrations of L-cysteine, the green fluorescent protein of the strain WT / pR achieved different expression intensities, and with the increase of the added concentration of L-cysteine, the fluorescence intensity also gradually increased. The expression of green fluorescent protein is driven by promoter P yhaO Above results show that in the presence of L-cysteine, the transcriptional regulator DecR can effectively activate the transcription of promoter P yhaO At the same time, the expression level of promoter P yhaO is positively correlated with the concentration of cysteine. The higher the concentration of L-cysteine, the stronger the transcriptional level of promoter P yhaO Example 3: Construct a combinatorial library of different strengths of RBS and promoter P

[0053] yhaO yhaO of the combination library

[0054] (1) Using plasmid pR as a template, through PCR site-directed mutagenesis, add RBS, apFAB689 (primers used are RBS689-F and universal RBS-R), apFAB685 (primers used are RBS685-F and universal RBS-R), and apFAB682 (primers used are RBS682-F and universal RBS-R) after promoter P on the pR plasmid. Digest the PCR products with DpnI. Transform the digested PCR products into E. coli DH5α, spread them on ampicillin-resistant plates, pick single colonies for sequencing verification (primers 99a-VF and universal RBS-R) to obtain vectors pTrc99a-P yhaO -apFAB689-eGFP (pR-1), pTrc99a-P yhaO -apFAB685-eGFP (pR-2), pTrc99a-P yhaO -apFAB682-eGFP (pR-3). The primers are shown in Table 3. yhaO

[0055] Table 3: Primers for Example 3

[0056]

[0057] (2) Prepare E. coli W3110 into chemically competent cells, and transform the constructed pR-1, pR-2, pR-3 plasmids into E. coli W3110 competent cells by chemical transformation to obtain strains WT / pR-1, WT / pR-2, WT / pR-3.

[0058] (3) Inoculate strains WT / pR-1, WT / pR-2, WT / pR-3 into 10 mL of LB medium and culture overnight at 37°C and 180 rpm. Inoculate 1 mL of the pre-culture into a 250 mL shake flask containing 50 mL of LB medium, and externally add different L-cysteine concentrations of 20 mM and culture at 37°C and 180 rpm. Take samples after 12 h of culture and use a microplate reader to detect the fluorescence intensity (excitation wavelength: 488, emission wavelength: 520). The change in fluorescence intensity is as Figure 2 shown.

[0059] The sequence of the said apFAB689 is shown in SEQ ID NO.2, the sequence of the said apFAB685 is shown in SEQ ID NO.4, and the sequence of the said apFAB682 is shown in SEQ ID NO.5.

[0060] Using RBS engineering, engineer the promoter P yhaO for engineering transformation. Combine different strengths of RBS and promoter P yhaO ​were combined to obtain different Promoter-RBS combinations. From Figure 2 It can be seen that after adding the same concentration of L-cysteine, different Promoter-RBS combinations showed different expression levels. At the same time, as the strength of RBS increased, the expression level of the Promoter-RBS combination also became stronger. This engineered modification effectively enriched the usability of the DECR-CYS dynamic control system and could meet the expression requirements of different target genes.

[0061] Example 4: Construction of an L-cysteine efficient transport system

[0062] (1) Using plasmid pTrc99a-cysE as a template, a linearized vector (primers pEline-F and pEline-R) was obtained by PCR amplification. Using the E. coli W3110 genome as a template, DNA fragments ydeD, yfiK, tolC, yeaS, and alaE were obtained by PCR amplification respectively. The PCR products were digested with DpnI. All PCR products were detected by 1.0% agarose gel electrophoresis and the PCR fragments were purified. According to the instructions of the One step clone kit (Vazyme Biotech, Nanjing, China), the linearized vector was ligated with the DCA fragments and transformed into E. coli DH5α. It was spread on an ampicillin-resistant plate, and single colonies were picked and verified by colony PCR (primers pE-VF and pE-VR). After sequencing verification, plasmids pTrc99a-cysE-ydeD (pED), pTrc99a-cysE-yfiK (pEK), pTrc99a-cysE-tolC (pEC), pTrc99a-cysE-yeaS (pES), and pTrc99a-cysE-alaE (pEA) were obtained. The primers are shown in Table 4.

[0063] Table 4: Primers for Example 4

[0064]

[0065]

[0066] (2) Prepare chemically competent cells from E. coli W3110EYC. Transform the constructed plasmids pTrc99a-cysE-ydeD (pED), pTrc99a-cysE-yfiK (pEK), pTrc99a-cysE-tolC (pEC), pTrc99a-cysE-yeaS (pES), and pTrc99a-cysE-alaE (pEA) into the competent cells of E. coli W3110EYC by chemical transformation method to obtain the strains E. coli W3110EYC / pED, E. coli W3110EYC / pEK, E. coli W3110EYC / pEC, E. coli W3110EYC / pES, and E. coli W3110EYC / pEA.

[0067] (3) Inoculate the strains E. coli W3110EYC / pED, E. coli W3110EYC / pEK, E. coli W3110EYC / pEC, E. coli W3110EYC / pES, and E. coli W3110EYC / pEA into 10 mL of LB medium respectively, and culture overnight at 37 °C and 180 rpm. Inoculate 1 mL of the pre-culture into a 500 mL shake flask containing 100 mL of SM medium, and culture at 30 °C and 200 rpm for 12 h. Inoculate 100 mL of the pre-culture into a fermenter containing 1 L of SM medium, and carry out fermentation culture at 25 - 37 °C and 200 - 800 rpm. When OD 600 = 10 - 30, add IPTG with a final concentration of 0.1 mM, and continue to culture until 60 h. After the fermentation is completed, measure the OD 600 of the fermentation broth, then take 1 mL of the fermentation broth, centrifuge at 12000 rpm at room temperature for 3 min, dilute the fermentation supernatant by 5 times, and detect according to the method of Example 1. The OD 600 and the content of L-cysteine in the fermentation broth supernatant are as shown in Figure 3 .

[0068] From Figure 3It can be seen that overexpression of yfiK, ydeD, tolC, yeaS, and alaE using plasmids effectively promoted the accumulation of L-cysteine in the engineered strain E. coli W3110 EYC. The yields of the strains E. coli W3110 EYC / pED, E. coli W3110 EYC / pEK, E. coli W3110 EYC / pES, E. coli W3110 EYC / pEC, and E. coli W3110 EYC / pEA reached 7.2, 7.0, 7.02, 6.73, and 6.82 g / L, respectively, which were 10%, 7%, 7%, 3%, and 4% higher than the yield of 6.56 g / L of the control strain E. coli W3110 EYC / pE. The above results indicate that overexpression of the above transporters on the plasmid can effectively promote the accumulation of L-cysteine in the engineered strain E. coli W3110 EYC.

[0069] Example 5: Construction and fermentation of the engineered strain E. coli W3110 EYC::P yhaO -ydeD / pE (ECY::D)

[0070] (1) Using the pTarget plasmid (Addgene Plasmid #62226) as a template, site-directed mutagenesis of the gRNA was performed by PCR amplification (primers pTTB-F and pTTB-R). The PCR product was digested with DpnI. The digested product was transformed into E. coli DH5α, spread on a spectinomycin plate, and single colonies were picked for sequencing verification (primers pTTB-VF and pTTB-VR) to screen for the successfully mutated pTarget-ydeD plasmid.

[0071] (2) Using the E. coli W3110 genome as a template, 500 bp sequences upstream and downstream of the ydeD promoter, as well as the promoter P yhaO , were amplified by PCR to obtain DNA fragments, Donor-ydeD-up (primers Up-F and Up-R), Donor-ydeD-down (primers Down-F and Down-R), and Donor-P yhaO (ydeD) (primers P yhaO -F and P yhaO -R). The above three DNA fragments were fused by fusion PCR to obtain the DNA fragment Donor-ydeD.

[0072] (3) Prepare the strain E. coli W3110EYC into chemically competent cells. Transform the pCas plasmid (Addgene Plasmid #62225) into the chemically competent cells of E. coli W3110EYC by chemical transformation method, and spread it on the kanamycin-resistant plate to obtain the strain E. coli W3110EYC / pCas.

[0073] (4) Prepare the strain E. coli W3110EYC / pCas into electrocompetent cells. After electrotransferring the plasmid pTarget-ydeD and the fragment Donor-ydeD into the electrocompetent cells of W3110EYC / pCas, spread it on the plate with double resistance of kanamycin and spectinomycin, pick single colonies for PCR verification (primers ydeDJYZ-VF and ydeDJYZ-VR), screen the successfully edited strains, and obtain E. coli W3110EYC::P yhaO -ydeD. The primers are shown in Table 5.

[0074] Table 5: Primers for Example 5

[0075]

[0076] (5) Pick positive single colonies and inoculate them into an LB test tube containing 1 mM IPTG and 0.05 mg / L kanamycin, culture overnight at 30 °C, streak on an LB plate containing 0.05 mg / L kanamycin, culture for 24 h at 30 °C, pick single colonies and streak on an LB plate containing 0.05 mg / L spectinomycin. For the single colonies that cannot grow on the LB plate containing 0.05 mg / L spectinomycin, the pTarget-ydeD plasmid has been successfully eliminated. Pick the single colonies with the pTarget-ydeD plasmid successfully eliminated into an LB test tube, culture overnight at 37 °C, streak the bacterial solution on an LB plate the next day, culture for 12 h at 37 °C, pick single colonies and streak on an LB plate containing 0.05 mg / L kanamycin. For the single colonies that cannot grow on the LB plate containing 0.05 mg / L kanamycin, the pCas plasmid has been successfully eliminated, and finally obtain plasmid-free E. coli W3110EYC::P yhaO -ydeD.

[0077] (6) Prepare the strain E. coli W3110EYC::P yhaO -ydeD into chemically competent cells. Transform the fermentation plasmid pE into the chemically competent cells of E. coli W3110EYC::P yhaO -ydeD, and spread it on the ampicillin-resistant plate to obtain the strain containing the fermentation plasmid E. coli W3110EYC::P yhaO -ydeD / pE (EYC::D). The constructed E. coli W3110EYC::P yhaO-ydeD / pE(EYC::D) was fermented and tested according to the method of Example 4(3). OD 600 and the L-cysteine content in the supernatant of the fermentation broth were as Figure 4 shown.

[0078] To achieve reasonable and efficient expression of the transporter, the DECR-CYS dynamic control system was used to drive the expression of the L-cysteine transport system. As can be seen from Figure 4 it, after the promoter of the transporter ydeD was replaced with P yhaO promoter, the L-cysteine yield of the strain E. coli W3110EYC::P yhaO -ydeD / pE(EYC::D) reached 6.91 g / L, which was 5% higher than that of the control strain E. coli W3110EYC / pE(ECY). The above results indicate that using the DECR-CYS dynamic control system to control the expression of the gene ydeD is effective in promoting the accumulation of L-cysteine in the engineered strain.

[0079] Example 6: Construction and fermentation of the engineered strain E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK / pE(ECY::DK)

[0080] (1) Using the pTarget plasmid (Addgene Plasmid#62226) as a template, the gRNA was site-directed mutated by PCR amplification (primers pTTB-F and pTTB-R). The PCR product was digested with DpnI. The digested product was transformed into E. coli DH5α, spread on a spectinomycin plate, and single colonies were picked for sequencing verification (primers pTTB-VF and pTTB-VR) to screen the successfully mutated pTarget-yfiK plasmid.

[0081] (2) Using the E. coli W3110 genome as a template, 500 bp sequences upstream and downstream of the yfiK promoter, as well as the promoter P yhaO were amplified by PCR to obtain DNA fragments, Donor-yfiK-up (primers Up-F and Up-R), Donor-yfiK-down (primers Down-F and Down-R) and Donor-P yhaO (yfiK) (primers -P yhaO -F and P yhaO -R). The above three DNA fragments were fused by fusion PCR to obtain the DNA fragment Donor-yfiK.

[0082] (3) The strain E. coli W3110EYC::PyhaO -ydeD was prepared into chemically competent cells, and the pCas plasmid (Addgene Plasmid #62225) was transformed into E. coli W3110 EYC::P by chemical transformation yhaO -ydeD chemically competent cells, and spread on a kanamycin-resistant plate to obtain the strain E. coli W3110 EYC::P yhaO -ydeD / pCas.

[0083] (4) The strain E. coli W3110 EYC::P yhaO -ydeD / pCas was prepared into electrocompetent cells. The plasmid pTarget-yfiK and the fragment Donor-yfiK were electroporated into W3110 EYC::P yhaO -ydeD / pCas electrocompetent cells, and then spread on a plate with double resistance to kanamycin and spectinomycin. Single colonies were picked for PCR verification (primers yfikJYZ-VF and yfikJYZ-VR) to screen for successfully edited strains, and the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK was obtained. The primers are shown in Table 6.

[0084] Table 6: Primers for Example 6

[0085]

[0086] (5) Single positive colonies E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK were inoculated into an LB test tube containing 1 mM IPTG and 0.05 mg / L kanamycin and cultured overnight at 30 °C. Then they were streaked on an LB plate containing 0.05 mg / L kanamycin and cultured at 30 °C for 24 h. Single colonies were picked and streaked on an LB plate containing 0.05 mg / L spectinomycin. Single colonies that could not grow on the LB plate containing 0.05 mg / L spectinomycin had successfully eliminated the pTarget-yfiK plasmid. Single colonies with successfully eliminated pTarget-yfiK plasmid were picked into an LB test tube and cultured overnight at 37 °C. The next day, the bacterial solution was streaked on an LB plate and cultured at 37 °C for 12 h. Single colonies were picked and streaked on an LB plate containing 0.05 mg / L kanamycin. Single colonies that could not grow on the LB plate containing 0.05 mg / L kanamycin had successfully eliminated the pCas plasmid. Finally, the plasmid-free E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK was obtained.

[0087] (6) The strain E. coli W3110 EYC::PyhaO -ydeD::P yhaO -yfiK was prepared into chemically competent cells, and the fermentation plasmid pE was transformed into E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK chemically competent cells were spread on an ampicillin-resistant plate to obtain the strain E. coli W3110 EYC::P containing the fermentation plasmid yhaO -ydeD::P yhaO -yfiK / pE(EYC::DK). The constructed E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK / pE(EYC::DK) was fermented and tested according to the method of Example 4(3). OD 600 and the L-cysteine content in the supernatant of the fermentation broth were as Figure 5 shown

[0088] In order to further increase the accumulation of L-cysteine in the engineered strain, the expression of yfiK was driven by the DECR-CYS dynamic control system based on the strain E. coli W3110 EYC::P yhaO -ydeD to obtain the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK. It can be seen from Figure 5 that after the promoter of the transporter yfiK was replaced with P yhaO promoter, the L-cysteine yield of the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK / pE(EYC::DK) reached 7.27 g / L, which was 5% higher than that of the control strain E. coli W3110 EYC::P yhaO -ydeD / pE(EYC:D). The above results show that using the DECR-CYS dynamic control system to control the expression of the gene yfiK is effective in promoting the accumulation of L-cysteine in the engineered strain

[0089] Example 7: Construction and fermentation of the engineered strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS / pE(EYC::DKS)

[0090] (1) Using the pTarget plasmid (Addgene Plasmid#62226) as a template, the gRNA was site-directed mutagenized by PCR amplification (primers pTTB-F and pTTB-R). The PCR product was digested with DpnI. The digested product was transformed into E. coli DH5α and spread on a spectinomycin plate. Single colonies were picked for sequencing verification (primers pTTB-VF and pTTB-VR) to screen for the successfully mutated pTarget-yeaS plasmid.

[0091] (2) Using the E. coli W3110 genome as a template, 500 bp sequences upstream and downstream of the yeaS promoter, as well as the promoter P yhaO , were PCR amplified to obtain DNA fragments, Donor-yeaS-up (primers Up-F and Up-R), Donor-yeaS-down (primers Down-F and Down-R), and Donor-P yhaO (yeaS) (primers P yhaO -F and P yhaO -R). The above three DNA fragments were fused by fusion PCR to obtain the DNA fragment Donor-yeaS.

[0092] (3) The strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK was prepared into chemically competent cells, and the pCas plasmid (Addgene Plasmid#62225) was transformed into the chemically competent cells of E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK by chemical transformation and spread on a kanamycin-resistant plate to obtain the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK / pCas.

[0093] (4) The strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK / pCas was prepared into electrocompetent cells. The plasmid pTarget-yeaS and the fragment Donor-yeaS were electrotransformed into the electrocompetent cells of W3110 EYC::P yhaO -ydeD::P yhaO -yfiK / pCas and then spread on a plate with double resistance to kanamycin and spectinomycin. Single colonies were picked for PCR verification (primers yeaSJYZ-VF and yeaSJYZ-VR) to screen for successfully edited strains, obtaining E. coli W3110 EYC::PyhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS. The primers are shown in Table 7.

[0094] Table 7: Primers of Example 7

[0095] Primer name Sequence (5’-3’) pTTB-F TAATACTAGTCTGATTAATGATTCAATTATGTTTTAGAGCTAGAAATAGC pTTB-R GCTCTAAAACATAATTGAATCATTAATCAGACTAGTATTATACCTAGGAC Up-F TCGATCTCGATATTCGCATTGG Up-R tactgctttcTCAGGCATGCTCCAGTGAAAA <![CDATA[P yhaO -F]]> gcatgcctgaGAAAGCAGTAAACGCCGCG <![CDATA[P yhaO -R]]> GGTCTGTTTCCTGTGTGAAATCCAGCACGACCCGCCGG Down-F tgctggaTTTCACACAGGAAACAGACCGTGTTCGCTGAATACGGGGTT Down-R TAGCAGAAACTCACCAGTTCCAGC pTTB-VF GTCAGTGAGCGAGGAAGCGG pTTB-VR TAGCACGATCAACGGCACTG yeaSJYZ-VF CAGCAGCTTTGGTTTTGGAC yeaSJYZ-VR AATGGCCAGTCCTCCGCGTGATG

[0096] (5) Pick a positive single colony of E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS and inoculate it into an LB test tube containing 1 mM IPTG and 0.05 mg / L kanamycin. Culture it overnight at 30 °C, streak it on an LB plate containing 0.05 mg / L kanamycin, culture it at 30 °C for 24 h, and pick a single colony and streak it on an LB plate containing 0.05 mg / L spectinomycin. For the single colonies that cannot grow on the LB plate containing 0.05 mg / L spectinomycin, the pTarget-yeaS plasmid has been successfully eliminated. Pick the single colonies with successfully eliminated pTarget-yeaS plasmid into an LB test tube, culture it overnight at 37 °C, streak the bacterial solution on an LB plate the next day, culture it at 37 °C for 12 h, and pick a single colony and streak it on an LB plate containing 0.05 mg / L kanamycin. For the single colonies that cannot grow on the LB plate containing 0.05 mg / L kanamycin, the pCas plasmid has been successfully eliminated, and finally, plasmid-free E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS is obtained.

[0097] (6) Prepare chemically competent cells from the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS, and transform the fermentation plasmid pE into the chemically competent cells of E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS. Spread it on an ampicillin-resistant plate to obtain the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS / pE(EYC::DKS). The constructed E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::PyhaO -yeaS / pE(EYC::DKS) was fermented and tested according to the method of Example 4(3). OD 600 and the L-cysteine content in the supernatant of the fermentation broth were as Figure 6 shown.

[0098] In order to further improve the accumulation of L-cysteine in the engineered strain, on the basis of the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK, the DECR-CYS dynamic control system was used to drive the expression of yfiK, and the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS was obtained. From Figure 6 it can be seen that after the promoter of the transporter yeaS was replaced with P yhaO promoter, the L-cysteine yield of the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS / pE(EYC::DKS) reached 7.47 g / L. The above results indicate that using the DECR-CYS dynamic control system to control the expression of the gene yeaS is effective in promoting the accumulation of L-cysteine in the engineered strain.

[0099] Example 8: Construction and fermentation of the engineered strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE / pE(EYC::DKSA)

[0100] (1) Using the pTarget plasmid (Addgene Plasmid #62226) as a template, the gRNA was site-directed mutated by PCR amplification (primers pTTB-F and pTTB-R). The PCR product was digested with DpnI. The digested product was transformed into E. coli DH5α, spread on a spectinomycin plate, and single colonies were picked for sequencing verification (primers pTTB-VF and pTTB-VR) to screen the successfully mutated pTarget-alaE plasmid.

[0101] (2) Using the E. coli W3110 genome as a template, the 500 bp sequences upstream and downstream of the alaE promoter, as well as the promoter P yhaO, DNA fragments were obtained, namely Donor-alaE-up (primers Up-F and Up-R), Donor-alaE-down (primers Down-F and Down-R), and Donor-P yhaO (alaE) (primers P yhaO -F and P yhaO -R). The above three DNA fragments were fused by fusion PCR to obtain the DNA fragment Donor-alaE.

[0102] (3) The strain E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS was prepared into chemically competent cells, and the pCas plasmid (Addgene Plasmid #62225) was transformed into the chemically competent cells of E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS by chemical transformation method, and then spread on a kanamycin-resistant plate to obtain the strain E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS / pCas.

[0103] (4) The strain E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS / pCas was prepared into electrocompetent cells. The plasmid pTarget-alaE and the fragment Donor-alaE were electrotransformed into the electrocompetent cells of W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS / pCas, and then spread on a plate with double resistance to kanamycin and spectinomycin. Single colonies were picked for PCR verification (primers alaEJYZ-VF and alaEJYZ-VR) to screen the successfully edited strains, and the strain E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE was obtained. The primers are shown in Table 8.

[0104] Table 8: Primers for Example 8

[0105]

[0106] (5) Pick the positive single colony E.coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE and inoculate it into an LB test tube containing 1 mM IPTG and 0.05 mg / L kanamycin, culture it overnight at 30 °C, streak it on an LB plate containing 0.05 mg / L kanamycin, culture it at 30 °C for 24 h, pick the single colony and streak it on an LB plate containing 0.05 mg / L spectinomycin. For the single colony that cannot grow on the LB plate containing 0.05 mg / L spectinomycin, its pTarget-alaE plasmid has been successfully eliminated. Pick the single colony with the successfully eliminated pTarget-alaE plasmid into an LB test tube, culture it overnight at 37 °C, streak the bacterial solution on an LB plate the next day, culture it at 37 °C for 12 h, pick the single colony and streak it on an LB plate containing 0.05 mg / L kanamycin. For the single colony that cannot grow on the LB plate containing 0.05 mg / L kanamycin, its pCas plasmid has been successfully eliminated, and finally, plasmid-free E.coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE is obtained.

[0107] (6) Prepare the strain E.coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE into chemically competent cells, and transform the fermentation plasmid pE into the chemically competent cells of E.coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE, and spread it on an ampicillin-resistant plate to obtain the strain E.coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE / pE(EYC::DKSA). The constructed E.coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO-alaE / pE(EYC::DKSA) was fermented and tested according to the method of Example 4(3). OD 600 and the L-cysteine content in the supernatant of the fermentation broth were as Figure 7 shown.

[0108] In order to further improve the accumulation of L-cysteine in the engineered strain, on the basis of the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS, the promoter of the transporter alaE was replaced with P yhaO promoter to obtain the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE. It can be seen from Figure 7 that by using the DECR-CYS dynamic control system to drive the expression of yfiK, the L-cysteine yield of the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE / pE(EYC::DKSA) reached 7.62 g / L. The above results indicate that using the DECR-CYS dynamic control system to control the expression of the gene alaE is effective in promoting the accumulation of L-cysteine in the engineered strain.

[0109] Example 9: Construction and fermentation of the engineered strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -tolC / pE(EYC::DKSAC)

[0110] (1) Using the pTarget plasmid (Addgene Plasmid #62226) as a template, the gRNA was site-directed mutated by PCR amplification (primers pTTB-F and pTTB-R). The PCR product was digested with DpnI. The digested product was transformed into E. coli DH5α, spread on a spectinomycin plate, and single colonies were picked for sequencing verification (primers pTTB-VF and pTTB-VR) to screen for the successfully mutated pTarget-tolC plasmid.

[0111] (2) Using the E. coli W3110 genome as a template, amplify the 500 bp sequences upstream and downstream of the tolC gene promoter, as well as promoter P yhaO , to obtain DNA fragments, Donor-tolC-up (primers Up-F and Up-R), Donor-tolC-down (primers Down-F and Down-R), and Donor-P yhaO (tolC) (primers P yhaO -F and P yhaO -R). Fuse the above three DNA fragments by fusion PCR to obtain the DNA fragment Donor-tolC.

[0112] (3) Prepare the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE into chemically competent cells, and transform the pCas plasmid (Addgene Plasmid #62225) into the chemically competent cells of E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE by chemical transformation method, and spread it on a kanamycin-resistant plate to obtain the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE / pCas.

[0113] (4) Prepare the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE / pCas into electrocompetent cells. Electroporate the plasmid pTarget-tolC and the fragment Donor-tolC into the electrocompetent cells of W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE / pCas, then spread it on a plate with double resistance to kanamycin and spectinomycin, pick single colonies for PCR verification, screen the successfully edited strains, and obtain E. coli W3110 EYC::P yhaO-ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -tolC. The primers are shown in Table 9.

[0114] Table 9: Primers for Example 9

[0115]

[0116] (5) Pick a positive single colony of E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -tolC and inoculate it into an LB test tube containing 1 mM IPTG and 0.05 mg / L kanamycin. Culture it overnight at 30 °C, streak it on an LB plate containing 0.05 mg / L kanamycin, culture it at 30 °C for 24 h, pick a single colony and streak it on an LB plate containing 0.05 mg / L spectinomycin. For the single colonies that cannot grow on the LB plate containing 0.05 mg / L spectinomycin, the pTarget-tolC plasmid has been successfully eliminated. Pick the single colonies with successfully eliminated pTarget-tolC plasmid into an LB test tube, culture it overnight at 37 °C. The next day, streak the bacterial solution on an LB plate, culture it at 37 °C for 12 h, pick a single colony and streak it on an LB plate containing 0.05 mg / L kanamycin. For the single colonies that cannot grow on the LB plate containing 0.05 mg / L kanamycin, the pCas plasmid has been successfully eliminated, and finally, plasmid-free E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -tolC.

[0117] (6) Prepare chemically competent cells from the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -tolC and transform the fermentation plasmid pE into E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::PyhaO In the tolC-transformed competent cells, they were spread on an ampicillin-resistant plate to obtain the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -tolC / pE(EYC::DKSAC). The constructed E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -tolC / pE(EYC::DKSAC) was subjected to fermentation tests and detections according to the method of Example 4(3). OD 600 and the L-cysteine content in the supernatant of the fermentation broth were as Figure 8 shown.

[0118] In order to further improve the accumulation of L-cysteine in the engineered strain, on the basis of the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE, the expression of tolC was driven by the DECR-CYS dynamic control system to obtain the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -tolC. It can be seen from Figure 8 that after the promoter of the transporter tolC was replaced with P yhaO promoter, the L-cysteine production of the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE / pE(EYC::DKSAC) decreased to 7.21 g / L. Combining with the result that overexpression of the plasmid tolC led to an increase in production, it was analyzed that the decrease in L-cysteine accumulation might be due to the insufficient expression level of tolC driven by the promoter P yhaO promoter. The above results indicate that it is necessary to optimize the expression levels of different target genes to achieve the best production accumulation.

[0119] Example 10: RBS Optimization of the Gene tolC Expression Unit

[0120] (1) Optimize the RBS of the tolC gene in the strain constructed in Example 8 to adjust the expression intensity of the tolC gene.

[0121] (2) Using the E. coli W3110 genome as a template, DNA fragments were obtained by PCR amplification, including the 500 bp sequences upstream and downstream of the tolC gene promoter (primers Up-F and Up-R, primers Down-F(689) and Down-R, primers Down-F(685) and Down-R, and primers Down-F(682) and Down-R), the promoter P yhaO (primers P yhaO -F and P yhaO -R) and RBS apFAB689 (primers RBS689-R and RBS-F), apFAB685 (primers RBS685-R and RBS-F), and apFAB682 (primers RBS682-R and RBS-F). The above four DNA fragments were fused by fusion PCR to obtain DNA fragments Donor-apFAB689-tolC, Donor-apFAB685-tolC, and Donor-apFAB682-tolC.

[0122] (3) Prepare the strain E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE into chemically competent cells, and transform the pCas plasmid (Addgene Plasmid#62225) into the chemically competent cells of E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE by chemical transformation, and spread them on a kanamycin-resistant plate to obtain the strain E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE / pCas.

[0123] (4) The strain E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO-yeaS::P yhaO -The electrocompetent cells were prepared from alaE / pCas. The plasmids pTarget-tolC, the fragments Donor-apFAB689-tolC, Donor-apFAB685-tolC, and Donor-apFAB682-tolC were electrotransformed into W3110 EYC::P respectively yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -After electrotransforming the electrocompetent cells of alaE / pCas, they were spread on the kanamycin and spectinomycin double-resistant plates, and single colonies were picked for PCR verification (primers tolCJYZ-VF and tolCJYZ-VR) to screen the successfully edited strains, obtaining E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC, E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB685-tolC and E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB682-tolC. The primers are shown in Table 10

[0124] Table 10: Primers for Example 10

[0125]

[0126]

[0127] (5) Pick a positive single colony and inoculate it into an LB test tube containing 1 mM IPTG and 0.05 mg / L kanamycin. Incubate overnight at 30 °C, then streak it on an LB plate containing 0.05 mg / L kanamycin and incubate at 30 °C for 24 h. Pick a single colony and streak it on an LB plate containing 0.05 mg / L spectinomycin. For the single colonies that cannot grow on the LB plate containing 0.05 mg / L spectinomycin, the pTarget-tolC plasmid has been successfully eliminated. Pick the single colonies with the successfully eliminated pTarget-tolC plasmid into an LB test tube and incubate overnight at 37 °C. The next day, streak the bacterial solution on an LB plate and incubate at 37 °C for 12 h. Pick a single colony and streak it on an LB plate containing 0.05 mg / L kanamycin. For the single colonies that cannot grow on the LB plate containing 0.05 mg / L kanamycin, the pCas plasmid has been successfully eliminated, and finally, plasmid-free E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC, E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB685-tolC and E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB682-tolC.

[0128] (6) Prepare the above three antibacterial-free strains into chemically competent cells, transform the fermentation plasmid pE into the chemically competent cells of the above strains, and coat them on an ampicillin-resistant plate to obtain the strain E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC / pE(EYC::DKSAC-1), E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO-alaE::P yhaO -apFAB685-tolC / pE(EYC::DKSAC-2) and E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB682-tolC / pE(EYC::DKSAC-3). The above three constructed strains were subjected to fermentation tests and detections according to the method of Example 4(3). OD 600 and the L-cysteine content in the supernatant of the fermentation broth were as Figure 9 shown.

[0129] To further optimize the expression level of the gene tolC, the Promoter-RBS combinants with different expression levels constructed in Example 3 were used to drive the expression of tolC to increase the accumulation of L-cysteine in the engineered strains. Based on the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE, the DECR-CYS dynamic control system was used to drive the expression of tolC, and the strains E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC, E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB685-tolC and E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB682-tolC. It can be seen from Figure 9 that the promoter of the transporter tolC was replaced with P yhaO -apFAB689, P yhaO -apFAB685 or PyhaO After expressing the apFAB682 expression cassette, the strain achieved the accumulation of different L-cysteines. Among them, the strain E. coli W3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC / pE(EYC::DKSAC-1) achieved the accumulation of 7.86 g / L of L-cysteine.

[0130] The apFAB689 sequence is shown in SEQ ID NO.2, the apFAB685 sequence is shown in SEQ ID NO.4, and the apFAB682 sequence is shown in SEQ ID NO.5.

[0131] The above results indicate that through engineering transformation, the DECR-CYS dynamic control system drives the expression of the L-cysteine transport system, which can effectively promote the accumulation of L-cysteine engineering strains. At the same time, the Promoter-RBS cassette obtained by RBS engineering transformation can meet the expression requirements of different target genes and has good engineering application prospects.

Claims

1. A genetically engineered bacterium with high yield of L-cysteine, which is obtained by the following method: (1) Using the strain E.coil W3110 EYC as the chassis strain, replace the promoters of its transporters ydeD, yfiK, yeaS, and alaE with P yhaO promoter to obtain the strain E.coliW3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE; the strain E.coil W3110 EYC is the strain CCTCC NO: M 20191026; (2) Construct P yhaO -apFAB689 expression cassette, and replace the promoter of the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE transporter tolC with P yhaO -apFAB689 to obtain the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC; Prepare the strain obtained in step (2) into chemically competent cells, and transform the fermentation plasmid pE to obtain EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC / pE, which is the genetically engineered bacterium for high-yield L-cysteine.

2. The genetically engineered bacterium with high yield of L-cysteine according to claim 1, characterized in that The promoter P yhaO has the sequence shown in SEQ ID NO.

1.

3. The genetically engineered bacterium with high yield of L-cysteine according to claim 1, characterized in that the sequence of apFAB689 is shown as SEQ ID NO.

2.

4. A method for constructing the genetically engineered bacterium with high yield of L-cysteine according to claim 1, characterized in that the method is as follows: (1) Using the strain E.coil W3110 EYC as the chassis strain, applying the CRISPR-Cas9 gene editing technology, replace the promoters of its transporters ydeD, yfiK, yeaS, and alaE with P yhaO promoter to obtain the strain E.coliW3110EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE; the strain E.coil W3110 EYC is the strain CCTCC NO: M20191026; (2) Construct P yhaO -apFAB689 expression cassette, and apply the CRISPR-Cas9 gene editing technology to replace the promoter of the -alaE transporter tolC in the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO with P yhaO -apFAB689 to obtain the strain E. coli W3110 EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC; (3) Prepare the strain obtained in step (2) into chemically competent cells, and transform the fermentation plasmid pE to obtain EYC::P yhaO -ydeD::P yhaO -yfiK::P yhaO -yeaS::P yhaO -alaE::P yhaO -apFAB689-tolC / pE, which is the genetically engineered bacterium for high-yield L-cysteine.

5. The method according to claim 4, characterized in that, The promoter P yhaO has the sequence shown in SEQ ID NO. 1, and the sequence of apFAB689 is shown in SEQ ID NO.

2.

6. Use of the genetically engineered bacterium according to claim 1 in the microbial fermentation for preparing L-cysteine.

7. The use according to claim 6, characterized in that the use is: inoculating the genetically engineered bacterium into a fermentation medium, and performing fermentation culture at 26-37 °C and 200-800 rpm for 60-72 h, and separating and purifying the supernatant of the fermentation broth after the fermentation ends to obtain L-cysteine.

Images