A grouper GU6-1 promoter mediating gene knockdown and its application

Abstract

The present invention discloses a grouper GU6-1 promoter that mediates gene knockdown, and the nucleotide sequence of the grouper GU6-1 promoter is shown in SEQ ID NO: 1. Also disclosed is the use of the grouper GU6-1 promoter in mediating gene knockdown. The present invention provides a grouper U6 promoter that can efficiently mediate gene knockdown and its use in RNAi. The GU6-1 promoter can efficiently, stably, continuously and safely express shRNA to induce gene silencing, providing a reliable new tool and technical platform for problems such as gene function research, variety improvement and disease control in fish and even other animals.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and specifically relates to a grouper GU6-1 promoter mediating gene knockdown and an application thereof, and in particular to a grouper U6 promoter capable of efficiently achieving gene knockdown and an application thereof in gene knockdown. Background Art

[0002] RNA interference (RNAi) involves the enzymatic cleavage of exogenous dsRNA within the body, forming short-splitting RNA (siRNA) that specifically binds to the target gene's mRNA. Once bound to the mRNA, the organism degrades the siRNA, treating it as a foreign substance. This process, a form of post-transcriptional gene silencing (PTGS), is a form of post-transcriptional gene silencing (PTGS). The molecular mechanisms of RNAi were first discovered in ancient organisms and are highly conserved throughout evolution. They are primarily divided into three phases: the initiation phase, the effector phase, and the amplification phase. Due to its ability to specifically silence target genes, and the advantages of siRNA, such as ease of synthesis, simplicity of manipulation, and high efficiency, RNAi has become one of the best tools for studying gene function. Currently, RNAi is primarily used in research on gene function, pathway mechanisms, disease control, and gene therapy.

[0003] There are two main methods for preparing siRNA: chemical synthesis of dsRNA and in vitro transcription of siRNAs, which are then injected or transfected into the body to exert their silencing effect. Although this method is highly efficient at silencing target genes, the practical application of RNAi requires large quantities of siRNAs. Chemical synthesis and in vitro transcription are difficult to meet due to cost constraints. The other method is to construct an siRNA expression vector, linking a promoter and a specially structured short hairpin RNA (shRNA) to the same expression vector. The promoter's transcriptional function is then used to continuously transcribe the shRNA; the shRNA undergoes a series of processing steps within the body's cells to form siRNA, achieving the purpose of RNA interference. As a method for expressing siRNA in vivo, siRNA expression vectors enable continuous transcription of siRNA, offering advantages such as high silencing efficiency and long-lasting action, overcoming the shortcomings of chemical synthesis and in vitro transcription. However, the transcription efficiency of siRNA expression vectors is highly dependent on the transcriptional capacity of the promoter. Currently, the promoters of siRNA expression vectors are mainly RNA polymerase III (RNA PolIII) promoters such as U6 and H1, among which U6 promoter is the most widely used.

[0004] The U6 promoter was first discovered as the U6 snRNA element encoding the spliceosome. Its transcription process is very strict, with a clear start transcription site and a conserved termination sequence. That is, the promoter always starts transcribing RNA at a certain position downstream and stops transcription when 4-5 consecutive U bases are present in the transcribed sequence. It is precisely because of the strict transcription of the U6 promoter and its high efficiency in gene silencing that it occupies a dominant position in the siRNA expression vector link of RNAi technology.

[0005] Like other type III promoters, the U6 promoter's main components are the distal sequence element (DSE), the proximal sequence element (PSE), and the TATA box. The PSE and TATA box together form the core transcriptional region, determining the promoter's transcriptional efficiency and being the most important component of the entire promoter. Because the DSE and PSE are generally located upstream of the TATA box, the start site of transcription must be located downstream of the TATA box for transcription to occur. The TATA box is a short sequence of alternating thymine and adenine bases. The PSE is generally close to the TATA box, and both are moderately conserved. The DSE, located at the very upstream of the promoter, primarily includes the SPH (SphI Post-octamer Homology domain) element and the OCT (Octamer motif) element. The SPH primarily binds to STAR during transcription, while the OCT is a highly conserved sequence that binds to OCT-1. Both elements enhance and increase promoter transcriptional activity. All U6 promoters contain the core PSE and TATA Box elements, but the number and types of enhancers they contain vary. For example, the human, mouse, and bovine U6 promoters all contain SPH and OCT elements, while the zebrafish U6 promoter contains only SPH and lacks the OCT element. In addition to SPH and OCT elements, U6 promoters may also contain some specialized enhancer elements. For example, the zebrafish has the CCAAT Box element, which can also play a similar enhancer function during transcription.

[0006] The U6 promoter must be linked to a suitable shRNA sequence to achieve its RNAi efficacy. Research has shown that while the transcriptional capacity of the U6 promoter determines the efficiency of target gene silencing, the structure of the shRNA also significantly influences the ultimate level of gene inhibition. The structural characteristics of shRNA primarily include two short inverted repeat sequences connected by a stem-loop loop, with five or six thymidine nucleosides (T) added to the 3' end as a termination sequence for RNA polymerase III. When the U6 promoter is linked to a properly designed shRNA, RNA polymerase III initiates transcription from the transcription start site within the TATA box to the termination sequence. Due to the complementary inverted repeat sequences at both ends, the transcript forms a hairpin structure. Dicer cleaves the stem-loop to form siRNAs. The 3' end of the siRNA also carries two overhanging uridine nucleosides (U) as termination sequences, similar to natural siRNAs, which can enhance gene silencing efficiency.

[0007] Due to the highly conserved nature of the U6 snRNA sequence, U6 promoters have been cloned from multiple species, including mice, cattle, chickens, and fruit flies. However, few U6 promoters have been identified in fish, including those from zebrafish and pufferfish. However, the knockdown efficiency of these fish U6 promoters is low. Current research suggests that U6 promoters may be species-specific; U6 promoters from mammals and other species are not suitable for fish, and U6 promoters closely related to the target species should be selected whenever possible. Therefore, given the scarcity of U6 promoters in fish, it is essential to identify highly efficient U6 promoters to ensure efficient RNAi in fish. Summary of the Invention

[0008] The present invention aims to provide a grouper GU6-1 promoter that can efficiently mediate gene knockdown.

[0009] The present invention also aims to provide the use of the grouper GU6-1 promoter in mediating gene knockdown.

[0010] To achieve the above first purpose, the present invention adopts the following technical solutions:

[0011] A grouper GU6-1 promoter mediating gene knockdown, wherein the nucleotide sequence of the grouper GU6-1 promoter is shown as SEQ ID NO: 1.

[0012] The grouper GU6-1 promoter of the present invention has a total of one. The DNA sequence of the grouper GU6-1 promoter is 398 bp in length and contains a 5 bp CCAAT Box element, an 11 bp OCT element, a 20 bp PSE element and a 7 bp TATA Box element.

[0013] The present invention also provides a method for knocking down a gene using the grouper GU6-1 promoter sequence, comprising the following steps:

[0014] (1) GU6-1 promoter cloning: The fin rays of grouper were collected, total DNA was extracted, GU6-1 specific primers were designed, PCR amplification was performed, and the destination vector containing the GU6-1 sequence was obtained through ligation, transformation and single clone selection;

[0015] (2) Construction of knockdown vector PBAsi-GU6-1-shRNA: The GU6-1 sequence in step (1) was connected to the PBAsi-HU6 plasmid by double enzyme digestion and homologous recombination to construct the PBAsi-GU6-1 vector, and the shRNA target sequence of the target gene (including but not limited to TNF-α, MSTN (grouper), leptin-B, BMP 15, MSTN (zebrafish), NTL) was screened using the shRNA screening website. The synthesized shRNA was connected by double enzyme digestion and homologous recombination to construct the PBAsi-GU6-1-shRNA vector;

[0016] (3) Construction of the overexpression vector Psi-check2-ORF: RNA was extracted from grouper and zebrafish tissues and reverse transcribed. The open reading frame (ORF) regions of target genes in grouper (including but not limited to TNF-α, MSTN (grouper), leptin-B, and BMP 15) and the ORF regions of target genes in zebrafish (including but not limited to MSTN (zebrafish) and NTL) were cloned as target sequences and connected into the Psi-check2 plasmid using double enzyme digestion and homologous recombination to construct the Psi-check2-ORF vector.

[0017] (4) GU6-1 promoter knockdown efficiency detection: The constructed PBAsi-GU6-1-shRNA vector and Psi-check2-ORF vector were co-transfected into the human HEK-293T cell line, and the gene knockdown efficiency was detected using the dual fluorescein reporter gene system; the constructed PBAsi-GU6-1-shRNA vector was transfected into the grouper GS cell line, RNA was extracted, and the expression of the target gene and shRNA was analyzed by fluorescent quantitative PCR to detect the gene knockdown efficiency;

[0018] (5) Investigation of the transcriptional toxicity level of the GU6-1 promoter: The PBAsi-GU6-1-shRNA vector was transfected into HEK-293T cell lines and GS cell lines, and the CCK-8 kit was used to detect changes in the toxicity level of the cells;

[0019] (6) Investigation of the duration of continuous transcription of the GU6-1 promoter: The PBAsi-GU6-1-shRNA vector was transfected into the HEK-293T cell line and the GS cell line. Cell RNA samples were collected at five time points: 24 h, 48 h, 3 d, 4 d, and 5 d. The duration of continuous transcription of the GU6-1 promoter was detected by PCR.

[0020] (7) Exploration of GU6-1 promoter at the embryonic level: Zebrafish embryonic cells at the 1-cell stage were collected, and the GU6-1-MSTN 550 shRNA plasmid was diluted to 200 ng / μL. The relevant plasmid was injected into the animal pole of the zebrafish embryo using a microinjector. After injection, the embryos were placed in a culture tank for further culture. The development of each group of embryonic cells was continuously observed and photographed for record.

[0021] (8) In vivo investigation of GU6-1 promoter: Each adult zebrafish was treated with 0.16 times volume (μL) of in vivo transfection reagent (in vitro) at a ratio of 5 μg plasmid (GU6-1-MSTN550shRNA) DNA / g body weight. ) was diluted to 10 μL with 5% sucrose solution, thoroughly vortexed and microcentrifuged, and then allowed to stand at room temperature for 15 minutes. After anesthetizing the fish, the coated GU6-1-MSTN 550 shRNA plasmid was injected into the muscle tissue of the fish using a 10 μL syringe. A control group was injected with an empty plasmid and returned to the culture tank. Muscle tissue RNA samples were collected 24 hours after injection.

[0022] In this method:

[0023] Preferably, in steps (2) to (3), BamHI and EcoRI restriction endonucleases are used to perform double digestion of the plasmid and homologous recombination to construct the PBAsi-GU6-1 vector, PBAsi-GU6-1-shRNA vector and Psi-check2-ORF vector.

[0024] Preferably, in step (4), grouper TNF-α, MSTN, leptin-B, BMP 15 and zebrafish MSTN, NTL are used as target genes to perform knockdown efficiency detection.

[0025] Preferably, in step (6), the knockdown vector and the overexpression vector are transfected into the human HEK-293T cell line and the grouper GS cell line.

[0026] Preferably, in step (7), the knockdown vector is microinjected into zebrafish 1-cell stage embryos.

[0027] Preferably, in step (8), the knockdown vector is injected into the zebrafish muscle.

[0028] The present invention constructs knockdown vectors PBAsi-GU6-1-shRNA and Psi-check2-ORF, and verifies their knockdown efficacy in different cell lines, such as the human HEK-293T cell line and the grouper GS cell line. The knockdown efficacy was further verified in zebrafish embryos and muscle.

[0029] To achieve the above second purpose, the present invention adopts the following technical solutions:

[0030] Application of the above-mentioned grouper GU6-1 promoter in mediating gene knockdown.

[0031] The grouper GU6-1 promoter and the shRNA of the target gene in the present invention are jointly constructed into a vector. When the vector enters the cell, the GU6-1 promoter can efficiently drive the transcription of the shRNA. The shRNA forms a large amount of siRNA under the action of Dicer enzyme and the like. The siRNA specifically binds to the target site of the target gene, thereby significantly inhibiting the expression of the target gene and achieving the purpose of gene knockdown.

[0032] Therefore, the grouper GU6-1 promoter and its vector in the present invention can be used as a type of molecular biology tool suitable for fish RNAi research. After the constructed vector is transferred into cells, the expression level of any target gene can be reduced, thereby studying the function of the gene, pathway mechanism and other practical research.

[0033] Compared with the existing technology, the present invention has the following advantages: the present invention provides a grouper U6 promoter that can efficiently mediate gene knockdown and its application in RNAi; the GU6-1 promoter can efficiently, stably, continuously and safely express shRNA to induce gene silencing, providing a reliable new tool and technical platform for gene function research, variety improvement and disease control in fish and even other animals. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is the PCR gel electrophoresis diagram of the grouper GU6-1 promoter in Example 1; M: molecular marker;

[0035] Figure 2 is the vector map of PBAsi-GU6-1 in Example 1;

[0036] Figure 3 The target positions of the shRNAs for each gene in Example 1; grouper: grouper; zebrafish: zebrafish; the numbers represent the designed positions of the shRNAs;

[0037] Figure 4is the knockdown efficiency of the shRNA driven by the GU6-1 promoter in HEK-293T cells in Example 1; Relative Luciferase activity: relative fluorescence value;

[0038] Figure 5 is the knockdown efficiency of the shRNA driven by the GU6-1 promoter in GS cells in Example 1; Relative mRNA level: relative mRNA expression level; control: control;

[0039] Figure 6 It is the toxicity level detection of shRNA driven by the GU6-1 promoter in Example 1; Relative cell viability: relative cell viability;

[0040] Figure 7 is the duration of transcription of shRNA driven by the GU6-1 promoter in HEK-293T cells in Example 1; 293T cell line: HEK293 cell line; control: control; h: hour; d: day;

[0041] Figure 8 This is the knockdown phenotype of MSTN shRNA driven by the GU6-1 promoter in zebrafish embryos in Example 1, control: control; Relative mRNA level: relative mRNA expression level; knock down: knockdown.

[0042] Figure 9 This is the study of knocking down the MSTN gene in zebrafish muscle by using MSTN shRNA driven by the GU6-1 promoter in Example 1, control: control; Relative mRNA level. DETAILED DESCRIPTION

[0043] The application method of the present invention is further described below with reference to specific examples. The following examples and figures are for illustrative purposes only and are not to be construed as limiting the present invention. Unless otherwise specified, the reagent raw materials used in the following examples are conventional commercially available or commercially available raw reagent raw materials. Unless otherwise specified, the methods and equipment used in the following examples are conventional methods and equipment used in the art.

[0044] Example 1

[0045] 1. Cloning of the grouper GU6-1 promoter

[0046] (1) Extraction of total DNA from Epinephelus coioides

[0047] Healthy grouper was taken and anesthetized on ice. The tail fin tissue of the grouper was cut and the total DNA was extracted using a DNA extraction kit.

[0048] (2) Promoter PCR cloning

[0049] Specific primers were designed, the upstream primer was GU6-1-F: CGAAAACAGGAAGTAGGAAG; the downstream primer was GU6-1-R: GACAGTACCATGTTTCGGGG. The size of the amplified promoter fragment was 398 bp. The electrophoresis results were as follows: Figure 1 As shown, the target band was recovered from the gel and ligated to the PGEM-T Easy vector. After transformation into DH5α Escherichia coli, positive clones were selected for sequencing.

[0050] The sequencing sequence is as follows:

[0051]

[0052] in: Indicates CCAAT Box; _ indicates OCT element; Indicates PSE components; Indicates TATA Box.

[0053] It contains a 5bp CCAAT Box element, an 11bp OCT element, a 20bp PSE element and a 7bp TATA Box element.

[0054] 2. Construction of GU6-1 promoter knockdown plasmid

[0055] The PBAsi-HU6 plasmid was double-digested with BamHI and EcoRI restriction endonucleases, run on an electrophoretic gel, and the target band was purified. Based on the GU6-1 promoter sequence, homology arms were added to the sequence. The upstream primer sequence was GU6-1-EcoRIF: ATCGATATCGAATTCCGAAAACAGGAAGTAGG AAG; the downstream primer sequence was GU6-1-BamHI-R: GCTATCGATGGATCCCGACAGTAC CATGTTTCGGG. PCR was performed using the PGEM-T Easy vector containing the GU6-1 promoter as a template. The target fragment was recovered from the gel and ligated into the double-digested PBAsi-HU6 plasmid. After transformation into DH5α Escherichia coli, positive clones were selected and sequenced. After sequencing verification of the correct sequence, the PBAsi-GU6-1 vector was constructed. Figure 2 ).

[0056] The shRNA screening website (http: / / rnaidesigner.thermofisher.com) was used to screen the target sequence of the target gene. Figure 3 , including grouper TNF-α, MSTN, leptin-B, BMP 15, and zebrafish MSTN and NTL as target genes). The synthesized shRNAs were ligated using the aforementioned homologous recombination method, transformed into DH5α Escherichia coli, and positive clones were selected for sequencing. After sequencing verification of the correct sequence, the PBAsi-GU6-1-shRNA vector was constructed.

[0057] 3. Construction of target gene overexpression plasmid

[0058] (1) Extraction of total RNA

[0059] Healthy Epinephelus coioides and zebrafish were anesthetized on ice, and the head kidney tissue, muscle tissue, gonad tissue of grouper, muscle tissue of zebrafish and early embryonic tissue of zebrafish were respectively cut, and total RNA was extracted using the Trizol method.

[0060] (2) Synthesis of the first strand of cDNA

[0061] 1 μg of total RNA sample from each tissue was treated with DNase to remove genomic DNA contamination, mixed with RNA OligodT, and reverse transcribed. The resulting product was stored in a -20°C refrigerator for future use.

[0062] (3) Cloning of target gene ORF sequence

[0063] Grouper TNF-α (Tumor Necrosis Factor-α), MSTN (Myostatin), leptin-B, BMP 15 (Bone morphogenetic protein 15), and zebrafish MSTN and NTL (no tail) were selected as target genes. Using appropriate cDNA as templates, their complete ORF regions were cloned. The cloning primers for each target gene are shown in Table 1 below. After gel recovery, the cloned gene fragments were ligated with the double-enzyme-digested Psi-check2 plasmid using the above-mentioned homologous recombination method, transformed into DH5α Escherichia coli, and positive clones were selected for sequencing. After sequencing verification of the correct sequence, the Psi-check2-ORF vector was constructed.

[0064] Table 1 Target gene cloning primers

[0065]

[0066] 4. Study on the efficiency of GU6-1 promoter gene knockdown

[0067] An appropriate amount of HEK-293T cells were seeded into a 48-well plate and transfected when the cells grew to 70% to 80%. The culture medium was changed to serum-free Opti-MEM before transfection. Each well was transfected with 200 ng of PBAsi-GU6-1-shRNA or PBAsi-GU6-1 blank vector control, and 200 ng of Psi-check2-ORF vector of the corresponding target gene. After 6 hours of transfection, the culture medium was changed to DMEM culture medium containing 5% fetal bovine serum. Dual luciferase reporter gene assay was performed 24 hours after transfection to calculate the knockdown efficiency of each gene. The experimental results are shown in the figure. Figure 4 shown.

[0068] Figure 4 For multiple genes, shRNA driven by the GU6-1 promoter can significantly inhibit the expression levels of genes in HEK-293T, among which the TNF-α group had the highest knockdown efficiency of 56.76%; the MSTN (grouper) group had the highest knockdown efficiency of 63.23%; the MSTN (zebrafish) group had the highest knockdown efficiency of 81.16%; the Leptin-B group had the highest knockdown efficiency of 76.07%; the TNF-α group had the highest knockdown efficiency of 56.76%; the BMP 15 group had the highest knockdown efficiency of 77.00%; and the NTL group had the highest knockdown efficiency of 79.61%.

[0069] An appropriate number of grouper GS cells were seeded into a 48-well plate and transfected when the cells reached 70% to 80% growth. The culture medium was changed to serum-free Opti-MEM medium before transfection. Each well was transfected with 200 ng of Pbasi-GU6-1-TNF-α shRNA / Pbasi-GU6-1-Leptin-B shRNA or a Pbasi-GU6-1 blank vector control. Six hours after transfection, for cells in the TNF-α group, 200 μL of L-15 medium containing 1 mg / mL lipopolysaccharide (LPS) and 5% fetal bovine serum was added to each well; for cells in the Leptin-B group, 200 μL of L-15 medium containing 5% fetal bovine serum was added to each well for medium replacement. 24 hours after transfection, cell samples were collected, total cell RNA was extracted, reverse transcribed, and fluorescence quantitative PCR was used to detect the mRNA expression of TNF-α and Leptin-B, with β-actin as the internal reference gene and the primers shown in Table 2 below; shRNA primers were also used for PCR to detect shRNA expression, with U6 snRNA as the internal reference gene and the primers shown in Table 3 below. The results were analyzed based on the CT values ​​obtained by the test, and the relative expression levels of TNF-α and Leptin-B were calculated using the 2-△△ct method. The experimental results are shown in Figure 5 shown.

[0070] Table 2 Fluorescence quantitative PCR primers

[0071]

[0072] Table 3 Primers for shRNA expression detection

[0073]

[0074]

[0075] Note: mRQ 3'Primer was purchased from Takara Co., Ltd., Japan, the same below.

[0076] Figure 5 In the experiment, the shRNA driven by the GU6-1 promoter could be normally transcribed in GS cells and effectively knocked down genes. The knockdown efficiency of the TNF-α group was 51.02%, and the knockdown efficiency of the Leptin-B group was 31.05%, indicating that the GU6-1 promoter can efficiently and stably express shRNA to induce gene silencing.

[0077] 5. Investigation of the transcriptional toxicity level of the GU6-1 promoter

[0078] Appropriate amounts of HEK-293T cells and GS cells were seeded into 48-well plates and transfected when the cells reached 70% to 80% growth. Serum-free Opti-MEM medium was used before transfection. Each well was transfected with 200 ng of Pbasi-GU6-1 shRNA or a Pbasi-GU6-1 blank vector control. After 24 hours, the sample cells were collected and the CCK-8 kit was used to detect changes in the cell toxicity level. The experimental results are shown in Figure 2. Figure 6 shown.

[0079] Figure 6 In the experiment, the toxicity level of the shRNA expression group driven by the GU6-1 promoter was not significantly different from that of the empty vector group and the negative control group, indicating that the GU6-1 promoter safely expressed shRNA to induce gene silencing.

[0080] 6. Study on the duration of transcription of GU6-1 promoter

[0081] Appropriate amounts of HEK-293T cells and GS cells were seeded into 48-well plates and transfected when the cells grew to 70% to 80%. The culture medium was changed to serum-free Opti-MEM before transfection. 200 ng of Pbasi-GU6-1 MSTN shRNA plasmid was transfected into each well. Cell RNA samples were collected at five time points: 24h, 48h, 3d, 4d, and 5d. Total cell RNA was extracted and reverse transcribed. PCR was performed using shRNA primers to detect the duration of transcription of the GU6-1 promoter. The primers are shown in Table 4 below. The experimental results are shown in Table 4 below. Figure 7 shown.

[0082] Figure 7 In the experiment, the shRNA driven by the GU6-1 promoter could be stably transcribed within 4 days, and the expression level decreased on the 5th day, indicating that the GU6-1 promoter can continuously express shRNA to induce gene silencing.

[0083] Table 4 Primers for shRNA expression detection

[0084]

[0085]

[0086] 7. Study on GU6-1 promoter-mediated gene knockdown in zebrafish embryos

[0087] Mature AB strain zebrafish were selected for natural spawning and fertilization, and embryonic cells at the 1-cell stage were collected. The GU6-1-MSTN 550 shRNA plasmid was diluted to 200 ng / μL. The relevant plasmid was injected into the animal pole of the zebrafish embryos using a microinjector. The control group was injected with only the diluted phenol red solution. After injection, the embryos were placed in a culture tank and cultured. The development of the embryonic cells in each group was continuously observed and photographed as needed. After 24 hours, RNA was extracted from the zebrafish embryos, and the expression of the MSTN gene was detected by fluorescent quantitative PCR.

[0088] Figure 8 In the study, both MSTN shRNAs were transcribed normally in zebrafish embryos. The shRNAs significantly suppressed MSTN expression and resulted in knockdown-related phenotypes in the embryos. After MSTN gene silencing, embryos in the control group developed normally 36 hours after hatching, while approximately 70% of embryos in the knockdown group had ruptured membranes and entered the larval stage. These results confirm that the GU6-1 promoter can effectively induce RNAi in zebrafish embryos.

[0089] 8. Study on GU6-1 promoter-mediated gene knockdown in zebrafish muscle

[0090] Adult AB strain zebrafish were selected. 0.16 times the volume (μL) of in vivo transfection reagent (in vitro) was added to each adult zebrafish at a ratio of 5 μg plasmid (GU6-1-MSTN550shRNA) DNA / g body weight. ) was diluted to 10 μL with 5% sucrose solution, thoroughly vortexed and microcentrifuged, and then allowed to stand at room temperature for 15 minutes. After anesthetizing the fish, the coated GU6-1-MSTN 550 shRNA plasmid was injected into the muscle tissue using a 10 μL syringe. A control group was injected with an empty plasmid and returned to the culture tank. Muscle tissue was sampled 24 hours after injection. RNA was extracted, and the expression of the MSTN gene was detected by fluorescent quantitative PCR.

[0091] Figure 9 In the study, MSTN shRNA was transcribed normally in zebrafish muscle. The shRNA significantly suppressed MSTN expression, indicating that the GU6-1 promoter can effectively induce RNAi in zebrafish muscle.

[0092] The above embodiments are only used to illustrate the present invention, and the scope of protection of the present invention is not limited to the above embodiments. Those skilled in the art can achieve the purpose of the present invention based on the above disclosure of the present invention. Any improvements and modifications based on the concept of the present invention fall within the scope of protection of the present invention, and the specific scope of protection is as described in the claims.

Claims

1. A grouper GU6-1 promoter for mediating gene knockdown, characterized by: The nucleotide sequence of the grouper GU6-1 promoter is shown in SEQ ID NO:

1.

2. Use of the grouper GU6-1 promoter according to claim 1 in constructing an siRNA expression vector.

Images