Preparation method and application of a eukaryotic expression vector for Nile tilapia CD36 protein

Abstract

The present invention discloses a method for preparing a eukaryotic expression vector of Nile tilapia CD36 protein and its application. The method comprises extracting RNA from Nile tilapia intestinal tissue and synthesizing cDNA; performing PCR amplification on the coding sequence fragment of the Nile tilapia CD36 gene to obtain the Nile tilapia CD36 protein gene; and then constructing a eukaryotic expression vector pEGFP-N1-CD36 of the Nile tilapia CD36 protein. The eukaryotic expression vector of the nucleotide sequence of the Nile tilapia CD36 protein prepared by the present invention can be used to prepare a product that improves the anti-streptococcal immunity of tilapia. The preparation of the product is simple, easy to operate, and low in cost. The present invention enhances the anti-streptococcal ability of tilapia by overexpressing the Nile tilapia CD36 protein in tilapia, thereby increasing the survival rate of tilapia infected with Streptococcus agalactiae by 60%. In addition, overexpressing the Nile tilapia CD36 protein in tilapia can also reduce the Streptococcus agalactiae load in tilapia. Therefore, it can be seen that the technical solution of the present invention can effectively induce cellular immunity in tilapia.

Description

Technical Field

[0001] The present invention relates to the technical field of fish immunity, in particular to a preparation method and application of a eukaryotic expression vector of Nile tilapia CD36 protein. Background Art

[0002] CD36 is a single-chain transmembrane glycoprotein belonging to the class B scavenger receptor. It is primarily composed of an extracellular domain, a C-terminal cytoplasmic region, an N-terminal cytoplasmic region, and two transmembrane regions. CD36 is expressed in antigen-presenting cells and participates in innate immunity, regulating immune responses and the activation of B and T cells. CD36 recognizes lipoteichoic acid, a cell wall component of Gram-positive bacteria, thereby stimulating the innate immune system to exercise its defensive functions, promoting bacterial clearance and internalization.

[0003] Streptococcal disease is a major threat to the tilapia aquaculture industry. The problem of drug-resistant strains caused by overuse of antibiotics cannot be ignored. Vaccines are a green and effective method for controlling viral and bacterial infections, but fishery vaccines stimulate weak cellular immunity. Furthermore, they currently do not offer a low-cost, long-term solution.

[0004] Research on the CD36 protein in Nile tilapia has yet to be reported. As an important aquacultured economic aquatic product, Nile tilapia production in my country and international market demand are increasing annually. Tilapia has a high protein content and a rich variety of essential amino acids, making it a nutritionally comprehensive, high-quality protein source. In recent years, outbreaks of Streptococcus agalactiae have caused high mortality rates in tilapia and seriously threatened the development of the tilapia industry. Scavenger receptors (SRs) are an important class of pattern recognition receptors (PRRs) that play a crucial role in host defense against pathogenic microorganisms by recognizing pathogen-associated molecular patterns (PAMPs). As a member of the scavenger receptors, CD36 plays a crucial role in host immunity and is therefore crucial for exploring strategies to control streptococcal disease in tilapia.

[0005] Therefore, it is urgent to develop a preparation method and application of a eukaryotic expression vector of Nile tilapia CD36 protein. Summary of the Invention

[0006] The purpose of the present invention is to solve the deficiencies in the prior art and provide a method for preparing a eukaryotic expression vector of Nile tilapia CD36 protein and its application.

[0007] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0008] The first object of the present invention is to provide a method for preparing a eukaryotic expression vector of Nile tilapia CD36 protein, comprising the following steps:

[0009] S1, extract RNA from the intestinal tissue of Nile tilapia and synthesize cDNA;

[0010] S2, using tilapia intestinal cDNA as a template, the coding sequence fragment of the Nile tilapia CD36 gene was amplified by PCR using the synthesized upstream primer CD36-F: 5'GAAGGAAGGCAACACACACCAC-3' and downstream primer CD36-R: 5'GATTCATTCATCCAAGGTTTGTTTT-3'. After the PCR amplification reaction was completed, the PCR amplification product was detected by gel electrophoresis to obtain a fragment of a single target band size. The amplification system was expanded and detected by electrophoresis. The PCR amplification product was purified and recovered, and then ligated to the pMD-18T vector and then transformed into Trans1-T1 competent cells. A single colony was picked on a plate for colony PCR detection to obtain the Nile tilapia CD36 protein gene;

[0011] S3. Using the pMD-18T plasmid pMD-18T-CD36 containing the Nile tilapia CD36 protein gene ORF fragment as a template, PCR amplification was performed using the synthesized upstream primer pEGFP-N1-CD36-BamHI-F: 5'-CGCGGATCCGACATGATCATTGAGAG-3' and the downstream primer pEGFP-N1-CD36-Xhol-R: 5'-CCGCTCGAGTTGCTGTACTATCTCC-3'; the PCR amplified target fragment was ligated with the expression vector pEGFP-N1 using T4 ligase, and the cells were transformed into Trans1-T1 competent cells. Single colonies were picked out for colony PCR detection to obtain the eukaryotic expression vector pEGFP-N1-CD36 of the Nile tilapia CD36 protein.

[0012] Furthermore, the coding sequence fragment of the Nile tilapia CD36 gene in step S2 is derived from the GenBank nucleotide sequence database, with accession number: XM_003452029.5.

[0013] Furthermore, the PCR amplification reaction system in step S2 is: TaKaRa Ex Taq, 10 μL; tilapia intestinal cDNA template, 0.5 μL; CD36-F, 1 μL; CD36-R, 1 μL; ddH2O, 7.5 μL; total volume, 20 μL; PCR reaction conditions: 95°C for 5 min; 95°C for 15 s, 55°C for 30 s, 72°C for 1 min 30 s, 34 cycles; 72°C for 5 min; stored at 4°C; the colony PCR detection reaction system is the same as above, using primers M13-F and M13-R.

[0014] Furthermore, the PCR amplification reaction system in step S3 is: 5×TaKaRa Ex Taq, 10 μL; pMD-18T-CD36, 1 μL; pEGFP-N1-CD36-BamHI-F, 1 μL; pEGFP-N1-CD36-Xhol-R, 1 μL; ddH2O, 7 μL; total volume, 20 μL; PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 55°C for 30 s, 72°C for 1 min 30 s, 34 cycles; 72°C for 10 min; stored at 4°C; the colony PCR detection reaction system is the same as above, using primers pEGFPN5 and pEGFPN3.

[0015] The second object of the present invention is to provide a use of a eukaryotic expression vector of Nile tilapia CD36 protein prepared by the above method in the preparation of a product to enhance the immunity of tilapia against Streptococcus agalactiae.

[0016] Compared to the prior art, the present invention has prepared a eukaryotic expression vector for the nucleotide sequence of the Nile tilapia CD36 protein. This eukaryotic expression vector for the nucleotide sequence of the Nile tilapia CD36 protein can be used to prepare a product that enhances tilapia's anti-streptococcal immunity. The product can be administered to tilapia via in vivo injection, making it simple, easy to operate, and low-cost to prepare. The present invention enhances tilapia's anti-streptococcal ability by overexpressing the Nile tilapia CD36 protein in tilapia, increasing the survival rate of tilapia infected with Streptococcus agalactiae by 60%. Furthermore, overexpressing the Nile tilapia CD36 protein in tilapia can also reduce the Streptococcus agalactiae load in the tilapia. This demonstrates that the present invention's technical solution can effectively induce cellular immunity in tilapia. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the electrophoresis diagram of the pEGFP-N1-CD36 recombinant expression vector.

[0018] Figure 2 Expression verification results of recombinant plasmids pEGFP-N1 and pEGFP-N1-CD36, A: negative control group; B: PBS control group; C: pEGFP-N1 control group; D: pEGFP-N1-CD36 experimental group.

[0019] Figure 3 The electrophoresis diagram of the infected tilapia was confirmed to be Streptococcus agalactiae by colony PCR detection.

[0020] Figure 4 Overexpression of CD36 significantly reduced the load of Streptococcus agalactiae in the spleen and liver of tilapia.

[0021] Figure 5 Overexpression of CD36 significantly reduced the lethality of Streptococcus agalactiae. DETAILED DESCRIPTION

[0022] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0023] Example 1

[0024] The preparation of the eukaryotic expression vector of the Nile tilapia CD36 protein of this embodiment is as follows:

[0025] First, RNA was extracted from Nile tilapia intestinal tissue and cDNA was synthesized: After four weeks of laboratory culture, healthy Nile tilapia were taken and 10-20 mg of intestinal tissue was collected. This was quickly frozen in liquid nitrogen and stored at -80°C. RNA was extracted from various tilapia tissues according to the instructions for the TransZol Up Plus RNA Kit. Reverse transcription was performed using the instructions for the Reverse Transcriptase M-MLV kit, and cDNA was synthesized using the TransScript First-Strand cDNA Synthesis Super Mix kit.

[0026] Then, using tilapia intestinal cDNA as a template, the coding sequence fragment of the Nile tilapia CD36 gene was PCR amplified using the synthesized upstream primer CD36-F: 5'GAAGGAAGGCAACACACACCAC-3' and downstream primer CD36-R: 5'GATTCATTCATCCAAGGTTTGTTTT-3'. The coding sequence fragment of the Nile tilapia CD36 gene was derived from the GenBank nucleotide sequence database, accession number: XM_003452029.5; the PCR amplification reaction system was: TaKaRa ExTaq, 10 μL; tilapia intestinal cDNA template, 0.5 μL; CD36-F, 1 μL; CD36-R, 1 μL; ddH2O, 7.5 μL; total volume, 20 μL; PCR reaction conditions: 95℃ for 5 min; 95℃ for 15 s, 55℃ for 30 s, 72℃ for 1 min 30 s, 34 cycles; 72℃ for 5 min; and storage at 4℃. After the PCR amplification reaction is completed, the PCR amplification product is detected by gel electrophoresis. After obtaining a fragment of a single target band size, the amplification system is expanded and detected by electrophoresis. The PCR amplification product is purified and recovered, and then connected to the pMD-18T vector, and then transformed into Trans1-T1 competent cells. A single colony is picked and plated for colony PCR detection. The colony PCR detection reaction system is: TaKaRa Ex Taq, 10 μL; tilapia intestinal cDNA template, 0.5 μL; M13-F (which is the universal primer of pMD-18T, the primer sequence is AGGGTTTTCCCAGTCACG), 1 μL; M13-R (which is the universal primer of pMD-18T, the primer sequence is GAGCGGATAACAATTTCACAC), 1 μL; ddH2O, 7.5 μL; total volume, 20 μL; PCR reaction conditions: 95°C 5 min; 95°C 15 s, 55°C 30 s, 72°C 1 min 30s, 34 cycles; 72°C for 5min; stored at 4°C; the Nile tilapia CD36 gene was obtained, and the selected positive bacteria were sent to Shenggong Bioengineering Co., Ltd. (Guangzhou) for sequencing. The nucleotide sequence is as follows:

[0027]

[0028] Secondly, using the pMD-18T plasmid containing the Nile tilapia CD36 gene ORF fragment, i.e., pMD-18T-CD36, as a template, PCR amplification was performed using the synthesized upstream primer pEGFP-N1-CD36-BamHI-F: 5'-CGCGGATCCGACATGATCATTGAGAG-3' and the downstream primer pEGFP-N1-CD36-Xhol-R: 5'-CCGCTCGAGTTGCTGTACTATCTCC-3'. The PCR amplification reaction system was: 5×TaKaRa Ex Taq, 10 μL; pMD-18T-CD36, 1 μL; pEGFP-N1-CD36-BamHI-F, 1 μL; pEGFP-N1-CD36-Xhol-R, 1 μL; ddH2O, 7 μL; total volume, 20 μL; PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min. 30s, 34 cycles; 72℃ for 10min; stored at 4℃; ligated the PCR amplified target fragment with the expression vector pEGFP-N1 using T4 ligase, transformed into Trans1-T1 competent cells, and plated to pick single colonies for colony PCR detection. The colony PCR detection reaction system was: 5× TaKaRa Ex Taq, 10 μL; bacterial solution (pMD-18T-CD36), 1 μL; pEGFPN5 (which is the universal primer of pEGFP-N1, the primer sequence is CGGTGGGAGGTCTATATAAG), 1 μL; pEGFPN3 (which is the universal primer of pEGFP-N1, the primer sequence is GTCGCCGTCCAGCTCGACCAG), 1 μL; ddH2O, 7 μL; total volume, 20 μL; PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 55°C for 30 s, 72°C for 1 min 30 s, 34 cycles; 72°C for 10 min; store at 4°C; obtain the eukaryotic expression vector pEGFP-N1-CD36 of Nile tilapia CD36 protein.

[0029] Example 2

[0030] The eukaryotic expression vector of the Nile tilapia CD36 protein prepared in Example 1 can be used to prepare a product for improving tilapia immunity against Streptococcus agalactiae. To verify its properties, the following experiments were performed:

[0031] 1. Validation of the eukaryotic expression vector for Nile tilapia CD36 protein overexpression in vivo

[0032] The tilapia purchased from Jieyang Sanao Fish Farm were temporarily placed in Dapeng Linhai Marine Biological Industry Innovation Demonstration Base. The average weight was 80±10g. They were raised in the breeding base and fed twice a day.

[0033] Bacterial suspensions containing the empty plasmid pEGFP-N1 and pEGFP-N1-CD36 plasmid were inoculated into LB medium (containing Kana+) for 12-16 hours at 37°C and 120 rpm. Plasmids were then extracted according to the instructions for the OMEGA Endo-Free Plasmid Maxi Kit. Plasmid concentrations were measured using a NanoDrop 2000 and diluted to 100 μg / mL in PBS.

[0034] 140 healthy tilapia (80±10g) were randomly divided into 4 groups, with 35 in each group. Group A: negative control group; Group B: PBS control group; Group C: empty plasmid pEGFP-N1 control group; Group D: recombinant plasmid pEGFP-N1-CD36 experimental group. Group A was not injected, and the other groups were injected intramuscularly with 100μL PBS, 10μg pEGFP-N1 and 10μg pEGFP-N1-CD36, respectively. One week after the injection, the head kidney and spleen tissues were taken and fixed with 4% paraformaldehyde solution. The expression of green fluorescent protein in vivo was observed using frozen sections and fluorescence microscopy. The results are shown in Figure 3. Figure 2 The results showed that pEGFP-N1 and pEGFP-N1-CD36 successfully expressed green fluorescent protein in tilapia.

[0035] 2. Detection of the bacterial load of tilapia infected with Streptococcus agalactiae by overexpressing CD36 protein in vivo using a eukaryotic expression vector of Nile tilapia CD36 protein

[0036] According to the above grouping, 7 days after injection, group A was injected with 100 μL PBS, and the other groups were injected with 100 μL Streptococcus agalactiae (5×10 7 ) were used for the challenge experiment. 24 h after the challenge with Streptococcus agalactiae, 3 tilapia were taken from each group, spleen and liver tissues were extracted under sterile conditions, and equal amounts were weighed and homogenized in sterile PBS, diluted 10-fold, and 10 -5 , 10 -6 Dilution concentration, each dilution concentration was spread on BHI plates in triplicate, incubated at 28°C for 12-24 hours, and colony counts were performed. Colony PCR detection was performed using bacterial 16S rDNA universal primers 27F / 1492R, and verification was performed by agarose gel electrophoresis ( Figure 3) and the positive bacteria were sent to Shenggong Bioengineering Co., Ltd. (Guangzhou) for sequencing. It was determined that the dead tilapia were infected with Streptococcus agalactiae. The bacterial load results showed that the amount of Streptococcus agalactiae in the pEGFP-N1-CD36 group was significantly lower than that in the control group ( Figure 4 ).

[0037] 3. Effect of overexpression of CD36 protein in vivo using a eukaryotic expression vector of Nile tilapia CD36 protein on the survival rate of tilapia infected with Streptococcus agalactiae

[0038] Same as above grouping, 7 days after plasmid injection, group A was injected with 100 μL PBS, and the other groups were injected with 100 μL Streptococcus agalactiae (5×10 7 ) were used for the challenge experiment, with 30 fish in each group. The mortality of tilapia was observed and recorded for 14 consecutive days. The results showed that the survival rate of the PBS group was 100%, the survival rate of the PBS + Streptococcus agalactiae group was 10%, the survival rate of the pEGFP-N1 + Streptococcus agalactiae group was 13.3%, and the survival rate of the pEGFP-N1-CD36 + Streptococcus agalactiae group reached 60% ( Figure 5 ), the above results indicate that overexpression of CD36 in vivo has an inhibitory effect on death caused by acute infection with Streptococcus agalactiae, suggesting that the eukaryotic expression vector of Nile tilapia CD36 protein has a certain immune protective effect on the body.

[0039] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. Any technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. Use of a eukaryotic expression vector of Nile tilapia CD36 protein in the preparation of a product for improving tilapia immunity against Streptococcus agalactiae, characterized in that: The method for preparing the eukaryotic expression vector of the Nile tilapia CD36 protein comprises the following steps: S1, extract RNA from the intestinal tissue of Nile tilapia and synthesize cDNA; S2, using tilapia intestinal cDNA as a template, the coding sequence fragment of the Nile tilapia CD36 gene was amplified by PCR using the synthesized upstream primer CD36-F: 5'GAAGGAAGGCAACACACACCAC-3' and downstream primer CD36-R: 5'GATTCATTCATCCAAGGTTTGTTTT-3'. After the PCR amplification reaction was completed, the PCR amplification product was detected by gel electrophoresis to obtain a fragment of a single target band size. The amplification system was expanded and detected by electrophoresis. The PCR amplification product was purified and recovered, and then ligated to the pMD-18T vector. It was then transformed into Trans1-T1 competent cells, and a single colony was picked on the plate for colony PCR detection to obtain the Nile tilapia CD36 protein gene. S3. Using the pMD-18T plasmid pMD-18T-CD36 containing the Nile tilapia CD36 protein gene ORF fragment as a template, PCR amplification was performed using the synthesized upstream primer pEGFP-N1-CD36-BamHI-F: 5'-CGCGGATCCGACATGATCATTGAGAG-3' and the downstream primer pEGFP-N1-CD36-Xhol-R: 5'-CCGCTCGAGTTGCTGTACTATCTCC-3'; the PCR amplified target fragment was ligated with the expression vector pEGFP-N1 using T4 ligase, and the cells were transformed into Trans1-T1 competent cells. Single colonies were picked and tested by colony PCR to obtain the eukaryotic expression vector pEGFP-N1-CD36 for the Nile tilapia CD36 protein.

2. The use of the eukaryotic expression vector of Nile tilapia CD36 protein according to claim 1 in preparing a product for improving tilapia anti-Streptococcus agalactiae immunity, characterized in that: The coding sequence fragment of the Nile tilapia CD36 gene in step S2 is derived from the GenBank nucleotide sequence database, with accession number: XM_003452029.

5.

3. Use of the eukaryotic expression vector of Nile tilapia CD36 protein according to claim 1 in preparing a product for improving tilapia anti-Streptococcus agalactiae immunity, characterized in that, The PCR amplification reaction system in step S2 is: TaKaRa ExTaq, 10 μL; tilapia intestinal cDNA template, 0.5 μL; CD36-F, 1 μL; CD36-R, 1 μL; ddH2O, 7.5 μL; total volume, 20 μL; PCR reaction conditions: 95°C for 5 min; 95°C for 15 s, 55°C for 30 s, 72°C for 1 min 30 s, 34 cycles; 72°C for 5 min; stored at 4°C; the colony PCR detection reaction system is the same as above, using primers M13-F and M13-R.

4. Use of the eukaryotic expression vector of Nile tilapia CD36 protein according to claim 1 in preparing a product for improving tilapia anti-Streptococcus agalactiae immunity, characterized in that: The PCR amplification reaction system in step S3 is: 5×TaKaRaEx Taq, 10 μL; pMD-18T-CD36, 1 μL; pEGFP-N1-CD36-BamHI-F, 1 μL; pEGFP-N1-CD36-Xhol-R, 1 μL; ddH2O, 7 μL; total volume, 20 μL; PCR reaction conditions: 94°C for 3 min; 94°C for 30 s, 55°C for 30 s, 72°C for 1 min 30 s, 34 cycles; 72°C for 10 min; stored at 4°C; the colony PCR detection reaction system is the same as above, using primers pEGFPN5 and pEGFPN3.

Images