Method for improving pancreatic β-cell function using gene-edited UC-MSCs

Abstract

The present invention provides a method for promoting or improving the secretion of insulin by pancreatic β cells, in particular a method for improving the function of pancreatic β cells by using gene-edited UC-MSCs, specifically co-culturing pancreatic β cells with UC-MSCs obtained by gene editing to increase the amount of insulin secreted by pancreatic β cells and prolong the survival time of pancreatic β cells, thereby providing a new option for the treatment of diabetes.

Description

Technical Field

[0001] The present invention relates to the intersection of molecular biology and cell biology, and in particular to a method for improving β-cell function by gene editing UC-MSC. Background Art

[0002] Mesenchymal Stem Cells (MSC) are a type of multipotent stem cell that originates from the mesoderm and exists in tissues such as fat, bone marrow, umbilical cord blood and umbilical cord. As medical waste, umbilical cord blood and umbilical cord have great advantages as a source of MSC in terms of ethics, cost and convenience of extraction compared to tissues such as fat. Studies by Shetty et al. have shown that the content of MSC in the umbilical cord is much higher than that in umbilical cord blood, and compared to the 100% success rate of extracting umbilical cord MSC (UC-MSC), the success rate of umbilical cord blood MSC is only 6%. In addition, in terms of differentiation potential, UC-MSC not only has the differentiation ability of MSC from other tissue sources, but also retains some characteristics of primitive stem cells (embryonic stem cells), and has a higher differentiation potential.

[0003] The maturity of CRISPRa technology allows researchers to directly activate and upregulate the expression levels of endogenous genes in cells, which provides a new method to enhance the nutritional supply and immune regulation ability of MSCs. In 2019, Meng et al. used CRISPRa technology to upregulate the expression level of IL10 in bone marrow MSCs for the treatment of myocardial infarction in diabetic mice. The results showed that the therapeutic effect of MSCs with upregulated gene expression was significantly better.

[0004] Therefore, the present invention provides a MSC that uses CRISPRa technology to upregulate the NGF gene, and uses the MSC for nutrient supply and co-culture with pancreatic β cells to increase the expression of insulin. Summary of the invention

[0005] In a first aspect, the present invention provides a method for promoting insulin secretion by pancreatic β cells, wherein the method comprises co-culturing pancreatic β cells with mesenchymal stem cells overexpressing the NGF gene.

[0006] Preferably, the method comprises using sgRNA to target the transcription start site of the NGF gene to initiate transcription to activate NGF gene expression.

[0007] Preferably, the target site sequence of the sgRNA comprises any one or a combination of two or more of SEQ ID NO: 5, 8 or 11.

[0008] The double-stranded DNA sequence encoding the sgRNA is selected from any one of the following groups or a combination of two or more:

[0009] A) SEQ ID NO: 6, 7;

[0010] B) SEQ ID NO: 9, 10;

[0011] C) SEQ ID NO: 12, 13.

[0012] Preferably, the method comprises introducing a vector composition into mesenchymal stem cells to activate NGF gene expression, thereby obtaining mesenchymal stem cells overexpressing the NGF gene.

[0013] Preferably, the carrier composition comprises:

[0014] A) a vector expressing one or more sgRNAs and MS2 binding sites, or one or more vectors expressing sgRNAs and MS2 binding sites; wherein the sgRNAs may be the same or different, and their target sites are selected from SEQ ID NO: 5, 8 or 11.

[0015] B) a vector expressing the fusion protein MS2-P65-HSF1; and,

[0016] C) Vector expressing dCas9 protein.

[0017] Preferably, the vector composition further comprises other vectors required for packaging the virus.

[0018] Preferably, the vector is a bacterial vector, a fungal vector or a viral vector.

[0019] In a specific embodiment of the present invention, the vector is a phage vector, a baculovirus vector, a herpes virus vector, a poxvirus vector, an RNA virus vector, a bovine papilloma virus vector, an Epstein-Barr virus vector, an adenovirus vector, a lentivirus vector or a retrovirus vector, etc., any vector in the prior art that can deliver genetic material into cells.

[0020] In a specific embodiment of the present invention, after the vector composition is introduced into mesenchymal stem cells, the vector expressing sgRNA and MS2 binding site will be transcribed into sgRNA and RNA with a stem-loop structure that can specifically bind to the MS2 protein, and form a complex of "genomic DNA-dCas9-sgRNA-MS2 binding site-MS2-P65-HSF1" structure with the other two vectors (the vector expressing the fusion protein MS2-P65-HSF1 and the vector expressing the dCas9 protein). Then, transcription is initiated and NGF gene expression is activated.

[0021] Preferably, the mesenchymal stem cells are derived from humans or non-human animals.

[0022] Preferably, the mesenchymal stem cells are derived from umbilical cord, bone marrow, umbilical cord blood or fat.

[0023] In a specific embodiment of the present invention, the mesenchymal stem cells are derived from the umbilical cord of human or non-human animals.

[0024] Preferably, the mesenchymal stem cells can be obtained by screening and extracting from the umbilical cord, bone marrow, umbilical cord blood or fat of human or non-human animals, or purchased as finished products.

[0025] Preferably, the non-human animals are non-human mammals, including but not limited to wild animals, zoo animals, economic animals, pets, experimental animals, etc. Preferably, the non-human mammals include but are not limited to pigs, cattle, sheep, horses, donkeys, foxes, raccoon dogs, minks, camels, dogs, cats, rabbits, mice (e.g., rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels) or monkeys, etc.

[0026] Preferably, the method further comprises the step of culturing the mesenchymal stem cells introduced with the vector composition.

[0027] Preferably, the mesenchymal stem cells are cultured in a culture medium containing fetal bovine serum, and more preferably in a DMEM culture medium containing fetal bovine serum, wherein the culture medium preferably contains 1%-20%, more preferably 2%-10%, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) of fetal bovine serum.

[0028] Preferably, the culture medium further comprises a marker (eg, hygromycin) and an antibiotic (eg, puromycin).

[0029] In a specific embodiment of the present invention, the method for obtaining mesenchymal stem cells overexpressing the NGF gene comprises using the above-mentioned vector composition to infect mesenchymal stem cells, infecting for 12-48 hours (preferably 24-32 hours, for example 12, 15, 18, 20, 24, 28, 32, 35, 40, 45, 48), and replacing the culture medium containing markers and / or antibiotics for culture.

[0030] In a specific embodiment of the present invention, the method for obtaining mesenchymal stem cells with overexpression of the NGF gene comprises inoculating the mesenchymal stem cells into DMEM culture medium (with 10% fetal bovine serum), and when the cell density grows to 50%-90% (preferably 60%-80%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%), transfecting the above-mentioned vector composition into the cells for 12-48h (preferably 24-32h, for example 12, 15, 18, 20, 24, 28, 32, 35, 40, 45, 48), replacing the DMEM culture medium containing antibiotics (10% fetal bovine serum, 400μg / mL hygromycin and 5μg / mL puromycin) and culturing for 2-5 days (preferably 3 days).

[0031] Preferably, pancreatic β cells and mesenchymal stem cells overexpressing the NGF gene are co-cultured at a ratio of 1:(3-7), for example, the ratio may be 1:(3, 4, 5, 6 or 7).

[0032] In a specific embodiment of the present invention, pancreatic β cells and mesenchymal stem cells overexpressing NGF gene are co-cultured at a ratio of 1:5.

[0033] Wherein, the co-culture can be cultured in DMEM medium, which can be high sugar (glucose above 5.5mM, preferably 10-40mM, more preferably 20-30mM, such as 10, 15, 20, 25, 30, 35, 40mM glucose), low sugar (glucose below 5.5mM, preferably 1-5.5, such as 1, 2, 3, 4, 5, 5.5mM glucose), etc. Further preferably, the culture medium is DMEM medium containing fetal bovine serum, wherein preferably contains fetal bovine serum 1%-20%, further preferably 2%-10%, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) of fetal bovine serum.

[0034] In a specific embodiment of the present invention, the co-culture is cultured in a DMEM medium containing 2% fetal bovine serum under high glucose conditions.

[0035] In a second aspect of the present invention, a sgRNA for constructing mesenchymal stem cells overexpressing the NGF gene is provided, wherein the target site sequence of the sgRNA comprises any one or a combination of two or more of SEQ ID NO: 5, 8 or 11.

[0036] The double-stranded DNA sequence encoding the sgRNA is selected from any one of the following groups or a combination of two or more:

[0037] A) SEQ ID NO: 6, 7;

[0038] B) SEQ ID NO: 9, 10;

[0039] C) SEQ ID NO: 12, 13.

[0040] The third aspect of the present invention provides a vector or vector combination comprising the above-mentioned sgRNA.

[0041] A fourth aspect of the present invention provides a carrier composition, wherein the carrier composition comprises:

[0042] A) A vector expressing one or more sgRNAs and MS2 binding sites, or one or more vectors expressing sgRNAs and MS2 binding sites; wherein the sgRNAs may be the same or different, and their target sites are selected from SEQ ID NO: 5, 8 or 11. Preferably, it is the vector or vector combination described in the third aspect.

[0043] B) a vector expressing the fusion protein MS2-P65-HSF1; and,

[0044] C) Vector expressing dCas9 protein.

[0045] Preferably, the vector composition further comprises other vectors required for packaging the virus.

[0046] Preferably, the vector is a bacterial vector, a fungal vector or a viral vector.

[0047] In a specific embodiment of the present invention, the vector is a phage vector, a baculovirus vector, a herpes virus vector, a poxvirus vector, an RNA virus vector, a bovine papilloma virus vector, an Epstein-Barr virus vector, an adenovirus vector, a lentivirus vector or a retrovirus vector, etc., any vector in the prior art that can deliver genetic material into cells.

[0048] In a specific embodiment of the present invention, after the vector composition is introduced into mesenchymal stem cells, the vector expressing sgRNA and MS2 binding site will be transcribed into sgRNA and RNA with a stem-loop structure that can specifically bind to the MS2 protein, and form a complex of "genomic DNA-dCas9-sgRNA-MS2 binding site-MS2-P65-HSF1" structure with the other two vectors (the vector expressing the fusion protein MS2-P65-HSF1 and the vector expressing the dCas9 protein). Then, transcription is initiated and NGF gene expression is activated.

[0049] A fifth aspect of the present invention provides a cell comprising the above-mentioned sgRNA, vector or vector combination, or the above-mentioned vector composition.

[0050] Preferably, the cell is a microbial cell (eg, bacteria, fungi, virus), or may be a plant cell, an animal cell or a human cell.

[0051] In a specific embodiment of the present invention, the cells include but are not limited to Escherichia coli, mesenchymal stem cells, and HEK293.

[0052] In a sixth aspect, the present invention provides an application of the above-mentioned sgRNA, vector or vector combination, or the above-mentioned vector composition or the above-mentioned cell, wherein the application comprises:

[0053] A) Application in preparing mesenchymal stem cells overexpressing NGF gene;

[0054] B) Application in promoting insulin secretion by pancreatic β cells;

[0055] C) Application in inhibiting pancreatic β-cell apoptosis;

[0056] D) Application in prolonging the survival time of pancreatic β cells or improving the survival rate of pancreatic β cells;

[0057] E) Application in the treatment of diabetes;

[0058] F) use in the preparation of a drug for treating diabetes; or,

[0059] G) Application in lowering blood sugar.

[0060] The seventh aspect of the present invention provides a method for preparing mesenchymal stem cells overexpressing NGF gene.

[0061] Preferably, the preparation method comprises using sgRNA to target the transcription start site of the NGF gene and initiate transcription to activate NGF gene expression.

[0062] Preferably, the target site sequence of the sgRNA comprises any one or a combination of two or more of SEQ ID NO: 5, 8 or 11.

[0063] The double-stranded DNA sequence encoding the sgRNA is selected from any one of the following groups or a combination of two or more:

[0064] A) SEQ ID NO: 6, 7;

[0065] B) SEQ ID NO: 9, 10;

[0066] C) SEQ ID NO: 12, 13.

[0067] Preferably, the method comprises introducing a vector composition into mesenchymal stem cells to activate NGF gene expression, thereby obtaining mesenchymal stem cells overexpressing the NGF gene.

[0068] Preferably, the carrier composition comprises:

[0069] A) a vector expressing one or more sgRNAs and MS2 binding sites, or one or more vectors expressing sgRNAs and MS2 binding sites; wherein the sgRNAs may be the same or different, and their target sites are selected from SEQ ID NO: 5, 8 or 11.

[0070] B) a vector expressing the fusion protein MS2-P65-HSF1; and,

[0071] C) Vector expressing dCas9 protein.

[0072] Preferably, the vector composition further comprises other vectors required for packaging the virus.

[0073] Preferably, the vector is a bacterial vector, a fungal vector or a viral vector.

[0074] In a specific embodiment of the present invention, the vector is a phage vector, a baculovirus vector, a herpes virus vector, a poxvirus vector, an RNA virus vector, a bovine papilloma virus vector, an Epstein-Barr virus vector, an adenovirus vector, a lentivirus vector or a retrovirus vector, etc., any vector in the prior art that can deliver genetic material into cells.

[0075] In a specific embodiment of the present invention, after the vector composition is introduced into mesenchymal stem cells, the vector expressing sgRNA and MS2 binding site will be transcribed into sgRNA and RNA with a stem-loop structure that can specifically bind to the MS2 protein, and form a complex of "genomic DNA-dCas9-sgRNA-MS2 binding site-MS2-P65-HSF1" structure with the other two vectors (the vector expressing the fusion protein MS2-P65-HSF1 and the vector expressing the dCas9 protein). Then, transcription is initiated and NGF gene expression is activated.

[0076] Preferably, the mesenchymal stem cells are derived from humans or non-human animals.

[0077] Preferably, the mesenchymal stem cells are derived from umbilical cord, bone marrow, umbilical cord blood or fat.

[0078] In a specific embodiment of the present invention, the mesenchymal stem cells are derived from the umbilical cord of human or non-human animals.

[0079] Preferably, the mesenchymal stem cells can be obtained by screening and extracting from the umbilical cord, bone marrow, umbilical cord blood or fat of human or non-human animals, or purchased as finished products.

[0080] Preferably, the non-human animals are non-human mammals, including but not limited to wild animals, zoo animals, economic animals, pets, experimental animals, etc. Preferably, the non-human mammals include but are not limited to pigs, cattle, sheep, horses, donkeys, foxes, raccoon dogs, minks, camels, dogs, cats, rabbits, mice (e.g., rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels) or monkeys, etc.

[0081] Preferably, the method further comprises the step of culturing the mesenchymal stem cells introduced with the vector composition.

[0082] Preferably, the mesenchymal stem cells are cultured in a culture medium containing fetal bovine serum, and more preferably in a DMEM culture medium containing fetal bovine serum, wherein the culture medium preferably contains 1%-20%, more preferably 2%-10%, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20) of fetal bovine serum.

[0083] Preferably, the culture medium further comprises a marker (eg, hygromycin) and an antibiotic (eg, puromycin).

[0084] In a specific embodiment of the present invention, the method for obtaining mesenchymal stem cells overexpressing the NGF gene comprises using the above-mentioned vector composition to infect mesenchymal stem cells, infecting for 12-48 hours (preferably 24-32 hours, for example 12, 15, 18, 20, 24, 28, 32, 35, 40, 45, 48), and replacing the culture medium containing markers and / or antibiotics for culture.

[0085] In a specific embodiment of the present invention, the preparation method comprises inoculating mesenchymal stem cells into DMEM medium (supplemented with 10% fetal bovine serum), and when the cell density grows to 50%-90% (preferably 60%-80%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%), transfecting the above-mentioned vector composition into the cells for 12-48h (preferably 24-32h, for example 12, 15, 18, 20, 24, 28, 32, 35, 40, 45, 48), replacing the DMEM medium containing antibiotics (10% fetal bovine serum, 400 μg / mL hygromycin and 5 μg / mL puromycin) and culturing for 2-5 days (preferably 3 days).

[0086] The eighth aspect of the present invention provides mesenchymal stem cells obtained by the above-mentioned preparation method.

[0087] The ninth aspect of the present invention provides a drug, which includes the above-mentioned sgRNA, the above-mentioned vector or vector combination, the above-mentioned vector composition, the above-mentioned cells or mesenchymal stem cells obtained by the above-mentioned preparation method, or a mixed system of co-culture of the above-mentioned pancreatic β cells and mesenchymal stem cells overexpressing the NGF gene, and pharmaceutically acceptable excipients.

[0088] The tenth aspect of the present invention provides a method for inhibiting apoptosis of pancreatic β cells, wherein the method comprises co-culturing pancreatic β cells with mesenchymal stem cells overexpressing the NGF gene.

[0089] In an eleventh aspect of the present invention, a method for prolonging the survival time of pancreatic β cells or improving the survival rate of pancreatic β cells is provided, wherein the method comprises co-culturing pancreatic β cells with mesenchymal stem cells overexpressing the NGF gene.

[0090] The twelfth aspect of the present invention provides a method for treating diabetes, which comprises applying the above-mentioned vector composition, sgRNA, cells, the above-mentioned drug or a mixed system of co-culturing the above-mentioned pancreatic β cells and mesenchymal stem cells overexpressing the NGF gene to an individual.

[0091] The thirteenth aspect of the present invention provides a method for lowering blood sugar, which comprises applying the above-mentioned vector composition, sgRNA, cells, the above-mentioned drug or the above-mentioned mixed system of co-culture of pancreatic β cells and mesenchymal stem cells overexpressing the NGF gene to an individual.

[0092] The present invention activates and upregulates the expression level of NGF gene through gene editing technology, enhances the nutritional effect and microenvironment regulation ability of UC-MSC, and achieves the purpose of improving the function of pancreatic β cells by co-culturing with pancreatic β cells.

[0093] The "NGF gene" mentioned in the present invention stands for Nerve growth factor, which refers to nerve growth factor.

[0094] "MS2 gene" stands for Multiple sclerosis,susceptibility to,2, multiple sclerosis susceptibility 2 gene.

[0095] "P65 gene" stands for RELA proto-oncogene, NF-kB subunit, RELA proto-oncogene, NF-kB subunit gene.

[0096] "HSF1 gene" stands for heat shock transcription factor 1, heat shock transcription factor 1 gene.

[0097] The "overexpression" described in the present invention means that the expression level of the corresponding gene is increased after the implementation method of the present application compared with the original cells. For example, in a specific embodiment of the present invention, "mesenchymal stem cells with overexpression of NGF gene" means that the expression level of NGF gene is increased compared with the mesenchymal stem cells after gene editing before gene editing. Of course, the "overexpression" described in the present application mainly refers to the content or degree of expression, and it is not necessarily limited to the operation performed by gene editing or any editing principle or means.

[0098] The "HEK293" mentioned in the present invention stands for human embryonic kidney 293 cells.

[0099] The "dCas9" described in the present invention is a protein formed by mutating the Cas9 cleavage site. It only has the ability to bind to the genome and sgRNA, but does not have the ability to cut DNA.

[0100] The “plurality” mentioned in the present invention means more than 2, including but not limited to 2-50, preferably 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.

[0101] The "activation" mentioned in the present invention may be to activate a gene that was not expressed originally to become expressed, or to activate a gene that was originally expressed at a low level to become expressed at a high level.

[0102] As used herein, "treating" means slowing, interrupting, preventing, controlling, stopping, alleviating, or reversing the progression or severity of a sign, symptom, disorder, condition, or disease after the disease has begun to develop, but does not necessarily involve the complete elimination of all disease-related signs, symptoms, conditions, or disorders.

[0103] The "pharmaceutically acceptable excipients" described in the present invention include, but are not limited to, one or more of carriers, excipients, diluents, wetting agents, fillers, binders, lubricants, disintegrants, antioxidants, buffers, suspending agents, solubilizers, thickeners, stabilizers, flavoring agents and preservatives.

[0104] The "drug" described in the present invention can be administered by any suitable route, such as gastrointestinal administration (e.g., oral) or parenteral administration (e.g., intravenous, intramuscular, subcutaneous, intradermal, intraorgan, intranasal, intraocular, instillation, intracerebral, intrathecal, transdermal, intrarectal, etc.).

[0105] The "drug" described in the present invention can be in any suitable dosage form, such as a dosage form for gastrointestinal administration or a dosage form for parenteral administration, preferably including but not limited to tablets, pills, powders, granules, capsules, lozenges, syrups, liquids, emulsions, microemulsions, suspensions, injections, sprays, aerosols, powder sprays, lotions, ointments, plasters, pastes, patches, eye drops, nasal drops, sublingual tablets, suppositories, aerosols, effervescent tablets, pills, gels, etc.

[0106] The various dosage forms of the drug of the present invention can be prepared according to conventional production methods in the pharmaceutical field.

[0107] The "individual" described in the present invention can be a human or a non-human mammal, and the non-human mammal can be a wild animal, a zoo animal, an economic animal, a pet, an experimental animal, etc. Preferably, the non-human mammal includes but is not limited to pigs, cattle, sheep, horses, donkeys, foxes, raccoon dogs, minks, camels, dogs, cats, rabbits, mice (such as rats, mice, guinea pigs, hamsters, gerbils, chinchillas, squirrels) or monkeys, etc.

[0108] The "and / or" described in the present invention includes all combinations of items connected by the term, and each combination should be deemed to have been listed separately herein. For example, "A and / or B" includes "A", "A and B" and "B". For another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C" and "A and B and C".

[0109] The terms “comprising” or “including” described in the present invention are open-ended terms. When used to describe a protein or nucleic acid sequence, the protein or nucleic acid may be composed of the sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, but still have the same or similar activity as the original sequence. BRIEF DESCRIPTION OF THE DRAWINGS

[0110] The embodiments of the present invention are described in detail below with reference to the accompanying drawings, wherein:

[0111] Figure 1 : The structure diagram of the modified lentiviral vector. The lentiviral vectors are Lenti-dCas9-VP64-T2A-BlastR, Lenti-MS2-P65-HSF1-T2A-HygroR, and Lenti-sgRNA2.0-PuroR.

[0112] Figure 2 : BsmBI restriction site and sticky ends formed after Lenti-sgRNA2.0-PuroR was digested with BsmBI.

[0113] Figure 3:The relative expression of NGF gene after three sgRNAs of NGF gene were transfected into HEK293 cells alone and together. A. RT-PCR analysis of the activation efficiency of different sgRNAs. B. qPCR analysis of the activation efficiency of different sgRNAs on NGF gene.

[0114] Figure 4 : Relative expression of NGF gene in UC-MSCs without and after infection with Lenti-dCas9-SAM / sgRNA.

[0115] Figure 5A : Effects of UC-MSC and infected UC-MSC co-cultured with pancreatic β cells for 24h on insulin gene expression.

[0116] Figure 5B : Effects of UC-MSC and infected UC-MSC co-cultured with pancreatic β cells for 24h on insulin secretion.

[0117] Figure 6 : Effects of co-culture of UC-MSCs and infected UC-MSCs with pancreatic β cells for 24 h on the expression of apoptosis-related genes in pancreatic β cells. DETAILED DESCRIPTION

[0118] The method and application of the present invention are described below in conjunction with the accompanying drawings. The examples given are only used to explain the present invention and are not used to limit the scope of the present invention.

[0119] The lentiviral vectors Lenti-dCas9-VP64_Blast (#61425), Lenti-MS2-P65-HSF1_Hygro (#61426) and Lenti-sgRNA2.0 (#61427) used in the examples are all from ADDGENE.

[0120] The PGK-PuroR used in the examples was purchased from SBI (System Biosciences), product catalog number: CD810A-1.

[0121] Example 1: Lenti-dCas9-SAM / sgRNA2.0 vector construction

[0122] 1. The Lenti-dCas9-VP64_Blast and Lenti-MS2-P65-HSF1_Hygro vectors replace the EF1a promoter with a strong CMV promoter.

[0123] Design CMV promoter primers with NheI and BsiWI endonuclease sites. The primer sequences are:

[0124] NheI-CMV-F: 5'GCTAGCCCCGTTACATAACTTACGG3' (SEQ ID NO: 1);

[0125] CMV-BsiWI-R: 5'CGTACGGATCTGACGGTTCACTAAA3' (SEQ ID NO: 2);

[0126] The NheI-CMV-BsiWI DNA fragment was amplified from the company's existing plasmid carrying the CMV promoter, and the DNA fragment was cloned into the pEasy vector to construct the pEasy-CMV vector. The positive single clones were screened by sequencing, and the plasmid was extracted for use. The Lenti-dCas9-VP64_Blast, Lenti-MS2-P65-HSF1_Hygro and pEasy-CMV vectors were double-digested with NheI-BsiWI. The enzyme digestion system is shown in Table 1.

[0127] Table 1: Enzyme digestion system

[0128]

[0129]

[0130] Incubate at 37°C overnight, separate the digestion products by 1% agarose gel electrophoresis, and recover and purify DNA fragments of 12820bp (Lenti-dCas9-VP64_Blast), 10471bp (Lenti-MS2-P65-HSF1_Hygro), and 521bp (CMV). Use T4 ligase to ligate the 12820bp and 10471bp fragments with the 521bp fragment. Transform the reaction products into competent stbl3 Escherichia coli, spread them on LB solid plates containing Amp, culture at 37°C overnight, and screen the positive clones, which are the modified lentiviral vectors Lenti-dCas9-VP64-T2A-BlastR and Lenti-MS2-P65-HSF1-T2A-HygroR. Figure 1 .

[0131] 2. Lenti-sgRNA2.0 vector was transformed to transform EF1a-BleoR into PGK-PuroR.

[0132] Design PGK-PuroR primers with BamHI and EcoRI endonuclease sites, the sequence is:

[0133] BamHI-PGK-F: 5'-GGATCCGGGTAGGGGAGGCGCTTTTC-3' (SEQ ID NO: 3), and PuroR-EcoRI-R: 5'-GAATTCTCAGGCACCGGGCTTGCGGG-3' (SEQ ID NO: 4), using the plasmid with PGK-PuroR as a template, DNA high-fidelity polymerase amplified the BamHI-PGK-PuroR-EcoRI fragment, ligated to the blunt-end vector to construct the pEasy-PGK-PuroR vector, screened the correct clones, and extracted the plasmid for use. Lenti-sgRNA2.0 and pEasy-PGK-PuroR were double-digested with BamHI-EcoRI, and the enzyme digestion system is shown in Table 2.

[0134] Table 2: Enzyme digestion system

[0135] Plasmids 1 μg B H 1μl EcoRI 1μl 10×CutSmart Buffer 5μl <![CDATA[ddH 2 The]]> Make up to 50 μl

[0136] Incubate at 37°C overnight, separate the digestion products by 1% agarose gel electrophoresis, purify and recover DNA fragments of 8351 bp (Lenti-sgRNA2.0) and 1146 bp (PGK-PuroR), connect with T4 ligase, transform the ligation products into stbl3 competent E. coli, screen the positive clones, and the transformed lentiviral plasmid Lenti-sgRNA2.0-PuroR is shown in the attached figure. Figure 1 .

[0137] 3. sgRNA design and vector construction

[0138] The sgRNA of the NGF gene was designed using the CHOPCHOP (version 3) online sgRNA design tool, and the sgRNA sequences are shown in Table 3.

[0139] Table 3: sgRNA sequences and positions

[0140]

[0141] According to the sticky ends obtained after the endonuclease BsmBI single enzyme digestion of Lenti-sgRNA2.0-PuroR (attached Figure 2 ), design the sticky ends of the sgRNA insertion vector (attached Figure 2 ) and sent to a commercial company for synthesis.

[0142] The single-stranded oligodeoxyribonucleic acid synthesized by a commercial company was synthesized into a double-stranded one. Specifically, the synthesized lyophilized powder was dissolved into 10 μM, 5 μl of each complementary chain was added to a 0.2 ml PCR tube and then placed in a PCR instrument. The reaction program was 37°C, 10 min; 95°C, 5 min; and the temperature dropped by 1.5°C per minute until it reached room temperature.

[0143] Double-stranded sgRNA phosphorylation. T4 polynucleotide kinase was used to phosphorylate the synthesized double-stranded sgRNA. The reaction system is shown in Table 4.

[0144] Table 4: Reaction system

[0145] Double-stranded sgRNA 1μl 10× T4 PNK buffer 1μl T4 PNK 0.25μl <![CDATA[ddH 2 The]]> Final volume 10 μl

[0146] 37℃, 1h, store at -20℃.

[0147] sgRNA vector construction. Lenti-sgRNA2.0-PuroR was digested with endonuclease BsmBI. The restriction enzyme system is shown in Table 5.

[0148] Table 5: Enzyme digestion system

[0149] Lenti-sgRNA2.0-PuroR 1 μg 10×CutSmart Buffer 5μl BbI 0.5μl <![CDATA[ddH 2 The]]> Make up to 50 μl Final volume 50μl

[0150] 37°C, 20 min. 1% agarose gel separation of enzyme digestion products, purification and recovery of large fragments. T4 ligase ligated double-stranded sgRNA and Lenti-sgRNA2.0-PuroR, ligated products transformed into stbl3 E. coli competent cells, sequencing screening of positive clones.

[0151] Example 2: Identification of the efficiency of dCas9-SAM / sgRNA in activating NGF gene expression

[0152] HEK293 cells were seeded into 6-well cell culture plates in DMEM supplemented with 10% fetal bovine serum and 4 mM L-glutamine at 37°C with 5% CO. 2 The cells were cultured in an incubator until the cell density reached 70%. The transfection reagent Lipofectamine 3000 was used to co-transfect Lenti-dCas9-VP64-T2A-BlastR, Lenti-MS2-P65-HSF1-T2A-HygroR and Lenti-sgRNA2.0-PuroR prepared in Example 1. The transfection system is shown in Table 6.

[0153] Table 6: Transfection system

[0154]

[0155]

[0156] Place at room temperature for 15 min, 37°C, 5% CO 2The cells were cultured in an incubator for 24 h, and fresh culture medium was replaced. After 48 h of culture, the cells were collected. Total RNA was extracted using the Invitrogen TRIzol RNA extraction kit. The extraction process is described in the product instructions. The quality of the extracted RNA samples was identified by 1% agarose gel electrophoresis.

[0157] TakaRa PrimeScript RT reagent Kit was used to synthesize cDNA (see product description for details).

[0158] cDNA samples were analyzed by qPCR and RT-PCR using ABI-7500. Untransfected HEK293 cells were used as negative controls, labeled with CN, and β-actin was used as an internal reference. The primer sequences are shown in Table 7.

[0159] Table 7: Primer sequences

[0160]

[0161]

[0162] The relative gene expression was measured using 2 -ΔΔC The legal analysis is as follows:

[0163] The β-actin gene was used as an internal reference. In the cell samples of CN and NGF_sgRNA1, the Ct values ​​were expressed as Ct(β-actin_CN) and Ct(β-actin_NGF_sgRNA1), respectively. The Ct values ​​of the two samples to be tested were Ct(CN) and Ct(NGF_sgRNA1), respectively.

[0164] ΔCt(CN)=Ct(CN)-Ct(β-actin_CN);

[0165] ΔCt(NGF_sgRNA1)=Ct(NGF_sgRNA1)-Ct(β-actin_NGF_sgRNA1);

[0166] ΔΔCt=ΔCt(NGF_sgRNA1)-ΔCt(CN);

[0167] The relative expression of NGF in cells transfected with NGF_sgRNA1 is 2 times that of CN samples. -ΔΔCt .

[0168] The results showed that the efficiency of the three sgRNAs synergistically activating the NGF gene was significantly higher than that of the three sgRNAs alone (Appendix Figure 3 ).

[0169] Example 3: Lentivirus packaging and expression analysis

[0170] Lentivirus packaging uses a four-plasmid system, PEI is used as a transfection reagent, and HEK293 cells are co-transfected. The medium is changed after 12 hours, and the supernatant is collected after 72 hours. The virus is purified and concentrated by purification column. The virus titer is determined by qPCR. Among them, sgRNA is a synergistic effect of 3 sgRNAs.

[0171] 1. dCas9-SAM / sgRNA activates NGF gene in UC-MSC

[0172] P3 generation UC-MSCs were inoculated into DMEM medium containing 10% fetal bovine serum. When the cell density reached 80%, the lentivirus Lenti-dCas9-VP64-T2A-BlastR, Lenti-MS2-P65-HSF1-T2A-HygroR and Lenti-sgRNA2.0-PuroR prepared in Example 1 co-infected the cells. After 24 hours of infection, the DMEM medium containing antibiotics (10% fetal bovine serum, 400 μg / ml hygromycin and 5 μg / ml puromycin) was replaced and cultured for three days. UC-MSCs not infected with lentivirus were used as parallel controls.

[0173] 2. Analysis of NGF gene expression in UC-MSCs

[0174] UC-MSCs were collected on the 4th day of infection, and total RNA was extracted using the Invitrogen TRIzol RNA extraction kit. The quality of the extracted RNA samples was identified by 1% agarose gel electrophoresis.

[0175] TakaRa PrimeScript RT reagent Kit was used to synthesize cDNA (see product description for details).

[0176] cDNA samples were analyzed by qPCR using ABI-7500. Uninfected UC-MSCs were used as parallel controls, β-actin was used as an internal reference, and the primer sequences are shown in Table 7.

[0177] The relative gene expression was measured using 2 -ΔΔC Legal analysis.

[0178] The results showed that the expression of NGF gene in UC-MSC infected with Lenti-dCas9-SAM / sgRAN was 15.55 times that of uninfected UC-MSC (see Figure 4 ).

[0179] Example 4: Improvement of pancreatic β-cell function by gene-edited UC-MSC

[0180] 4 days after lentiviral infection, infected UC-MSC and pancreatic β cells were co-cultured in DMEM high glucose medium (25mM glucose, 2% fetal bovine serum) using a transwell cell co-culture system, with infected UC-MSC in the upper chamber and pancreatic β cells in the lower chamber. Uninfected UC-MSC co-cultured with pancreatic β cells served as a parallel control. The results are as follows:

[0181] 1. Effects on insulin gene expression and secretion

[0182] After 24 h of co-culture, pancreatic β cells and culture supernatant were collected. Total RNA was extracted from pancreatic β cells using the Invitrogen TRIzol RNA extraction kit, and the quality of the extracted RNA samples was identified by 1% agarose gel electrophoresis. cDNA was synthesized by the TakaRa PrimeScriptRT reagent Kit reverse transcription kit, and cDNA was analyzed by qPCR, with β-actin as an internal reference. The relative expression of genes was measured using 2 -ΔΔC Legal analysis.

[0183] The supernatant was collected and the insulin secretion was measured using Abcam insulin ELISA kit.

[0184] The results showed that the relative expression of insulin gene in pancreatic β cells co-cultured with infected UC-MSCs was 9.36±1.17, and the insulin secretion was 12.208±0.914 μg / l, which were significantly higher than those in pancreatic β cells co-cultured with uninfected UC-MSCs (Figure 5).

[0185] 2. Effects on β-cell apoptosis

[0186] In order to analyze the effect of up-regulation of gene NGF in UC-MSC cells on pancreatic cell apoptosis, the present invention detected the changes in the expression levels of apoptosis-related genes bcl2, bax, bad, Caspase-9 and survivin in pancreatic β cells after co-culture with infected UC-MSC for 24 hours. After 24 hours of co-culture, pancreatic β cells were collected. Total RNA was extracted from pancreatic β cells using the Invitrogen TRIzol RNA extraction kit, and the quality of the extracted RNA samples was identified by 1% agarose gel electrophoresis. TakaRa PrimeScript RTreagent Kit was used to synthesize cDNA, and cDNA was analyzed by qPCR, with β-actin as an internal reference. The relative expression of genes was measured using 2 -ΔΔC Legal analysis.

[0187] The results showed that the expression levels of pro-apoptotic genes (bax, bad and Caspase-9) and anti-apoptotic genes (bcl2 and survivin) in pancreatic β cells co-cultured with infected UC-MSCs were increased, but the expression of anti-apoptotic genes was significantly higher than that of pro-apoptotic genes (appendix Figure 6 ). This indicates that under high glucose conditions, upregulated expression of NGF gene in UC-MSCs can inhibit apoptosis of human β cells.

[0188] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0189] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

Claims

1. A method for promoting insulin secretion by pancreatic β cells, characterized in that: The method comprises islet β cells and NGF Co-culture of gene-overexpressing mesenchymal stem cells; The method comprises using sgRNA targeting NGF The transcription start site of the gene initiates transcription to activate NGF Gene expression; The target site sequence of the sgRNA comprises SEQ ID NOs: 5, 8 and 11; The method comprises introducing a vector composition into mesenchymal stem cells to activate NGF Gene expression, obtained NGF Gene overexpression in mesenchymal stem cells; The carrier composition comprises: A) Vector expressing sgRNA and MS2 binding site; B) A vector expressing the fusion protein MS2-P65-HSF1; and, C) Vector expressing dCas9 protein.

2. The method according to claim 1, characterized in that The vector is a viral vector.

3. The method according to any one of claims 1-2, characterized in that: The mesenchymal stem cells are derived from the umbilical cord, bone marrow, umbilical cord blood or fat of humans or non-human animals.

4. The method according to any one of claims 1-2, characterized in that: Pancreatic β cells and NGF Gene-overexpressing mesenchymal stem cells were co-cultured at a ratio of 1:(3-7).

5. A construction NGF The sgRNA for gene overexpression in mesenchymal stem cells is characterized by: The target site sequence of the sgRNA comprises SEQ ID NOs: 5, 8 and 11.

6. A vector composition comprising the sgRNA according to claim 5.

7. The carrier composition according to claim 6, comprising: A) Vector expressing sgRNA and MS2 binding site; B) Vector expressing the fusion protein MS2-P65-HSF1; as well as, C) Vector expressing dCas9 protein.

8. The carrier composition according to claim 7, characterized in that The vector is a viral vector.

9. A NGF A method for preparing gene-overexpressed mesenchymal stem cells, characterized in that: Comprising the targeting of the sgRNA according to claim 5 NGF The transcription start site of the gene initiates transcription to activate NGF Gene expression.

10. The method according to claim 9, characterized in that The method comprises introducing the vector composition of claim 6 into mesenchymal stem cells to activate NGF Gene expression, obtained NGF Gene overexpression in mesenchymal stem cells.

11. A method for inhibiting pancreatic β cell apoptosis, prolonging pancreatic β cell survival time or improving pancreatic β cell survival rate, characterized in that: The method comprises islet β cells and NGF Co-culture of gene-overexpressing mesenchymal stem cells; The method comprises using sgRNA targeting NGF The transcription start site of the gene initiates transcription to activate NGF Gene expression; The target site sequence of the sgRNA comprises SEQ ID NOs: 5, 8 and 11; The method comprises introducing a vector composition into mesenchymal stem cells to activate NGF Gene expression, obtained NGF Gene overexpression in mesenchymal stem cells; The carrier composition comprises: A) Vector expressing sgRNA and MS2 binding site; B) A vector expressing the fusion protein MS2-P65-HSF1; and, C) Vector expressing dCas9 protein.

Images