Methods for integrating target gene fragments

Abstract

The present application provides a method for integrating a target gene fragment, which comprises the following steps: 1) obtaining a target gene fragment, wherein the length of the target gene fragment exceeds 100 kb; 2) cloning the target gene fragment into a circular YAC vector; 3) transforming the vector containing the target gene fragment into a yeast cell; 4) introducing the vector containing the target gene fragment in the yeast into a recipient cell, wherein the recipient cell is a eukaryotic cell; 5) inducing the recombinase activity of CreERT2 by adding Tamoxifen, wherein the Cre recombinase mediates the site-specific integration of the target gene fragment into the genome of the recipient cell, and at the same time, the expression cassette 1 and the expression cassette 2 form a resistance expression cassette expressing the complete resistance gene neomycin; 6) screening the recipient cell whose genome has the target gene fragment site-specifically integrated.

Description

[0001] This application is a divisional application of the Chinese patent application with application number 201910951144.8 and invention name “Method for site-specific integration of large fragments of exogenous DNA”. Technical Field

[0002] The present application relates to the field of genetic engineering technology, and in particular, to a method for integrating a target gene fragment. The method of the present application is suitable for efficiently integrating a target gene fragment, especially a large exogenous DNA fragment of more than 300 kb, into a cell genome. Background Art

[0003] Large-scale DNA modification of the cell genome, especially the site-specific integration of ultra-long gene fragments in the genome, especially large exogenous gene fragments with a length of more than 300kb, has always been a difficult problem in biotechnology.

[0004] Mammalian artificial chromosome (MAC) is a cloning vector isolated from mammalian cells and constructed by the replication origin, telomeres and centromeres. This vector can be used to load exogenous DNA fragments larger than 1000 kb. The large exogenous genes carried by MAC can be introduced into eukaryotic cells using microcell-mediated chromosome transfer (MMCT) (Martella, Pollard et al. 2016). Since MAC exists free from chromosomes, exogenous genes cannot be stably integrated into cell chromosomes and obtain stable inheritance.

[0005] Yeast artificial chromosomes (YAC) are vectors that can clone the largest DNA fragments in artificial chromosomes, into which foreign DNA fragments of 100-2000 kb can be inserted. YAC vectors equipped with large fragments of foreign DNA can be inserted into the chromosomes of recipient cells using yeast spheroplast cell fusion technology (Mendez, Green et al. 1997). However, this method has a series of problems: the number of copies of foreign genes is uncontrollable, the genome integration position is random, the YAC vector regulatory sequence causes gene contamination of the recipient cells, and large fragments of genes are easily broken during cell fusion and integration. At the same time, when using this method to establish transgenic mice, it is necessary to perform a large number of genotype identifications on gene-edited non-human ES cell clones, and it is also necessary to identify the phenotypes of different transgenic mouse lines.

[0006] Bacterial artificial chromosome (BAC) is a bacterial chromosome cloning vector constructed based on F-plasmid, which is often used to clone DNA fragments of 150kb-200kb in size. BAC vectors are often used for genetic modification because of their large capacity, genetic stability, and easy operation. Using traditional homologous recombination technology or recombinase system, foreign genes of 100kb to 200kb can be site-specifically integrated into specific locations of the cell genome (Valenzuela, Murphy et al. 2003; Wallace, Marques-Kranc et al. 2007). Limited by the gene capacity of BAC vectors, if you want to modify the genome on a larger scale, such as site-specific insertion or in situ replacement, you need to perform complex multiple genetic modifications on the cells (Macdonald, Karow et al. 2014; Murphy, Macdonald et al. 2014). This strategy is undoubtedly long-term and technically difficult.

[0007] Therefore, there is an urgent need in the art for methods for site-specific integration of large fragments of exogenous DNA, especially large fragments of exogenous DNA larger than 300 kb, into the genome. Summary of the invention

[0008] Large-scale DNA modification of the cell genome, especially the integration of large fragments of exogenous DNA into the genome, has always been a difficult problem in current biotechnology. The main technical difficulties of site-specific integration include the following aspects: 1) It is difficult to clone large fragments of exogenous DNA into gene vectors; 2) It is difficult to completely introduce vectors containing large fragments of exogenous DNA into eukaryotic cells; 3) It is difficult to efficiently integrate large fragments of exogenous DNA into the genome of the recipient cell; 4) It is difficult to efficiently screen and detect site-specific integration recombinant cell clones.

[0009] This patent solves the above-mentioned technical problems through a series of technological innovations, and for the first time provides a method for efficiently and stably integrating large fragments of exogenous DNA, especially large fragments of exogenous DNA larger than 300kb, into the genome.

[0010] Specifically, on one hand, the present application utilizes the improved recombinase system Cre / Loxp, that is, utilizing the Loxp71 / 66 mutant to stably and irreversibly integrate exogenous DNA into the genome of the recipient cell.

[0011] Cre-Lox recombination is a site-specific recombinase technology used to perform deletion, insertion, transposition and inversion operations at specific sites in cell DNA. The Loxp site consists of a 34bp special site sequence, in which the middle 8bp DNA base is an asymmetric sequence that determines the direction of the Loxp sequence. On both sides of the asymmetric sequence are two 13bp reverse symmetric sequences that determine the binding efficiency with Cre. Although the conventional Cre-Lox recombination method can catalyze the site-specific integration of exogenous genes. However, in the initial experiments, wild-type Loxp could not stably integrate large molecular DNA into cell chromosomes. After analysis, this may be because the Loxp sequence-dependent recombination reaction catalyzed by Cre is reversible, that is, reverse recombination or deletion may occur between Loxp sites, so the wild-type Loxp site cannot effectively mediate the stable site-specific integration of large molecular DNA into cell chromosomes.

[0012] When a mutation occurs at one end of the symmetrical sequence, such as Loxp71 (mutation in the symmetrical sequence at the 5' end) and Loxp66 (mutation in the symmetrical sequence at the 3' end), Cre can still catalyze the recombination reaction between mutant Loxp (such as Loxp71 and Loxp66). After the recombination reaction between Loxp71 and Loxp66, wild-type Loxp and double mutant Loxp (Loxp71 / 66) are produced. Because the symmetrical sequences at both ends of Loxp71 / 66 are mutated, their binding ability with Cre is greatly reduced, thus avoiding the reverse recombination reaction between wild-type Loxp and Loxp71 / 66, resulting in the stable and irreversible integration of exogenous DNA into the cell chromosomes, thereby enhancing the stability of the knock-in gene. The present application discovered for the first time that this mutant Loxp, rather than wild-type Loxp, facilitates the site-specific integration of large fragments of DNA into the cell genome. The principle is shown in the attached figure of the specification. Figure 2 .

[0013] The present application has found through experiments that the Loxp double mutation Loxp66 / 71 is the most preferred solution for mediating stable site-specific integration of large molecular DNA into cell chromosomes. Compared with wild-type Loxp, or Loxp containing one mutation, such as Loxp / Loxp66 or Loxp / Loxp71, or Loxp double mutation containing other mutation positions, loxp66 / 71 has the best effect and the highest conversion efficiency, and can most effectively and stably integrate large molecular DNA into cell chromosomes, and is most suitable for site-specific integration and cloning of large fragments of DNA.

[0014] In addition, in order to efficiently screen recombinants that are site-integrated into chromosomes, the present application also designs expression cassettes of the functionally complementary and truncated resistance gene neomycin (NeoR) after the Loxp sites of DNA and chromosomes, respectively. Only recombinants with exogenous genes inserted at the site can express resistance to G418 drugs, while randomly integrated DNA fragments cannot produce drug resistance. See the schematic diagram in the attached figure of the specification. Figure 3 .

[0015] At the same time, the present application uses the FLP / FRT system to remove unnecessary vector sequences and G418 resistance expression cassettes. Figure 3 .

[0016] In addition, since the YAC vector can accommodate up to 2000kb of exogenous DNA fragments, the present application uses YAC as a vector for loading exogenous genes. Traditional YAC vectors are linear structures, unstable in cells, and prone to breakage and homologous recombination. In response to this, the present application utilizes YAC vectors to load large DNA fragments into circular YAC vectors, thereby improving the efficiency of site-specific insertion of complete genes into cell chromosomes.

[0017] The difficulty of knocking large DNA fragments into recipient cells lies in the low conversion efficiency, the easy breakage of exogenous DNA, and the low purification efficiency of large DNA fragments from yeast cells. Therefore, this application uses yeast protoplast fusion technology. The large exogenous gene fragments in yeast are introduced into the recipient cells. This method has no restrictions on the size of the exogenous gene body and can avoid the breakage of the exogenous gene during the purification process (Brown, Chan et al. 2017).

[0018] The present application overcomes various problems existing in the process of site-specific integration of macromolecular DNA into chromosomal DNA through the above series of technical designs, such as poor transfection efficiency of macromolecular DNA, easy breakage of exogenous genes, poor site-specific integration efficiency, etc. Therefore, the method of the present application can efficiently and stably integrate exogenous DNA, especially large fragments of exogenous DNA, more particularly large fragments of exogenous DNA larger than 300 kb, into the genome at one time.

[0019] Specifically, 1. A method for integrating a target gene fragment comprises the following steps:

[0020] 1) obtaining a target gene fragment, wherein the length of the target gene fragment exceeds 100 kb;

[0021] 2) cloning the target gene fragment into a circular YAC vector, inserting a truncated neomycin (G418) resistance expression cassette 1 into the obtained vector containing the target gene fragment, wherein the expression cassette 1 contains a mutant Loxp1, i.e., Loxp66 sequence, a part of the HPRT intron, and a part of the resistance gene a, i.e., the 3' end part of the neomycin resistance gene Neo gene in the 5' to 3' direction;

[0022] 3) transforming the vector containing the target gene fragment into yeast cells;

[0023] 4) introducing the vector containing the target gene fragment in the yeast into a recipient cell, wherein the recipient cell is a eukaryotic cell, wherein a truncated neomycin (G418) resistance expression cassette 2 has been site-specifically introduced into the genome of the recipient cell, wherein the expression cassette 2 comprises a portion of the HPRT intron, a mutant Loxp 2, i.e., a Loxp71 sequence, a resistance gene b portion, i.e., a 5' end portion of the Neo gene, a fusion protein CreERT2 containing a mutant of the ligand binding region of the estrogen receptor (ER) (ERT2) and a Cre recombinase, and an IRES-PuroR structure in the 5' to 3' direction;

[0024] 5) Inducing the recombinase activity of CreERT2 by adding Tamoxifen, the Cre recombinase mediates the site-specific integration of the target gene fragment into the genome of the recipient cell, and at the same time, the expression cassette 1 and the expression cassette 2 form a resistance expression cassette that expresses the complete resistance gene neomycin;

[0025] 6) screening the recipient cells whose genomes have been site-specifically integrated with the target gene fragment,

[0026] wherein the mutant Loxp 1 in the truncated neomycin (G418) resistance expression cassette 1 in the step 2) and / or the mutant Loxp 2 in the truncated neomycin (G418) resistance expression cassette 2 in the step 4) are used to site-specifically introduce the expression cassette into the genome of the recipient cell,

[0027] The 3' end portion of the resistance gene part a (neomycin resistance gene Neo) contained in the resistance expression cassette 1 in step 2) and the 5' end portion of the resistance gene part b (neomycin resistance gene Neo) contained in the resistance expression cassette 2 in step 4) are functionally complementary.

[0028] The HPRT intron, resistance gene a part and Neo gene 3' end part contained in the resistance expression cassette 1 in step 2), the HPRT intron, resistance gene b part and Neo gene 5' end part contained in the resistance expression cassette 2 in step 4), and the resistance expression cassette Neomycin (G418) expressing the complete resistance gene formed in step 5) are used to screen cell recombinants after site-specific integration of the target gene fragment.

[0029] 2. The method according to item 1, wherein the 5' end portion of the Neo gene and the 3' end portion of the Neo are truncated at position 92,

[0030] In step 6), the antibiotic G418, which is specific to the resistance gene, is added to screen the recipient cells in which the target gene fragment is site-specifically integrated in the genome.

[0031] 3. The method according to item 2, wherein the 92nd amino acid of neomycin is encoded by the last nucleotide of the 5' end portion of the Neo gene and the start nucleotide of the 3' end portion of the Neo gene.

[0032] 4. According to the method of item 2, the 92nd amino acid of neomycin is encoded by the last two nucleotides of the 5' end of the Neo gene and the first nucleotide at the beginning of the 3' end of the Neo gene.

[0033] 5. The method according to any one of the preceding items, wherein in the vector containing the target gene fragment obtained in step 1), there is a FRT sequence upstream of the target gene fragment, and in the expression cassette in step 4), there is a FRT sequence downstream of the IRES-PuroR structure,

[0034] And after the step 6), the method further comprises the step 7): transferring the plasmid containing FLP into the recipient cell to remove the expression cassette.

[0035] 6. The method according to any one of the preceding items, wherein the target gene fragments in step 1) include prokaryotic and eukaryotic gene fragments.

[0036] 7. According to the method of item 1, the circular vector is obtained by homologous recombination splicing technology, or a combination of homologous recombination splicing technology and genome editing technology.

[0037] 8. The method according to item 7, wherein the circular vector is obtained by yeast transformation-coupled recombination (TAR) technology, or a combination of yeast transformation-coupled recombination (TAR) technology and genome editing technology.

[0038] 9. A method according to item 7 or 8, wherein the homologous recombination splicing technology is selected from one or more of the following: sequence-dependent in vitro assembly technology, yeast transformation-coupled recombination (TAR) technology and bacterial Red / ET homologous recombination technology.

[0039] 10. The method according to any one of the preceding items, wherein the target gene fragment in step 1) is obtained from a chromosome or another vector.

[0040] 11. A method according to any of the preceding items, wherein the target gene fragment in step 1) is obtained by cutting the chromosome or vector using genome editing technology.

[0041] 12. A method according to any of the preceding items, wherein in step 4), the expression cassette and its downstream large DNA fragment are site-specifically and stably introduced into the genome of the recipient cell by genome editing technology.

[0042] 13. A method according to any one of items 7, 8, 11 and 12, wherein the genome editing technology is selected from one or more of the following: zinc finger nuclease technology (ZFNs), transcription activator-like effector nuclease technology (TALENs) and clustered regularly interspaced short palindromic repeat (Clustered Regularly Interspaced Short Palindromic Repeat, CRISPR) technology, including CRISPR / Cas9 and CRISPR-Cpf1.

[0043] 14. The method according to any of the preceding items, wherein the yeast is Saccharomyces cerevisiae.

[0044] 15. The method according to any one of the preceding items, wherein in step 4), the vector containing the target gene fragment in the microorganism is introduced into a recipient cell using yeast protoplast fusion technology.

[0045] 16. The method according to any one of the preceding items, wherein the recipient cells in step 4) are non-human animal embryonic stem cells.

[0046] 17. A method according to any one of the preceding items, wherein the length of the target gene fragment exceeds 300 kb.

[0047] 18. A method according to any of the preceding items, wherein the length of the target gene fragment exceeds 400 kb.

[0048] Specifically, the present invention relates to the following aspects:

[0049] 1. A method for integrating a target gene fragment, comprising the following steps:

[0050] 1) Obtain the target gene fragment;

[0051] 2) cloning the target gene fragment into a vector, inserting a resistance expression cassette 1, preferably a truncated neomycin (G418) resistance expression cassette 1, into the obtained vector containing the target gene fragment, wherein the expression cassette 1 comprises a mutant Loxp 1, preferably a Loxp66 sequence, a part of the HPRT intron and a part of the resistance gene a, preferably a 3' end part of the neomycin resistance gene Neo gene in the 5' to 3' direction;

[0052] 3) transforming the vector containing the target gene fragment into microbial cells, preferably yeast, especially Saccharomyces cerevisiae cells;

[0053] 4) introducing the vector containing the target gene fragment in the microorganism into a recipient cell, wherein a resistance expression cassette 2, preferably a truncated neomycin (G418) resistance expression cassette 2, has been site-specifically introduced into the genome of the recipient cell, and the expression cassette 2 comprises a portion of the HPRT intron, a mutant Loxp 2, preferably a Loxp71 sequence, a resistance gene b portion, preferably a 5' end portion of the Neo gene, a fusion protein CreERT2 containing a mutant of the ligand binding region of the estrogen receptor (ER) (ERT2) and a Cre recombinase, and an IRES-PuroR structure in the 5' to 3' direction.

[0054] wherein the mutations in the mutant Loxp 1 and the mutant Loxp 2 are located at the 3' symmetric sequence and the 5' symmetric sequence of the wild-type Loxp site, or the 5' symmetric sequence and the 3' symmetric sequence of the wild-type Loxp site, respectively; the mutant Loxp 1 and the mutant Loxp 2 can both bind to Cre, and after step 4), form a Loxp sequence containing mutations at both ends, such as Loxp66 / 71;

[0055] Preferably, the loxp sequence with single-end mutation, mutant Loxp 1 and mutant Loxp 2, such as Loxp71 and Loxp66, does not affect the binding efficiency with Cre, but forms two loxp sequences after recombination, one of which is a wild-type Loxp sequence, and the other is a Loxp sequence with mutations at both ends, such as Loxp66 / 71, the latter of which reduces the binding efficiency with Cre compared to the wild-type Loxp sequence; it is known in the prior art that similar to the Loxp66 sequence, it is possible to recombine with loxp71 to form a double-end mutant Loxp structure including loxJTZ17, loxKR1, loxKR2, loxKR3, loxKR4, etc. These similar Loxp structures mediate recombination in different cells, and the efficiency of integration into chromosomes to form stable recombinants is slightly different. In addition, the efficiency of integration into chromosomes to form stable recombinants is affected by many factors, such as the cell line into which it is integrated. The Loxp66 / 71 structure of the present application has the highest efficiency in forming stable recombinants in the chromosomes of cells relative to these similar Loxp mutants, and thus has the highest efficiency in cloning large DNA fragments;

[0056] 5) inducing the recombinase activity of CreERT2, preferably by adding Tamoxifen to induce the recombinase activity of CreERT2, wherein the Cre recombinase mediates the site-specific integration of the target gene fragment into the genome of the recipient cell, and at the same time, the expression cassette 1 and the expression cassette 2 form an expression of a complete resistance gene, preferably a neomycin resistance expression cassette;

[0057] 6) Screening the recipient cells whose genomes have site-specifically integrated the target gene fragment.

[0058] 2. The method according to item 1, wherein the resistance gene part a contained in the resistance expression cassette 1 in the step 2), preferably the 3' end part of the neomycin resistance gene Neo, and the resistance gene part b contained in the resistance expression cassette 2 in the step 4), preferably the 5' end part of the Neo gene, are functionally complementary, and any single resistance expression cassette 1 or 2 cannot make the cell resistant, for example, the truncated neomycin (G418) resistance expression cassette 1 or 2 cannot make the cell produce neomycin resistance, and preferably, only the resistance gene part b and part a contained therein, such as the 5' end part and the 3' end part of the Neo gene, can express the neomycin resistance protein after being recombined in a certain order.

[0059] Preferably, the 5' end portion of the Neo gene and the 3' end portion of the Neo gene are truncated at position 92, more preferably, the 92nd amino acid of neomycin is co-encoded by the last nucleotide of the 5' end portion of the Neo gene and the starting nucleotide of the 3' end portion of the Neo gene, more preferably, the 92nd amino acid of neomycin is co-encoded by the last 2 nucleotides of the 5' end portion of the Neo gene and the first nucleotide at the beginning of the 3' end portion of the Neo gene. That is, the 5' end portion of the Neo gene expresses the amino acids of neomycin from positions 1 to 91, the 3' end portion of the Neo gene expresses the amino acids of neomycin from positions 93 to 267, and at the same time, the last 2 nucleotides of the 5' end portion and the first nucleotide at the beginning of the 3' end portion of the Neo gene co-encode the 92nd amino acid of neomycin,

[0060] In step 6), a reagent specific to the resistance gene, preferably the antibiotic G418, is added to screen the recipient cells in which the target gene fragment is site-specifically integrated in the genome.

[0061] 3. The method according to item 1 or 2, wherein in the vector containing the target gene fragment obtained in step 1), there is a FRT sequence upstream of the target gene fragment, and in the expression cassette in step 4), there is a FRT sequence downstream of the IRES-PuroR structure,

[0062] And after the step 6), the method further comprises the step 7): transferring the plasmid containing FLP into the recipient cell to remove the expression cassette.

[0063] 4. A method according to any of the preceding items, wherein the target gene fragment in step 1) comprises prokaryotic and eukaryotic gene fragments, preferably eukaryotic gene fragments, and its length is preferably more than 100 kb, preferably more than 300 kb, and more preferably more than 400 kb.

[0064] 5. The method according to any one of the preceding items, wherein the vector containing the target gene fragment obtained in step 2) is a circular BAC vector or genomic DNA.

[0065] 6. The method according to any one of the preceding items, wherein the vector in step 2) is a linearized vector, preferably a linearized vector having homologous end sequences of the cloned target DNA fragment, more preferably a linearized yeast shuttle vector.

[0066] 7. The method according to item 6, wherein the linearized vector is a YAC or TAR cloning vector.

[0067] 8. The method according to item 7, wherein the linearized vector is a YAC cloning vector, preferably a pTARYAC cloning vector.

[0068] 9. The method according to any one of items 1 to 5, wherein the vector containing the target gene fragment in step 2) is a BAC (bacterial artificial chromosome) or a PAC (P1 artificial chromosomes).

[0069] 10. The method according to item 5, wherein the circular vector is obtained by homologous recombination splicing technology (preferably yeast transformation-coupled recombination (TAR) technology), or a combination of homologous recombination splicing technology (preferably yeast transformation-coupled recombination (TAR) technology) and genome editing technology.

[0070] 11. A method according to item 10, wherein the homologous recombination splicing technology is selected from one or more of the following: sequence-dependent in vitro assembly technology (such as Gibson assembling, SLIC, LIC, etc.), yeast transformation-coupled recombination (TAR) technology and bacterial Red / ET homologous recombination technology, preferably yeast transformation-coupled recombination (TAR) technology.

[0071] 12. The method according to any one of the preceding items, wherein the target gene fragment in step 1) is obtained from a chromosome or another vector (preferably a BAC vector).

[0072] 13. A method according to any of the preceding items, wherein the target gene fragment in step 1) is obtained by cutting the chromosome or vector using genome editing technology.

[0073] 14. A method according to any of the preceding items, wherein in step 4), the expression cassette and its downstream large DNA fragment are site-specifically and stably introduced into the genome of the recipient cell by genome editing technology.

[0074] 15. A method according to item 10, 13 or 14, wherein the genome editing technology is selected from one or more of the following: zinc finger nuclease technology (ZFNs), transcription activator-like effector nuclease technology (TALENs) and clustered regularly interspaced short palindromic repeat (Clustered Regularly Interspaced Short Palindromic Repeat, CRISPR) technology, including CRISPR / Cas9 and CRISPR-Cpf1, preferably CRISPR / Cas9.

[0075] 16. The method according to one of the preceding items, wherein the yeast is Saccharomyces cerevisiae.

[0076] 17. The method according to any one of the preceding items, wherein in step 4) the vector containing the target gene fragment in the microorganism is introduced into a recipient cell using yeast protoplast fusion technology.

[0077] 18. The method according to any of the preceding items, wherein the resistance expression cassette 1 in the step 2), preferably the mutant Loxp 1 in the truncated neomycin (G418) resistance expression cassette 1 and / or the resistance expression cassette 2 in the step 4), preferably the mutant Loxp 2 in the truncated neomycin (G418) resistance expression cassette 2, is used to site-specifically introduce the expression cassette into the genome of the recipient cell.

[0078] 19. A method according to any of the preceding items, wherein the resistance expression cassette 1 in step 2), preferably the HPRT intron and resistance gene part a contained in the truncated neomycin (G418) resistance expression cassette 1, preferably the 3' end part of the Neo gene, and the resistance expression cassette 2 in step 4), preferably the HPRT intron and resistance gene part b contained in the truncated neomycin (G418) resistance expression cassette 2, preferably the 5' end part of the Neo gene, and the resistance expression cassette expressing the complete resistance gene formed in step 5), preferably the neomycin (G418) resistance expression cassette of neomycin Neo, are used to screen cell recombinants after site-specific integration of the target gene fragment.

[0079] 20. The method according to any one of the preceding items, wherein the recipient cell in step 4) is a eukaryotic cell, preferably a non-human animal embryonic stem cell.

[0080] In addition, in addition to using complementary truncated G418 gene resistance to screen recombinants with exogenous genes inserted at fixed positions, the present application can also use other resistance screening mechanisms known in the art. These commonly used resistance screening mechanisms or resistance genes can be, for example, puromycin, hygromycin, HPRT, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0081] Figure 1 .Shows the overall strategy for site-specific integration of large exogenous genes into the cell genome.

[0082] Figure 2 .Loxp71 / 66 mutants promote targeted integration of large circular DNA.

[0083] Figure 3.Schematic diagram of the site-specific integration of exogenous circular DNA into cell chromosomes.

[0084] Figure 4 .TAR-YAC-HygR-ΔNeoGFP-Loxp66 FRT plasmid map.

[0085] Figure 5 . PCR identification and electrophoresis results of vector TAR-IGL-Loxp66.

[0086] exist Figure 5 middle,

[0087] M represents 100 bp DNA ladder,

[0088] Lane 1 is the PCR product 1 at the junction of the vector TAR-Loxp66 end and IGL1.

[0089] Lane 2 is IGL1 internal PCR product 2,

[0090] Lane 3 is the PCR product 3 at the junction of IGL1 and IGL2.

[0091] Lane 4 is IGL2 internal PCR product 4,

[0092] Lane 5 is the PCR product 5 at the junction of IGL2 and IGL3.

[0093] Lane 6 is IGL3 internal PCR product 6, and

[0094] Lane 7 is the PCR product 7 at the end junction of IGL3 and vector TAR-Loxp66.

[0095] Figure 6 . Primer sequences used to identify TAR-IGL-Loxp66.

[0096] Figure 7 .CRISPR / Cas9 technology-mediated gene knock-in.

[0097] Figure 8 .Identification of genetically modified recipient cells.

[0098] Fig. 9 . Identification of site-specific insertion of large fragments of IGL.

[0099] Fig.10. Schematic diagram of the nucleotide sequence and amino acid sequence of the 5' end portion of the Neo gene in the truncated neomycin (G418) resistance expression cassette 2 and the 3' end portion of the neomycin resistance gene Neo contained in the truncated neomycin (G418) resistance expression cassette 1. In the figure, the 5' end portion of the Neo gene and the 3' end portion of the Neo gene are truncated at position 92, the 5' end portion of the Neo gene expresses the amino acids from positions 1 to 91 of neomycin, and the 3' end portion of the Neo gene expresses the amino acids from positions 93 to 267 of neomycin, and at the same time, the last 2 nucleotides of the 5' end portion and the first nucleotide at the beginning of the 3' end portion of the Neo gene jointly encode the 92nd amino acid R of neomycin. Fig.10 In the figure, the unshaded part at the top shows the nucleotide sequence corresponding to the amino acid sequence of neomycin from position 1 to position 91 expressed by the 5' end of the Neo gene, and the gray-shaded part at the bottom shows the nucleotide sequence corresponding to the amino acid sequence of neomycin from position 93 to position 267 expressed by the 3' end of the Neo gene. At the same time, the black-shaded part shows the 92nd amino acid R, which is jointly encoded by the last two nucleotides AG at the 5' end and the first nucleotide G at the beginning of the 3' end of the Neo gene. DETAILED DESCRIPTION

[0100] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

[0101] All patents, published patent applications, other publications, and sequences from GenBank and other databases mentioned herein are incorporated by reference in their entirety with respect to related technologies. Unless otherwise noted, the implementation of the provided embodiments will employ conventional techniques of molecular biology, etc., which are within the skill of those skilled in the art. These techniques are fully explained in the literature. See, e.g., Molecular Cloning: A Laboratory Manual, (J. Sambrook et al., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1989); Current Protocols in Molecular Biology (F. Ausubel et al., eds., 1987 and latest); Essential Molecular Biology (Browned., IRL Press 1991); Gene Expression Technology (Goeddel, ed., Academic Press 1991); Methods for Cloning and Analysis of Eukaryotic Genes (Bothwell et al., eds., Bartlett Publ. 1990); Gene Transfer and Expression (Kriegler, Stockton Press 1990); Recombinant DNA Methodology (R. Wu et al., eds., Academic Press 1989); PCR: A Practical Approach (M. McPherson et al., IRL Press at Oxford University Press 1991); Cell Culture for Biochemists (R. Adams, ed., Elsevier Science Publishers 1990); Gene Transfer Vectors for Mamalian Cells (Miller & M. Calos, ed., 1987); Mammalian Cell Biotechnology (M. Butler, ed., 1991); Animal Cell Culture (Pollard et al., ed., Humana Press 1990); Culture of Animal Cells, 2nd Ed. (Freshney et al., ed., Alan R. Liss 1987).

[0102] As used herein, "a" or "an" means "one", "at least one" or "one or more".

[0103] As used herein, "restriction endonuclease site" refers to a target nucleic acid sequence that is recognized and cleaved by a restriction enzyme. Restriction enzymes are well known in the art.

[0104] As used herein, the term "target gene fragment" refers to a target DNA fragment to be cloned, which can be a genomic fragment or an artificially synthesized exogenous fragment, or a complete gene.

[0105] The term "genome" includes naturally occurring genomes and synthetic genomes, and includes genetically modified genomes, such as genomes that did not exist in the laboratory and nature before, including modified genomes and hybrid genomes containing nucleic acids and / or partial genomes from more than one species. The term "genome" includes organelle genomes (e.g., mitochondrial and chloroplast genomes), genomes (cellular genomes) of self-replicating organisms, including prokaryotes and eukaryotes, fungi, yeasts, bacteria (e.g., mycoplasmas), archaea, vertebrates, mammals and other organisms, and viral genomes and other genomes that rely on host proliferation. Genomes also include those of organisms and synthetic organisms that do not fall into any known Linnaean classification. Exemplary genomes can be microbial genomes, such as genomes of unicellular organisms including bacteria and yeast.

[0106] As mentioned above, the prior art lacks a method for site-specific integration of large genomic DNA fragments of more than 300 kb into the genome.

[0107] In order to solve this problem, the present invention has established a method for efficiently and stably integrating genes larger than 300 kb, especially eukaryotic genes, into the genome. Compared with the prior art, the method of the present application can not only stably integrate large exogenous DNA fragments, such as larger than 300 kb, into the genome, but also improve the efficiency of site-specific integration.

[0108] As mentioned above, large-scale DNA modification of the cell genome, especially the site-specific integration of large fragments of exogenous DNA into the genome, has always been a difficult problem in current biotechnology. The main technical difficulties of site-specific integration include the following aspects: 1. How to clone large fragments of exogenous DNA into gene vectors; 2. How to completely introduce vectors containing exogenous DNA into eukaryotic cells; 3. How to efficiently site-specifically integrate large fragments of exogenous DNA into the genome of recipient cells; 4. How to efficiently screen and detect site-specific integrated recombinant cell clones.

[0109] For the above four technical difficulties, this application has been designed so that the exogenous DNA can be integrated into the genome efficiently and stably. The details are as follows:

[0110] Regarding 1): How to clone large fragments of foreign DNA into gene vectors

[0111] Because carriers, especially gene carriers, such as YAC carriers, have strong homologous recombination properties that help large fragments of exogenous DNA to recombine in cells. Meanwhile, considering that YAC carriers can accommodate up to 2000kb of exogenous DNA fragments, the present application selects YAC as a carrier for loading exogenous genes. Traditional YAC carriers are linear structures, unstable in cells, prone to breakage and random recombination. To this end, the present application utilizes YAC carriers to load large fragments of DNA into circular YAC carriers, thereby improving the efficiency of complete gene site-specific insertion into cell chromosomes.

[0112] In one embodiment, a circular YAC vector containing a target gene fragment is obtained by homologous recombination splicing technology, or a combination of homologous recombination splicing technology and genome editing technology. In a preferred embodiment, a linear YAC vector is cyclized into a circular closed YAC vector using homologous recombination splicing technology, such as yeast transformation-associated recombination (TAR) technology. In another preferred embodiment, homologous recombination splicing technology and genome editing technology, such as Crispr / Cas9 method and TAR technology, are used in combination to edit gene fragments in multiple BAC vectors into multiple linear DNA segments with homologous ends, and the homologous recombination characteristics of Saccharomyces cerevisiae are used to splice them into a circular YAC vector in its cells. For specific methods, please refer to Chinese Patent Application No. 201811238618.6.

[0113] Sequence-dependent recombinant splicing techniques include sequence-dependent in vitro assembly techniques (such as Gibson assembling, SLIC, LIC, etc.), yeast transformation-coupled recombination (TAR) technology and bacterial Red / ET homologous recombination technology, which are cloned into some gene vectors, such as BAC (bacterial artificial

[0114] chromosome), YAC (Yeast artificialchromosomes) and PAC (P1 artificial

[0115] chromosomes).

[0116] Yeast includes Saccharomyces cerevisiae and other yeast species such as Saccharomyces pombe as host cells, which can be used to clone ultralong genomic DNA. Due to their unique genetic manipulation tool set, yeast hosts are particularly suitable for operating donor genomic materials. The natural ability of yeast cells and decades of research have produced a rich tool set for operating DNA in yeast. These advantages are well known in the art. For example, yeast, with their rich genetic system, can assemble and reassemble nucleotide sequences by homologous recombination, which is an ability that many easily available organisms do not have. Yeast, such as Saccharomyces cerevisiae, has an efficient homologous recombination mechanism, and homologous recombination can be accurately and effectively performed between two DNA molecules as long as there is a homologous segment of more than 60bp (Noskov, Koriabine et al. 2001). Yeast cells can be used to clone larger DNA that cannot be cloned into other organisms, for example, whole cells, organelles and viral genomes. Therefore, an embodiment of the described method utilizes the huge ability of yeast inheritance, and promotes synthetic biology and synthetic genomics by using yeast as a host cell for operating difficult and other biological genomes and synthetic genomes.

[0117] In addition, yeast, especially Saccharomyces cerevisiae, has great advantages as a host cell for cloning DNA fragments. For example, yeast has strong recombinase activity and can connect up to 25 overlapping DNA fragments to vector DNA at a time (Gibson, Benders et al. 2008), so it has the ability to take in multiple DNAs. At the same time, the homologous recombination ability of yeast can effectively assemble multiple DNA fragments into a single recombinant.

[0118] In addition, yeast artificial chromosomes (YAC) contain centromeres that can support the replication of at least 2 Mb of eukaryotic unstable DNA (Kouprina, Leem et al. 2003). Large prokaryotic DNA fragments can be cloned in yeast using a universal genetic code. Toxic gene expression is generally not an obstacle to cloning donor nucleic acids in yeast. For example, studies of bacterial and archaeal genomes indicate that proteins expressed from cloned genomes pose little risk of harm to yeast hosts because eukaryotes use different protein expression machinery than these bacteria. Transcription signals in yeast are different from transcription and translation in bacteria. In fact, most prokaryotic genes are likely not expressed in yeast. There are no restriction barriers in yeast. If there are barriers, then it may be a replication barrier rather than a gene expression barrier. Genotoxicity is minimized because gene expression regulation in eukaryotes such as yeast is different from that in prokaryotes. Moreover, mycoplasmas use the codon UGA as tryptophan rather than as a translation termination signal. Therefore, most mycoplasma genes, if expressed, will produce truncated proteins in yeast. This largely avoids the possibility of toxic gene products.

[0119] Therefore, the present application uses YAC vectors in yeast cells to load large DNA fragments into circular YAC vectors based on the efficient DNA homologous recombination mechanism unique to yeast, thereby improving the efficiency of site-specific insertion of complete genes into cell chromosomes.

[0120] Regarding 2): How to completely introduce a vector containing a large fragment of foreign gene into eukaryotic cells

[0121] The difficulty of targeted knock-in of large DNA fragments into recipient cells lies in the low transformation efficiency and the easy breakage of exogenous DNA. In addition, the efficiency of purifying large DNA fragments from yeast cells in vitro is very low. At the same time, ordinary DNA transfection methods also have limitations on the size of DNA.

[0122] As an improvement, the present application adopts the yeast protoplast fusion method to introduce large fragments of exogenous genes in yeast into recipient cells. Under the mediation of PEG, yeast spheroplasts can fuse with cells, and large fragments of DNA are introduced into recipient cells. This method has no restrictions on the size of exogenous genes and can avoid the breakage of exogenous genes during the purification process (Brown, Chan et al. 2017).

[0123] The process of large fragment exogenous gene transformation and site-specific integration into the cell genome is shown in the figure of the specification. Figure 1 .

[0124] Regarding 3) how to efficiently integrate large fragments of exogenous genomic DNA into the genome of the recipient cell;

[0125] The present application utilizes the improved recombinase system Cre / Loxp, that is, utilizing the Loxp71 / 66 mutant to stably and irreversibly integrate exogenous DNA into the genome of the recipient cell.

[0126] Using traditional recombinase systems, such as Cre / Loxp, FLP / FRT and phiC31-att, circular vectors can be inserted into cell chromosomes (Ohtsuka, Miura et al. 2012). However, there is no report that the above recombinases can integrate exogenous circular genes of more than 300kb into the cell genome at one time. Since the Cre / Loxp and FLP / FRT systems mediate reversible enzymatic reactions, when large molecular circular DNA is recombined into chromosomes, the DNA cleavage reaction mediated by the recombinase is much larger than the site-specific integration reaction. This leads to the fact that the larger the exogenous molecule, the lower the efficiency of the stable recombinant obtained. Although the phiC31-att recombination system can mediate irreversible recombination reactions between DNA fragments, the activity of phiC31 is lower than that of the Cre recombinase, so it is not the preferred solution for mediating large molecular DNA recombination. Among the above recombinase systems, the Cre / Loxp system has the highest catalytic efficiency and is the most commonly used, so this application considers using the Cre / Loxp system to mediate the recombination of large fragments of DNA.

[0127] Cre-Lox recombination is a site-specific recombinase technology used to perform deletion, insertion, transposition and inversion operations at specific sites in cell DNA. The Loxp site consists of a special 34bp sequence, in which the middle 8bp DNA base is an asymmetric sequence that determines the direction of the Loxp sequence. On both sides of the asymmetric sequence are two 13bp reverse symmetric sequences that determine the binding efficiency with Cre.

[0128] Although conventional Cre-Lox recombination can catalyze the site-specific integration of foreign genes, it was found in initial experiments that the wild-type Loxp sequence failed to stably integrate large molecular DNA into cell chromosomes. This may be because the recombination reaction dependent on the Loxp sequence catalyzed by Cre is reversible, that is, reverse recombination or deletion may occur between Loxp sites, so the recombination between wild-type Loxp sites cannot effectively mediate the stable site-specific integration of large molecular DNA into cell chromosomes.

[0129] Although the introduction of heterologous Loxp sequences (such as Loxp and Loxp2272) at the sites on both sides of the DNA fragment can mediate recombination between homologous Loxp sites (Loxp and Loxp, Loxp2722 and Loxp2722), thereby mediating the directional insertion of foreign DNA into chromosomes. However, the efficiency of Cre-lox recombination is greatly reduced as the length of its insertion increases. This scheme may be used for the site-specific insertion of some large molecular DNA, but it is not the preferred scheme.

[0130] In this regard, in one embodiment, the present application uses tamoxifen to induce recipient cells, such as non-human ES cells, to express Cre recombinase. When one end of the symmetric sequence in the Loxp sequence is mutated, that is, mutant Loxp 1, preferably Loxp71 (mutation in the 5' end symmetric sequence) and mutant Loxp 2, preferably Loxp66 (mutation in the 3' end symmetric sequence).

[0131] Meanwhile, the mutations in the mutant Loxp 1 and the mutant Loxp 2 are respectively located at the 3' symmetric sequence and the 5' symmetric sequence of the wild-type Loxp site, or the 5' symmetric sequence and the 3' symmetric sequence of the wild-type Loxp site, and the mutant Loxp 1 and the mutant Loxp 2 can both bind to Cre, and after the step 4), form a Loxp sequence containing mutations at both ends, such as Loxp66 / 71;

[0132] Preferably, the loxp sequence with single-end mutation, mutant Loxp 1 and mutant Loxp 2, such as Loxp71 and Loxp66, does not affect the binding efficiency with Cre, but forms two loxp sequences after recombination, one of which is a wild-type Loxp sequence and the other is a Loxp sequence containing mutations at both ends, such as Loxp66 / 71, the latter of which has reduced binding efficiency with Cre compared to the wild-type Loxp sequence;

[0133] It is known in the prior art that sequences similar to Loxp66 may be recombined with loxp71 to form double-terminal mutant Loxp structures, including loxJTZ17, loxKR1, loxKR2, loxKR3, loxKR4, etc. These similar Loxp structures mediate recombination in different cells, and the efficiency of forming stable recombinants by stable integration into chromosomes is slightly different. In addition, the efficiency of integration into chromosomes to form stable recombinants is affected by many factors, such as the cell line into which it is integrated. The Loxp66 / 71 structure of the present application has the highest efficiency in forming stable recombinants in the chromosomes of cells relative to these similar Loxp mutants, and therefore has the highest efficiency in cloning large DNA fragments.

[0134] In a preferred embodiment, the single-end mutated loxp sequence, mutant Loxp 1 and mutant Loxp 2, preferably Loxp71 and Loxp66, do not affect the binding efficiency with Cre, but form two loxp sequences after recombination, one of which is a wild-type Loxp sequence, and the other is a Loxp sequence containing mutations at both ends, preferably Loxp66 / 71, the latter of which has reduced binding with Cre compared to the wild-type Loxp sequence.

[0135] After recombination, the circular DNA can be inserted into the chromosome at a fixed point and produce wild-type Loxp sites and Loxp 1 / 2 mutants, such as Loxp71 / 66 mutants, on both sides of the inserted fragment. Because the symmetrical sequences at both ends of the Loxp 1 / 2 mutant, preferably the Loxp71 / 66 mutant, are mutated, its binding ability with Cre is greatly reduced, so Cre cannot effectively catalyze the reverse recombination of the Loxp 1 / 2 mutant, preferably the Loxp71 / 66 mutant, resulting in a large fragment of circular DNA that can be stably and irreversibly integrated into the cell chromosome. In other words, the Loxp 1 / 2 mutant, preferably the Loxp71 / 66 mutant, avoids the reverse recombination reaction between the wild-type Loxp and the Loxp 1 / 2 mutant, preferably the Loxp71 / 66 mutant, resulting in the stable and irreversible integration of the exogenous DNA into the cell chromosome, thereby enhancing the stability of the inserted gene.

[0136] As shown in the examples of this application, the wild-type Loxp site cannot effectively mediate the stable site-specific integration of large circular DNA into chromosomes through Cre. The working principle of Loxp71 / 66 mutants promoting the directional integration of large molecular circular DNA can be found in the attached drawings of the specification. Figure 2 .

[0137] Therefore, the present application discovered for the first time that mutant Loxp, such as Loxp71 / 66 mutant rather than wild-type Loxp, helps to efficiently and stably integrate large DNA fragments into the cell genome.

[0138] At the same time, the present application has found through experiments that the Loxp double mutation Loxp66 / 71 is the most preferred solution for mediating the stable site-specific integration of large molecular DNA into cell chromosomes. Compared with wild-type Loxp, or Loxp containing one mutation, such as Loxp / Loxp66 or Loxp / Loxp71, or Loxp double mutation containing other mutation positions, loxp66 / 71 has the best effect and the highest conversion efficiency, and can most effectively and stably integrate large molecular DNA into cell chromosomes, and is most suitable for site-specific integration and cloning of large fragments of DNA.

[0139] Regarding 4) How to efficiently screen and detect site-specific integrated recombinant cell clones.

[0140] Once the target gene fragment is site-directedly integrated into the genome of the recipient cell, the recipient cell needs to be screened. To this end, the vector generally includes any DNA elements (e.g., replication origins) required to promote vector replication in one or more desired cell types and selection and / or resistance markers for different cell types.

[0141] Resistance markers are well known. The technician can determine suitable resistance markers for different host / donor combinations. In some cases, it is desirable to use non-clinically relevant markers. In other cases, the selection of resistance markers depends on the properties of the donor, host and / or recipient cells.

[0142] For the present application, in order to efficiently screen recombinants that are site-integrated into chromosomes, the present application also designs expression cassettes of the functionally complementary and truncated resistance gene neomycin (NeoR) after the Loxp sites of DNA and chromosomes, respectively. Only recombinants with foreign genes inserted at fixed positions can express resistance to the G418 drug, while randomly integrated DNA fragments cannot produce drug resistance. Therefore, this expression cassette can be used to identify the site-specific insertion of foreign genes. Any single truncated neomycin (G418) resistance expression cassette cannot cause cells to produce neomycin resistance. Preferably, only the 5' end portion and the 3' end portion of the Neo gene contained therein can express neomycin resistance protein after being recombined in a certain order.

[0143] In a preferred embodiment, the 5' end portion of the Neo gene and the 3' end portion of the Neo are truncated at position 92. More preferably, the 92nd amino acid of neomycin is co-encoded by the last nucleotide of the 5' end portion of the Neo gene and the starting nucleotide of the 3' end portion of the Neo gene. In a specific embodiment, the 92nd amino acid of neomycin is co-encoded by the last 2 nucleotides of the 5' end portion of the Neo gene and the first nucleotide at the beginning of the 3' end portion of the Neo gene. That is, the 5' end portion of the Neo gene expresses the amino acids of neomycin from positions 1 to 91, the 3' end portion of the Neo gene expresses the amino acids of neomycin from positions 93 to 267, and at the same time, the last 2 nucleotides of the 5' end portion and the first nucleotide at the beginning of the 3' end portion of the Neo gene co-encode the 92nd amino acid of neomycin.

[0144] At the same time, a CreERT2-IRES-PuroR structure was designed upstream of the NeoR expression cassette. CreERT2 is a fusion protein containing a mutant of the ligand binding region of the estrogen receptor (ER) (ERT2) and the Cre recombinase. In the absence of Tamoxifen induction, Cre-ERT2 is inactive in the cytoplasm. After Tamoxifen induction, the metabolite of Tamoxifen, 4-OHT (estrogen analog), binds to ERT, allowing Cre-ERT2 to enter the nucleus and exert Cre recombinase activity. The IRES-PuroR structure is used to screen positive clones of gene knock-in.

[0145] In addition, the present application uses the FLP / FRT system to remove the vector sequence and the G418 resistance expression cassette. As the foreign gene is inserted into the chromosomal genome, the cell will express some unnecessary selective genes, such as HygR, NeoR and PuroR. The present application utilizes FLP / FRT recombination to delete these selective genes. After the foreign gene is integrated into the Loxp71 site of the recipient cell chromosome, the NeoR-CreERT2-IRES-PuroR sequence can be deleted by the FLP recombinase that the FRT sequence depends on.

[0146] In addition, in addition to using complementary truncated G418 gene resistance to screen recombinants with exogenous genes inserted at fixed positions, the present application can also use other resistance screening mechanisms known in the art. These commonly used resistance screening mechanisms are, for example, puromycin, hygromycin, HPRT, etc.

[0147] The present application provides the following examples to help understand the present invention, and the true scope of the present invention is given in the appended claims. It should be understood that the given method can be modified without departing from the spirit of the present invention.

[0148] Example: Site-specific integration of a portion of the human Lambda light chain locus (IGL) into non-human embryonic stem cells (non-human ES cells)

[0149] 1. Preparation of YAC vectors containing large fragments of foreign DNA

[0150] According to the previously reported DNA macromolecular cloning method (Chinese patent application No. 201811238618.6), the 340 kb partial human IGL locus (GRCh37 / hg19chr22: 22,377,297-22,717,584) was cloned into the linear TAR cloning shuttle vector TAR-YAC-HygR-ΔNeoGFP-Loxp 66FRT (i.e., TAR-Loxp 66, see the accompanying drawings in the specification) Figure 4 ) and TAR-YAC-HygR-ΔNeoGFP-WT Loxp FRT (i.e., TAR-WT Loxp). Vectors TAR-Loxp 66 and TAR-WT Loxp were obtained by DNA synthesis. The TAR-Loxp 66 sequence (full name: TAR-YAC-HygR-ΔNeoGFP-Loxp 66FRT sequence) is SEQ ID NO: 25, see sequence table. The difference between vectors TAR-WT Loxp and TAR-Loxp 66 is that the Loxp 66 sequence (ATAACTTCGTATAATGTATGC TATACGAACGGTA) of the TAR-Loxp 66 vector is replaced by the WT Loxp sequence (ATAACTTCGTATAATGTATGC TATACGAAGTTAT).

[0151] The 340kb template sequence of the partial human IGL locus is derived from the BAC vectors RP11-685C18, RP11-890G10 and RP11-373H24. According to the patented method (Chinese patent application number 201811238618.6), the above BAC vector is digested in vitro using the Crispr / Cas9 method, and then the linearized DNA fragment is cloned into the pTARYAC vector using the TAR cloning technology. The recombinant pTARYAC vector can be amplified and purified in bacteria. After the vector was purified in large quantities by I-SceI digestion, three DNA fragments were obtained, namely DNA fragment IGL1, 38kbp (GRCh37 / hg19Chr22: 22377208-22415482); DNA fragment IGL2, about 155kb (GRCh37 / hg19 Chr22: 22415353-22571119) and DNA fragment IGL3, 147kb (GRCh37 / hg19 Chr22: 22570833-22718740). There was a homologous recombination sequence of about 100bp between the above digested DNA products.

[0152] Linearized TAR-WT Loxp and TAR-Loxp 66 were prepared by digestion with ApaI and PAC I and DNA gel purification. The ends of linearized TAR-WT Loxp and TAR-Loxp 66 contained the terminal homologous sequences of DNA fragment IGL1 and DNA fragment IGL3, respectively. The digested DNA fragments IGL1, IGL2, IGL3 and linearized TAR-WT Loxp or TAR-Loxp66 were transformed into Saccharomyces cerevisiae by TAR cloning method to obtain a circular vector containing a 340 kb human IGL locus that can be used for gene integration.

[0153] The specific test operation is as follows:

[0154] Referring to the method listed in the patent application (Chinese patent application number 201811238618.6), 100 ng of DNA fragment IGL1 (GRCh37 / hg19 Chr22: 22377208-22415482), 100 ng of DNA fragment IGL2 (GRCh37 / hg19Chr22: 22415353-22571119), and 100 ng of DNA fragment IGL3 (GRCh37 / hg19 Chr22: 22570833-22718740) were mixed with 100 ng of linearized vectors TAR-WT Loxp and TAR-Loxp 66, and the DNA fragments were transformed into competent yeast cells AB using the yeast protoplasm fusion method (Kouprina and Larionov 2008).

[0155] 1380 (ATCC, Cata: 20843).

[0156] The yeast protoplasm fusion method is briefly as follows:

[0157] Yeast cell culture was harvested overnight and then washed with 1M sorbitol. Cells were transformed into spheroplasts by treatment with ZymolyaseTM and β-mercaptoethanol in the presence of 1M sorbitol. The spheroplasts were washed with sorbitol and resuspended in a buffer containing sorbitol and CaCl2. 200μl of competent yeast equivalent to 5ml of the original yeast culture was mixed with 100ng of the linearized vector and 100ng of the RP11-890G10 digest. Incubate at 30°C for 30 minutes and then heat shock in a 42°C water bath for 20-25 minutes. Centrifuge at 6000-8000r / min for 15 seconds and remove the transformation mixture with a micropipette. 1.0ml of YPD liquid medium (Sigma Cata#Y1375) was added to each reaction tube, and the precipitated cells were gently suspended with a micropipette and cultured overnight at 30°C.

[0158] On the second day, 200 μl of the transformation mixture was evenly spread on YPD solid medium containing 0.2 mg / mL Hygromycin B for culture. After 48 hours, the positive clones were picked and amplified to grow in YPD liquid medium containing Hygromycin B. Yeast DNA was extracted using a kit (Yeast DNA Kit, D3370-01), and positive clones were identified by PCR. Complete recombinants were identified using different PCR primers. Finally, two recombinants were obtained, namely TAR-IGL-HygR-ΔNeoGFP-Loxp 66 (ie, TAR-IGL-Loxp 66) and TAR-IGL-HygR-ΔNeoGFP-WTLoxp (ie, TAR-IGL-WTLoxp). The electrophoresis identification results of the ligation product, i.e., the vector TAR-IGL-Loxp66PCR, can be found in the attached figure of the specification. Figure 5 For primer sequences, see the attached figure in the specification. Figure 6 .

[0159] 2. Genetic modification of recipient cells

[0160] In order to integrate exogenous genes into specific locations on host cell chromosomes, the host cell chromosomes need to be genetically modified.

[0161] Considering the advantages of CRISPR / Cas9 technology, such as short cycle and high efficiency, this application uses this technology to clone specific sites of non-human embryonic stem cells (non-human ES cells).

[0162] Chr16:19046551-19048556 (NCBI37 / mm9) was inserted into the expression cassette containing CreERT2 and 5'NeoR. The working principle is shown in the figure of the specification. Figure 7 .

[0163] Specifically, a guide RNA was designed near the insertion site (Chr16: 19046551-19048556 (NCBI37 / mm9)). Its recognition target sequence is

[0164] TTGGCTACAATAGCCAATGC / CGG, wherein the CGG at the 3' end is the PAM sequence. Non-human ES cells (EDJ#22) were purchased from ATCC (ATCC, cat: SCRC-1021) and are 129S5 / SvEvTac-derived non-human ES cell lines.

[0165] The inserted gene structure is: Loxp71-hprt intron-5'Neo-PGKpromoter-rBGpA-EF1apromoter-CreERT2-IRES-puro-FRT, and its sequence is shown in the sequence table. The Loxp 71 sequence is used to mediate the site-specific integration of foreign genes. Upstream of the Loxp 71 site is a truncated NeoR resistance expression cassette. After the foreign gene is inserted into the Loxp71 site, a complete NeoR expression cassette can be formed. This newly formed resistance expression cassette can be used to identify the site-specific insertion of foreign genes.

[0166] A CreERT2-IRES-PuroR structure was also designed upstream of the NeoR expression cassette. CreERT2 is a fusion protein containing a mutant of the ligand binding region of the estrogen receptor (ER) (ERT2) and the Cre recombinase. In the absence of Tamoxifen induction, Cre-ERT2 is inactive in the cytoplasm. After Tamoxifen induction, the metabolite of Tamoxifen, 4-OHT (estrogen analog), binds to ERT, allowing Cre-ERT2 to enter the nucleus and exert Cre recombinase activity. The IRES-PuroR structure is used to screen positive clones with gene insertion. After the exogenous gene is integrated into the Loxp 71 site of the chromosome, the NeoR-CreERT2-IRES-PuroR sequence can be deleted by the FRT sequence-dependent FLP recombinase.

[0167] In this embodiment, the 5' end portion of the Neo gene and the 3' end portion of the Neo are truncated at position 92, the 5' end portion of the Neo gene expresses the amino acids of neomycin from positions 1 to 91, the 3' end portion of the Neo gene expresses the amino acids of neomycin from positions 93 to 267, and the 92nd amino acid R is jointly encoded by the last two nucleotides AG of the 5' end portion and the first nucleotide G at the beginning of the 3' end portion of the Neo gene.

[0168] In order to insert the above gene structure into the host cell genome, a 1014 bp 5' recombination arm was cloned upstream of the insertion sequence (Loxp71-5'NeoR-CreERT2-IRES-PuroR-FRT), whose sequence is located at chr16:19046411-19047425 (NCBI37 / mm9). A 1087 bp 3' recombination arm was cloned downstream, whose sequence is located at NCBI37 / mm9

[0169] chr16:19047426-19048512(NCBI37 / mm9).

[0170] The specific test methods are as follows:

[0171] A. Preparation of Cas9 ribonucleoprotein complex (RNP): According to the template sequence (ttggctacaatagccaatgc / cgg), CrRNA of the sequence was synthesized by chemical synthesis (IDTdna company). In addition to the 20nt specific sequence of the target site, CrRNA also contains 16nt complementary sequence for fusion of tracrRNA. Denature 10μM CrRNA and 10μM TracrRNA (IDTdna cata: 1072534) at 95℃ for 5min. Then cool to room temperature. Add equimolar Cas9 Nuclease V3, (IDTdna cata: 1081058), use PBS as buffer, the reaction solution volume is 20ul, and incubate at 25℃ for 20min to form RNP.

[0172] B. 20 μl of RNP and 100 ng of linear template DNA (Loxp71-5′NeoR-CreERT2-IRES-PuroR-FRT) were mixed in an ice bath for 10 min.

[0173] C. 3x 105 non-human ES cells and 20ul RNP were mixed with DNA template and electrotransfected in an electroporation cup (BioRad, cata: 1652081). Electrotransfection conditions: 1200 volts, pulse interval 30 milliseconds. After electrotransfection, non-human ES cells diluted with culture medium were cultured in a 10 cm culture dish in the presence of trophoblast cells (Sigmaaldrich Cata: PMEF-CFX). The culture medium and culture conditions of non-human ES cells refer to the instructions of ATCC for this cell line.

[0174] D. After continuing to culture the non-human ES cells for 48 hours, add 1 ug / ml Puromycin (Thermofisher Cata: A1113802) to the culture medium and continue to culture for 7 days.

[0175] E. Pick a monoclonal non-human ES cell and transfer it to a 48-well culture plate for further growth. After 3 days, use a pipette tip to break up the non-human ES cells, half of which are used to extract genomic DNA, and the other half are frozen in a 48-well cell culture plate for later use.

[0176] F. Design primers at the junction of the 5' and 3' ends of the inserted fragment and the insertion site, and use the PCR method to screen the genomic DNA with the expression cassette integrated at the site. The primer sequences are as follows: Insert5F: GCAGTCTGCACTCTCTGTGG; Insert 5R: tcgagggacctaTACCGTTC; Insert3F: cgtgacatgtgagcaaaagg; Insert 3R: GGAACCTTTCCCCCATAAAA. The primer design principle and screening results are shown in the attached figure of the specification. Figure 8 . PCR identification showed that 15 of the 28 clones were PCR negative, 9 clones were positive at both the 5' and 3' ends of the inserted fragment, and a few clones were PCR positive at only one end. The results showed that using CRISPR / Cas9 technology, the proportion of exogenous DNA inserted into recipient cells reached 30%. The genetically modified non-human ES clone was named ES 5'Neo-Loxp 71.

[0177] Using the same strategy, the present application prepared another non-human ES clone, the inserted gene structure was WT-Loxp-hprtintron-5'Neo-PGKpromoter-rBGpA-EF1a-CreERT2-IRES-

[0178] The modified non-human ES clone was named ES 5'Neo-WTLoxp.

[0179] 3. Yeast Spheroplast-Mediated Cell Fusion Technology

[0180] The difficulty of inserting large DNA fragments into recipient cells is that the traditional methods, such as liposome transfection, electroporation, etc., have low conversion efficiency, and the exogenous DNA in the form of linear large fragments is easy to break. At the same time, the efficiency of purifying large DNA fragments from yeast cells is very low. In this regard, the present application uses yeast spheroplast fusion technology. Under the mediation of PEG, yeast spheroplasts can fuse with cells to introduce large DNA fragments into recipient cells. Although it is reported in the prior art that yeast spheroplast-mediated cell fusion can be used to mediate the introduction of YAC containing large DNA fragments into recipient cells, this introduction is mostly random chromosome insertion, rather than fixed-point insertion. At the same time, linear YAC vectors are easily degraded or broken in cells. In this regard, the present application has been improved. The present application splices YAC vectors into circular YAC vectors, and at the same time, large DNA fragments are loaded into circular YAC vectors, thereby improving the efficiency of complete gene fixed-point insertion into cell chromosomes. In addition, in order to maintain the multifunctionality of non-human ES cells after protoplast fusion, we also selected non-human embryonic stem cells (non-human ES cells) with 129S5 / Sv as the genetic background. Non-human ES cells with this genetic background are less likely to differentiate when cultured in vitro than non-human ES cells with other genetic backgrounds.

[0181] Specific steps:

[0182] A. Preparation of yeast protoplasts:

[0183] The yeast solution loaded with large fragment IGL (carrying TAR-IGL-Loxp 66 gene) was added to YPD (Sigma, Cata: Y1375) medium containing 0.2mg / mL Hygromycin and shaken at 30℃ overnight. The next day, the bacterial solution was diluted 10 times with YPD medium and continued to shake for 3-4 hours until the OD600 value was 2.0-3.0. The yeast was then collected by centrifugation at 2500g for 15min. The yeast cell pellet was suspended with 20ml1M sorbitol and allowed to stand at 4℃ for 2 hours. The yeast cells were collected by centrifugation, and the cell pellet was mixed with SPEM buffer (1M sorbitol, 0.1M sodium phosphate buffer mixture pH7.4, and 10mM EDTA, pH 8.0), and then 75ul 14mM 2-ME and 100UL Zymolase were added for wall removal, and digested at 30℃ for 30 minutes. The digested cells were washed with 1M sorbitol. The cells were then suspended in 2 ml of STC solution (1 M sorbitol, 10 mM Tris-HCl, pH 7.5, 10 mM CaCl 2 and 2.5 mM MgCl 2 ) for later use.

[0184] B. PEG-mediated cell fusion:

[0185] At the same time, the above-mentioned genetically modified non-human ES cells (e.g., ES 5'Neo-Loxp71) were collected. ES5'Neo-Loxp 71 cells and TAR-IGL-Loxp 66 yeast cells were mixed in PBS solution at a ratio of 1:100. Centrifuged at room temperature, the cell mixture was suspended in a PEG1500 solution containing 10% DMSO (Roche Applied Science, cata: 10783641001). Two minutes later, the fused non-human ES cells were suspended in culture medium and centrifuged at 200g for 5 minutes. The cell mixture was suspended, 2x106 ES cells were diluted with non-human ES cell culture medium, and cultured in 5 10cm culture dishes. After 50% of the non-human ES cells adhered to the wall, Tamoxifen (1 μg / ml) (Sigma, Cata: T5648-1G) was added to induce the non-human ES cells to express Cre recombinase. After 16 hours, Tamoxifen was washed off, G418 was added, and resistant clones were selected.

[0186] As a control, ES 5'Neo-WTLoxp cells were fused with TAR-IGL-WTLoxp yeast cells using the PEG method and then screened with G418, but no G418-resistant clones were observed, indicating that WT Loxp cannot mediate the site-specific insertion of large circular DNA fragments, or the insertion efficiency is very low.

[0187] Therefore, the present application also tried the conventional Cre-Lox recombination method, that is, using the wild-type Loxp sequence, but failed to stably integrate the macromolecular DNA into the cell chromosome. This may be because the recombination reaction catalyzed by Cre and dependent on the Loxp sequence is reversible, that is, reverse recombination or deletion may occur between Loxp sites, so the recombination between wild-type Loxp sites cannot effectively mediate the stable integration of macromolecular DNA into the cell chromosome.

[0188] C. Detection of positive gene insertion cells:

[0189] After continuous culture in the presence of G418 for one week, G418-resistant monoclonal non-human ES cells (ES 5'Neo-WTLoxp) expressing GFP were picked and transferred to a 48-well culture plate for continued growth. After 3 days, the non-human ES cells were dispersed with a pipette tip, half of which were used to extract genomic DNA, while the other half were frozen in a 48-well cell culture plate for standby use. Considering that clones with G418 resistance will undergo recombination between the Loxp 66 site of the exogenous fragment and the chromosomal Loxp 71 position, thereby generating WTLoxp sites and Loxp 71 / 66 sites at both ends of the inserted fragment, primers were designed at both ends of the insertion site WTLoxp and Loxp 71 / 66, and the site-specific insertion non-human ES clones were identified by PCR.

[0190] The primer sequences are as follows:

[0191] WT Loxp F:GGAGATCCTCAGGTCATTGC;

[0192] WT Loxp R:GGCAGAGCTTTGCTTTTGTT;

[0193] Loxp 66 / 71F: CCTTGACCCAGAAATTCCAC;

[0194] Loxp 66 / 71R:TGGAGGCCATAAACAAGAAGA. Primer design and PCR identification results are shown in the attached figure of the specification. Fig. 9 .

[0195] After G418 screening, all cell clones were positive for Loxp 71 / 66 PCR, of which 75% were double positive for Loxp 71 / 66 and WT Loxp, while 25% were only single positive for Loxp71 / 66 PCR and negative for WT Loxp PCR, indicating that a second gene recombination may have occurred at the WT Loxp site, resulting in multiple copy insertions or gene breakage. This situation can be excluded by PCR, so as to further select double positive clones and identify the integrity of the inserted gene IGL. The PCR primers used are shown in the attached figure of the specification. Figure 6 The identification results showed that all PCR results were positive, indicating that the inserted gene was intact.

[0196] D. Deletion of Selective Markers:

[0197] As the exogenous gene IGL is inserted into the chromosome, the cell will express some unnecessary selective genes, such as HygR, NeoR, CreERT2 and PuroR. These selective genes can be deleted by FLP / FRT recombination. Figure 3 The FLP plasmid (pCAG-Flpe) sequence was synthesized (Addgene, Cata: 13787). The pCAG-Flpe plasmid was transformed into the non-human ES clones with the IGL gene inserted using the conventional liposome transformation method, and the GFP-negative, G418-sensitive and Puromycin-sensitive non-human ES clones were selected for use.

[0198] Cre-Lox recombination is a site-specific recombinase technology used to perform deletion, insertion, transposition and inversion operations at specific sites in cell DNA. The loxP site consists of a 34bp special site sequence. The middle 8bp DNA base is an asymmetric sequence that determines the direction of the loxP sequence. On both sides of the asymmetric sequence are two 13bp reverse symmetric sequences that determine the binding efficiency with Cre. When one end of the symmetric sequence mutates, such as Loxp 71 (mutation in the 5' end symmetric sequence) and Loxp66 (mutation in the 3' end symmetric sequence), Cre can still catalyze the recombination reaction between mutant Loxp (such as Loxp 71 and Loxp 66). However, after the recombination reaction between Loxp 71 and Loxp 66, wild-type Loxp and double mutant Loxp (Loxp71 / 66) are produced. Because Loxp 71 / 66 has mutations in the symmetrical sequences at both ends, its ability to bind to Cre is greatly reduced, thus avoiding the reverse recombination reaction between WT Loxp and Loxp 71 / 66, thereby enhancing the stability of the inserted gene. The present application found through the above experiments that this mutant Loxp, rather than wild-type Loxp, is conducive to the site-specific insertion of large fragments of DNA.

[0199] The present application has found through experiments that the Loxp double mutation Loxp66 / 71 is the most preferred solution for mediating stable site-specific integration of large molecular DNA into cell chromosomes. Compared with wild-type Loxp, or Loxp containing one mutation, such as Loxp / Loxp66 or Loxp / Loxp71, or Loxp double mutation containing other mutation positions, loxp66 / 71 has the best effect and the highest conversion efficiency, and can most effectively and stably integrate large molecular DNA into cell chromosomes, and is most suitable for site-specific integration and cloning of large fragments of DNA.

[0200] The sequences involved in this application are as follows:

[0201] 1. Sequence 1 SEQ ID NO:1

[0202] LoxP66 sequence:

[0203] ATAACTTCGTATA ATGTATGC TATACGAACGGTA

[0204] 2. Sequence 2 SEQ ID NO:2

[0205] WT loxP sequence

[0206] ATAACTTCGTATA ATGTATGC TATACGAAGTTAT

[0207] 3. Sequence 3 SEQ ID NO:3

[0208] Forward primer for PCR product 1 at the junction of vector TAR-loxp66 ends and IGL1

[0209] GGGTTCTCACCTCTGATTAG

[0210] 4. Sequence 4 SEQ ID NO:4

[0211] Reverse primer for PCR product 1 at the TAR-loxp66 end of the vector and the IGL1 junction

[0212] AGGTCCCTCGACCTGCAGCCC

[0213] 5. Sequence 5 SEQ ID NO:5

[0214] Forward primer for IGL1 internal PCR product 2

[0215] AAACCAAGACGGTGAGGAAAG

[0216] 6. Sequence 6 SEQ ID NO: 6

[0217] Reverse primer for IGL1 internal PCR product 2

[0218] GTAAATGAATAAAGGAATGG

[0219] 7. Sequence 7 SEQ ID NO:7

[0220] Forward primer for PCR product 3 at the junction of IGL1 and IGL2

[0221] TGGTGCAGACTCCCCGGATCT

[0222] 8. Sequence 8 SEQ ID NO:8

[0223] Reverse primer for PCR product 3 at the junction of IGL1 and IGL2

[0224] GGAAATGATACCTGGCCCTGGCC

[0225] 9. Sequence 9 SEQ ID NO:9

[0226] Forward primer for IGL2 internal PCR product 4

[0227] AGGGAGGCAGATGCAGAGGT

[0228] 10. Sequence 10 SEQ ID NO:10

[0229] Reverse primer for IGL2 internal PCR product 4

[0230] TTGACCCCACTCCTCCTCCTCA

[0231] 11. Sequence 11 SEQ ID NO:11

[0232] Forward primer for PCR product 5 at the junction of IGL2 and IGL3

[0233] TCCAGTAATGGTCAGGGAGGC

[0234] 12. Sequence 12 SEQ ID NO:12

[0235] Reverse primer for PCR product 5 at the junction of IGL2 and IGL3

[0236] CCCACCTCTGCTCCAGCTTC

[0237] 13. Sequence 13 SEQ ID NO: 13

[0238] Forward primer for IGL3 internal PCR product 6

[0239] CTCGGTGACTTGATCCCAG

[0240] 14. Sequence 14 SEQ ID NO: 14

[0241] Reverse primer for IGL3 internal PCR product 6

[0242] AATGTGTGTAGGGAACATCAT

[0243] 15. Sequence 15 SEQ ID NO:15

[0244] Forward primer for PCR product 7 at the junction of IGL3 and vector TAR-loxp66 ends

[0245] AGTTCTGCTCAAGCTTGGC

[0246] 16. Sequence 16 SEQ ID NO:16

[0247] Reverse primer for PCR product 7 at the junction of IGL3 and vector TAR-loxp66 ends

[0248] CACAGCTACCCTCAAGAAAG

[0249] 17. Sequence 17 SEQ ID NO:17

[0250] Primer Insert 5F for PCR screening of genomic DNA incorporating the expression cassette:

[0251] GCAGTCTGCACTCTCTGTGG

[0252] 18. Sequence 18 SEQ ID NO: 18

[0253] Primers for PCR screening of genomic DNA incorporating the expression cassette Insert 5R:

[0254] tcgagggacctaTACCGTTC

[0255] 19. Sequence 19 SEQ ID NO:19

[0256] Primer for PCR screening of genomic DNA with integrated expression cassette Insert 3F: cgtgacatgtgagcaaaagg

[0257] 20. Sequence 20 SEQ ID NO:20

[0258] Primer Insert 3R for PCR screening of genomic DNA incorporating the expression cassette

[0259] GGAACCTTTCCCCCATAAAA

[0260] 21. Sequence 21 SEQ ID NO: 21

[0261] Primer used to identify WT loxp positive WT loxp F:

[0262] GGAGATCCTCAGGTCATTGC

[0263] 22. Sequence 22 SEQ ID NO: 22

[0264] Primers used to identify WT loxp positive WT loxp R:

[0265] GGCAGAGCTTTGCTTTTGTT

[0266] 23. Sequence 23 SEQ ID NO: 23

[0267] Primer Loxp66 / 71F used to identify Loxp66 / 71 positive:

[0268] CCTTGACCCAGAAATTCCAC

[0269] 24. Sequence 24 SEQ ID NO: 24

[0270] Primer Loxp66 / 71R for identification of Loxp66 / 71 positive:

[0271] TGGAGGCCATAAACAAGAAGA

[0272] 25. Sequence 25 SEQ ID NO: 25

[0273] TAR-loxp66 sequence

[0274] GGCGCGCCACTAGTGGATCTCGAGCCCCAGCTGGTTCTTTCCGCCTCAGAAGGAATTTCGAGGTCGCTAGTGCTA

[0275] GAGCTTGGGCTGCAGGTCGAGGGACCTAATAACTTCGTATAATGTATGCTATACGAACGGTAATTAAGGGTTCC

[0276] GGATCAATTCTAGAGGCTATCTAATATATTTTAAAGGTTGCATAGCATTCTGTCTTATGGAGATACCATAACTGAT

[0277] TTAACCAGTCCACTATTGATAGACACTATTTTGTTCTTACCGACTGTACTAGAAGAAACATTCTTTTACATGTTTG

[0278] GTACTTGTTCAGCTTTATTCAAGTGGAATTTCTGGGTCAAGGGGAAAGAGTTTATTGAATATTTTGGTATTGCCA

[0279] AATTTTCCTCTAAGAAGTTGAATCATTTTATACTCCTGATGTTATATGAGAGTACCTTTCTCTTCACAATTTGTCT

[0280] CTTTTTTTTTTTTTTTTGAGACAAGGTCTCTGTTGCCCAGGCTGGGGTGCAGTGCAGCAGAATGATCACAGTTCAC

[0281] TGCAGTCTCAACCTCCTGGGTTCAAGCGATCCTTCCACCTCAGCCTCCTGAGTAGCTGGGACTATAGGTGTGCGC

[0282] CACCACTCCCAGCTAATATTTTTATTTTGTAGAAACAGGGTTCGCCATGTTACCCAGCCTCCCAAAGTGCTGGGA

[0283] TTACAGGCATGAGCCACTGGCCCAGTTTCTACAGTCTCTCTTAATATTGTATATTATCCAAGAAATTTCATTTAAT

[0284] CAGAACCTGCCAGTCTGATAGGTGAAAATGGTATCTTGTTTTTATTTGCATTTAAAAAAAATTATGATAGTGGTA

[0285] TGCTTGGTTTTTTTGAAGGTATCAAATTTTTTACCTTATGAAACATGAGGGCAAAGGATGTGTTACGTGGAAGAT

[0286] TTAAAAAAAATTTTTAATGCATTTTTTTGAGACAAGGTCTTGCTCTATTGTCCAGGCTGGAGTGCAGTGGCACAA

[0287] TCACAGTTCACTCCAGCCTCAACATCCTGCACTAAAGTGATTTTCCCACCTCACCTCTCAAGTAGCTGGGACTAC

[0288] AGGTACATGCTACCATGCCTGGCTAATTTTTTTTTTTTTGCAGGCATGGGGTCTCACTATATTGCCCAGGTTGGTG

[0289] TGGAAGTTTAATGACTAAGAGGTGTTTGTTATAAAGTTTAATGTATGAAACTTTCTATTAAATTCCTGATTTTATT

[0290] TCTGTAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGA

[0291] AAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAA

[0292] GCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAG

[0293] AGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGATGATCTCGTC

[0294] GTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGC

[0295] CGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGA

[0296] ATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTT

[0297] GACGAGTTCTTCGGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCC

[0298] CAGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGG

[0299] CCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCA

[0300] CCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCT

[0301] ACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATC

[0302] TTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCAT

[0303] CGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGC

[0304] CACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCG

[0305] AGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCC

[0306] GACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCT

[0307] GGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGAGCTCGCTGATCAGCCT

[0308] CGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCAC

[0309] TCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGG

[0310] TGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGAGAATAGCAGGCATGCTGGGGATGCGGTGGGCTCT

[0311] ATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCGATCCTCTAGTTGGGTACCTTCTGAGAATTCGCCCTCGCC

[0312] GCAGGGCCTCGGTGGCCGGCCGCAGCTTGCAAATTAAAGCCTTCGAGCGTCCCAAAACCTTCTCAAGCAAGGTT

[0313] TTCAGTATAATGTTACATGCGTACACGCGTCTGTACAGAAAAAAAAGAAAAATTTGAAATATAAATAACGTTCT

[0314] TAATACTAACATAACTATAAAAAAATAAATAGGGACCTAGACTTCAGGTTGTCTAACTCCTTCCTTTTCGGTTAG

[0315] AGCGGATGTGGGGGGAGGGCGTGAATGTAAGCGTGACATAACTAATTACATGATGCGGCCCTCTAGATGCATGC

[0316] TCGAGCGGCCGCTACCACTTTGTACAAGAAAGCTGGGTTTATTCCTTTGCCCTCGGACGAGTGCTGGGGCGTCGG

[0317] TTTCCACTATCGGCGAGTACTTCTACACAGCCATCGGTCCAGACGGCCGCGCTTCTGCGGGCGATTTGTGTACGC

[0318] CCGACAGTCCCGGCTCCGGATCGGACGATTGCGTCGCATCGACCCTGCGCCCAAGCTGCATCATCGAAATTGCC

[0319] GTCAACCAAGCTCTGATAGAGTTGGTCAAGACCAATGCGGAGCATATACGCCCGGAGCCGCGGCGATCCTGCAA

[0320] GCTCCGGATGCCTCCGCTCGAAGTAGCGCGTCTGCTGCTCCATACAAGCCAACCACGGCCTCCAGAAGAAGATG

[0321] TTGGCGACCTCGTATTGGGAATCCCCGAACATCGCCTCGCTCCAGTCAATGACCGCTGTTATGCGGCCATTGTCC

[0322] GTCAGGACATTGTTGGAGCCGAAATCCGCGTGCACGAGGTGCCGGACTTCGGGGCAGTCCTCGGCCCAAAGCAT

[0323] CAGCTCATCGAGAGCCTGCGCGACGGACGCACTGACGGTGTCGTCCATCACAGTTTGCCAGTGATACACATGGG

[0324] GATCAGCAATCGCGCATATGAAATCACGCCATGTAGTGTATTGACCGATTCCTTGCGGTCCGAATGGGCCGAAC

[0325] CCGCTCGTCTGGCTAAGATCGGCCGCAGCGATGGCATCCATGGCCTCCGCGACCGGCTGCAGAACAGCGGGCAG

[0326] TTCGGTTTCAGGCAGGTCTTGCAACGTGACACCCTGTGCACGGCGGGAGATGCAATAGGTCAGGCTCTCGCTAA

[0327] ATTCCCCAATGTCAAGCACTTCCGGAATCGGGAGCGCGGCCGATGCAAAGTGCCGATAAACATAACGATCTTTG

[0328] TAGAAACCATCGGCGCAGCTATTTACCCGCAGGACATATCCACGCCCTCCTACATCGAAGCTGAAAGCACGAGA

[0329] TTCTTCGCCCTCCGAGAGCTGCATCAGGTCGGAGACGCTGTCGAACTTTTCGATCAGAAACTTCTCGACAGACGT

[0330] CGCGGTGAGTTCAGGCTTTTTACCCATGGTGGCAGCCTGCTTTTTTGTACAAACTTGCTTAGATTAGATTGCTATG

[0331] CTTTCTTTCTAATGAGCAAGAAGTAAAAAAAGTTGTAATAGAACAAGAAAAATGAAACTGAAACTTGAGAAATT

[0332] GAAGACCATTTATTAACTTAAATATCAATGGGAGGTCATCGAAAGAGAAAAAAATCAAAAAAAAAAATTTTCA

[0333] AGAAAAAGAAACGTGATAAAAATTTTTATTGCCTTTTTCGACGAAGAAAAAGAAACGAGGCGGTCTCTTTTTTC

[0334] TTTTCCAAACCTTTAGTACGGGTAATTAACGACACCCTAGAGGAAGAAAGAGGGGGAATTTAGTATGCTGTGCT

[0335] TGGGTGTTTTGAAGTGGTACGGCGATGCGCGGAGTCCGAGAAAATCTGGAAGAGTAAAAAAGGAGTAGAAACA

[0336] TTTTGAAGCTATGGTGTGTGGGGGATCCAACTTTTCTATACAAAGTTGACTAGTGGATCGATCCCCTTTACATCTT

[0337] CGGAAAAAAAAAACTATTTTTCTTTAATTTCTTTTTTACTTTCTATTTTTAATTTATATATTTATATTAAAAAAAT

[0338] TTAAATTATAATTATTTTTATAGCACGTGATCAGCCTGCTGTCGTGAATACGGCGCGCCGAAGTTCCTATACTTTC

[0339] TAGAGAATAGGAACTTCGGAATAGGACACTTCTTATGAGGTCCCTCATCCAGAACTCTGGCTGCAGCAACCCCAG

[0340] CAGAGGTCCTGAGTCTGCAGACTTGAAGAATAATACAAAGAAGAATTAGGAAGTGAGTAGGCACTATTAATT

[0341] AAAGTTCTGCTCAAGCTTGGCGTAATCATGGTCATAGCTTGTTCCTGTGTGAAAGCCTGGGGTGCCTAATGAGTG

[0342] AGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAA

[0343] TGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTG

[0344] CGCTCGGTCGTTCGGCTGCGGCGAGGCGGTATCAGCTCACTCAAAAGCGGTAATACGGTTATCCACAGAATCAGG

[0345] GGATAACGCAGGAAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAAGGCCGCGTTGCT

[0346] GGCGTTTTTCCATAGGCTCCGCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACC

[0347] CGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGC

[0348] TTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAG

[0349] TTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATC

[0350] CGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGA

[0351] TTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGA

[0352] ACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAA

[0353] CAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGA

[0354] AGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAG

[0355] ATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGA

[0356] GTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATC

[0357] CATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAAT

[0358] GATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGC

[0359] AGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCG

[0360] CCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCT

[0361] TCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCC

[0362] TTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAAT

[0363] TCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAG

[0364] TGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAA

[0365] AGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGAT

[0366] GTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGG

[0367] AAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAAT

[0368] ATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAA

[0369] TAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCT

[0370] ATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATG

[0371] CAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAG

[0372] CGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATG

[0373] CGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAA

[0374] CTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGC

[0375] GATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCACGGGCCCTTGCCA

[0376] CCCGCTCTCACTGCCACACCCTCATAGAAATCCTTCCCCATATGGATCTTGTGTTCTTCTCTCTCTCTTCCCTCTCA

[0377] GCTCCTGCTCAGTGGCTGAAGCAGATTTGGAGCCACGAACACGAGTCTGGCAGAGCTTTGCTTTTGTTTTTAACT

[0378] GGGAGTCGACTGCAGAGGCCTGCATG

[0379] 26. Sequence 26 SEQ ID NO:26

[0380] loxp71 - hprt intron - 5'Neo - PGK promoter - rBGpA - EF1a - CreERT2 - IRES - puro - FRT sequence

[0381] CGATTTAAGAAACAGAGGAAAATTGCAAGATTTTCTTGATTCTCTGTCTTAAACAAAACAGACAAAGATGATGG

[0382] GCTCTTTGACTTTCTTGTGTCACTTTAATTTTCCTTGTCTTTCTAAGGAAAGTTGCCTGAGATAGCATAATGAGGG

[0383] TTGAACATGACTGACACTGATAGAAACCCTGGTGAGGAGGTAGACATGTAAATAACAAGCAGAGCATTTGACC

[0384] AGCACTGTTTGGTGTCACTAAATCAGTGGGTGCTATAAGTGGTGATGATGTTACCTGTATTCTTGAATGTTTCAA

[0385] TTTATATTTACCTGGAAAACTGGTTCATTTTGTTAAGGATTCTATGTTGCATTCCCTAAGTGTTGTGAGGTAAATG

[0386] ATGAAAGTTCTTTCAGGTCTGAATGAGGAAGATGTCTTGATGTCTTTTCAAGGCAAGCTCTATAGTGCAGGAGA

[0387] GATGAGAGTTGTATATTCTCCAACACTATCCTCCATGTTCAGAAACAGCTATCACTTCAAGCCTGGGGTATGGAA

[0388] TTATATGACAGAAGGCCTCTGAAATAATTTCCCTGCTCTACCTTGCAAATTAACCCCATCTCTCTTATCTGTCACT

[0389] CAATACCTGTATTCCTATCAATTCGTAACAAAACCAAACTGTTGTGTCTGATTTAAATAATATCTATGAAGTTGA

[0390] TATGAGCATGGCATGGCTTCTCTGTCTACTAGGGTATGAAGAAAAATCACCTTTCAAACAGAGAAAAAATACAC

[0391] CGAGTAGCAGCTGTCTGACTCTGGCATTAACTGGTAAATATTTGCAGCATATACTATGGAGCTGTTCAGATTTGA

[0392] TGAGTATGTTATTTGTTGACTCACTCATTCACTGAACAAATCTTCAGTGAGCACAGGTGTAGGCATGGGTTAGGA

[0393] GCAAAGAGATGAGGCCTACCTACTCTGGAGAAACTTAGGAGTTAGAGATAAATACAATGTAGAATGAATCATTA

[0394] TTCTTATCCAGGAGATCCTCAGGTCATTGCTTGTCTCCGGCAGGATCCGATGATCCGGAACCCTTAATATAACTT

[0395] CGTATAATGTATGCTATACGAACGGTATAGGTCCCTCGACCTGCAGCCCAAGCTCTAGACACACTAATATTAAA

[0396] AGTGTCCAATAACATTTAAAACTATACTCATACGTTAAAATATAAATGTATATATGTACTTTTGCATATAGTATA

[0397] CATGCATAGCCAGTGCTTGAGAAGAAATGTGTACAGAAGGCTGAAAGGAGAGAACTTTAGTCTTCTTGTTTATG

[0398] GCCTCCATAGTTAGAATATTTTATAACACAAATATTTTGATATTATAATTTTAAAATAAAAACACAGAATAGCCA

[0399] GACATACAATGCAAGCATTCAATACCAGGTAAGGTTTTTCACTGTAATTGACTTAACAGAAAATTTTCAAGCTAG

[0400] ATGTGCATAATAATAAATCTGACCTTGCCTTCATGTGATTCAGCCCCAGTCCATTACCCTGTTTAGGACTGAG

[0401] AAATGCAAGACTCTGGCTAGAGTTCCTTCTTCCATCTCCCTTCAATGTTTACTTTGTTCTGGTCCCTACAGAGTCC

[0402] CACTATACCACAACTGATACTAAGTAATTAGTAAGGCCCTCCTCTTTTATTTTTAATAAAGAAGATTTTAGAAAG

[0403] CATCAGTTATTTAATAAGTTGGCCTAGTTTATGTTCAAATAGCAAGTACTCAGAACAGCTGCTGATGTTTGAAAT

[0404] TAACACAAGAAAAGTAAAACCTCATTTTAAGATCTTACTTACCTTCCCGCTTCAGTGACAACGTCGAGCAC

[0405] AGCTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTGCAGTTCATTCAGGGCAC

[0406] CGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAGAGCA

[0407] GCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATC

[0408] CATCTTGTTCAATGGCCGATCCCATAACGGAGCCGGCCGGCGCGCGGGCTGACTGCTCAGGAGGAGGAAGCCGG

[0409] TGGCGGAGCAGAGGAGGAGGCGGAGGCGCAGCAAGACCCCCCCCCCCCCCTGCAGGTCGAAAGGCCCGGAGAT

[0410] GAGGAAGAGGAGAACAGCGCGGCAGACGTGCGCTTTTGAAGCGTGCAGAATGCCGGGCCTCCGGAGGACCTTC

[0411] GGGCGCCCGCCCCGCCCCTGAGCCCGCCCCTGAGCCCGCCCCCGGACCCACCCCTTCCCAGCCTCTGAGCCCAG

[0412] AAAGCGAAGGAGCAAAGCTGCTATTGGCCGCTGCCCCAAAGGCCTACCCGCTTCCATTGCTCAGCGGTGCTGTC

[0413] CATCTGCACGAGACTAGTGAGACGTGCTACTTCCATTTGTCACGTCCTGCACGACGCGAGCTGCGGGGCGGGGG

[0414] GGAACTTCCTGACTAGGGGAGGAGTAGAAGGTGGCGCGAAGGGGCCACCAAAGAACGGAGCCGGTTGGCGCCT

[0415] ACCGGTGGATGTGGAATGTGTGCGAGGCCAGAGGCCACTTGTGTAGCGCCAAGTGCCCAGCGGGGCTGCTAAA

[0416] GCGCATGCTCCAGACTGCCTTGGGAAAAGCGCCTCCCCTACCCGGTAGAATTCCTGGCGCGGATCTCCATAAGA

[0417] GAAGAGGGACAGCTATGACTGGGAGTAGTCAGGAGAGGAGGAAAAATCTGGCTAGTAAAACATGTAAGGAAA

[0418] ATTTTAGGGATGTTAAAGAAAAAAATAACACAAAACAAAATATAAAAAAAATCTAACCTCAAGTCAAGGCTTTT

[0419] CTATGGAATAAGGAATGGACAGCAGGGGGCTGTTTCATATACTGATGACCTCTTTATAGCCAACCTTTGTTCATG

[0420] GCAGCCAGCATATGGGCATATGTTGCCAAACTCTAAACCAAATACTCATTCTGATGTTTTAAATGATTTGCCCTC

[0421] CCATATGTCCTTCCGAGTGAGAGACACAAAAAATTCCAACACACTATTGCAATGAAAATAAATTTCCTTTATTAG

[0422] CCAGAAGTCAGATGCTCAAGGGGCTTCATGATGTCCCCATAATTTTTGGCAGAGGGAAAAAGATCTCAGTGGTA

[0423] TTTGTGAGCCAGGGCATTGGCCACACCAGCCACCACCTTCTGATAGGCAGCCTGCACCTGAGGATCACCACTTTG

[0424] TACAAGAAAGCTGGGTGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGG

[0425] GGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTA

[0426] CTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCG

[0427] CAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATG

[0428] GCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTG

[0429] GGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGC

[0430] TGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAA

[0431] AATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACT

[0432] GGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGG

[0433] CCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGTCTCG

[0434] CGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGG

[0435] CCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCAC

[0436] CCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCC

[0437] AGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAG

[0438] TTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCC

[0439] CTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTC

[0440] GTGAAGCTTGGTACCGCCACCATGGGCTCCAATTTACTGACCGTACACCAAAATTTGCCTGCATTACCGGTCGAT

[0441] GCAACGAGTGATGAGGTTCGCAAGAACCTGATGGACATGTTCAGGGATCGCCAGGCGTTTTCTGAGCATACCTG

[0442] GAAAATGCTTCTGTCCGTTTGCCGGTCGTGGGCGGCATGGTGCAAGTTGAATAACCGGAAATGGTTTCCCGCAG

[0443] AACCTGAAGATGTTCGCGATTATCTTCTATATCTTCAGGCGCGCGGTCTGGCAGTAAAAACTATCCAGCAACATT

[0444] TGGGCCAGCTAAACATGCTTCATCGTCGGTCCGGGCTGCCACGACCAAGTGACAGCAATGCTGTTTCACTGGTTA

[0445] TGCGGCGGATCCGAAAAGAAAACGTTGATGCCGGTGAACGTGCAAAACAGGCTCTAGCGTTCGAACGCACTGA

[0446] TTTCGACCAGGTTCGTTCACTCATGGAAAATAGCGATCGCTGCCAGGATATACGTAATCTGGCATTTCTGGGGAT

[0447] TGCTTATAACACCCTGTTACGTATAGCCGAAATTGCCAGGATCAGGGTTAAAGATATCTCACGTACTGACGGTG

[0448] GGAGAATGTTAATCCATATTGGCAGAACGAAAACGCTGGTTAGCACCGCAGGTGTAGAGAAGGCACTTAGCCTG

[0449] GGGGTAACTAAACTGGTCGAGCGATGGATTTCCGTCTCTGGTGTAGCTGATGATCCGAATAACTACCTGTTTTGC

[0450] CGGGTCAGAAAAAATGGTGTTGCCGCGCCATCTGCCACCAGCCAGCTATCAACTCGCGCCCTGGAAGGGATTTT

[0451] TGAAGCAACTCATCGATTGATTTACGGCGCTAAGGATGACTCTGGTCAGAGATACCTGGCCTGGTCTGGACACA

[0452] GTGCCCGTGTCGGAGCCGCGCGAGATATGGCCCGCGCTGGAGTTTCAATACCGGAGATCATGCAAGCTGGTGGC

[0453] TGGACCAATGTAAATATTGTCATGAACTATATCCGTAACCTGGATAGTGAAACAGGGGCAATGGTGCGCCTGCT

[0454] GGAAGATGGCGATCTCGAGCCATCTGCTGGAGACATGAGAGCTGCCAACCTTTGGCCAAGCCCGCTCATGATCA

[0455] AACGCTCTAAGAAGAACAGCCTGGCCTTGTCCCTGACGGCCGACCAGATGGTCAGTGCCTTGTTGGATGCTGAG

[0456] CCCCCCATACTCTATTCCGAGTATGATCCTACCAGACCCTTCAGTGAAGCTTCGATGATGGGCTTACTGACCAAC

[0457] CTGGCAGACAGGGAGCTGGTTCACATGATCAACTGGGCGAAGAGGGTGCCAGGCTTTGTGGATTTGACCCTCCA

[0458] TGATCAGGTCCACCTTCTAGAATGTGCCTGGCTAGAGATCCTGATGATTGGTCTCGTCTGGCGCTCCATGGAGCA

[0459] CCCAGTGAAGCTACTGTTTGCTCCTAACTTGCTCTTGGACAGGAACCAGGGAAAATGTGTAGAGGGCATGGTGG

[0460] AGATCTTCGACATGCTGCTGGCTACATCATCTCGGTTCCGCATGATGAATCTGCAGGGAGAGGAGTTTGTGTGCC

[0461] TCAAATCTATTATTTTGCTTAATTCTGGAGTGTACACATTTCTGTCCAGCACCCTGAAGTCTCTGGAAGAGAAGG

[0462] ACCATATCCACCGAGTCCTGGACAAGATCACAGACACTTTGATCCACCTGATGGCCAAGGCAGGCCTGACCCTG

[0463] CAGCAGCAGCACCAGCGGCTGGCCCAGCTCCTCCTCATCCTCTCCCACATCAGGCACATGAGTAACAAAGGCAT

[0464] GGAGCATCTGTACAGCATGAAGTGCAAGAACGTGGTGCCCCTCTATGACCTGCTGCTGGAGGCGGCGGACGCCC

[0465] ACCGCCTACATGCGCCCACTAGCCGTGGAGGGGCATCCGTGGAGGAGACGGACCAAAGCCACTTGGCCACTGC

[0466] GGGCTCTACTTCATCGCATTCCTTGCAAAAGTATTACATCACGGGGGAGGCAGAGGGTTTCCCTGCCACAGCTTG

[0467] ATGAGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTC

[0468] TATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGA

[0469] GCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTC

[0470] TGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGG

[0471] TGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAG

[0472] TTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGG

[0473] TACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAAC

[0474] GTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCCACAACCCACAA

[0475] GGAGACGACCTTCCATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTA

[0476] CGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCG

[0477] GGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACG

[0478] GCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCG

[0479] CATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCA

[0480] AGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTC

[0481] GTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAAACCTCCGCGCCCCGCAACCT

[0482] CCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCA

[0483] TGACCCGCAAGCCCGGTGCCTGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGA

[0484] AATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCA

[0485] TTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTACTTA

[0486] AGAGGGGGAGACCAAAGGGCGAGACGTTAAGGCCTCACGTGACATGTGAGCAAAAGGCCAGCAAAAGGCCAG

[0487] GAACCGTAAAAAGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCTAAAAGTGAAGTTCCTATACTTTCTAGA

[0488] GAATAGGAACTTCGGAATAGGAACTTCTTGGCTATTGTAGCCAAAAATCTCATCAAAAGCCCAGAATGGATCTG

[0489] AACAACAGAAAATTCCATGAGATGATCTGACTGTATGACCAGAGCCATTGTGGACACAGCACAGTACATTGCTG

[0490] ATTTCTTTTCAACTCTGAGGTATCAGGATTGCTAATGTCCATCATTTATGGGGTATCTACCATTAGATGTACAAA

[0491] GGACTGACCCTGTTCCACTTATCATATATGACCAATTTATGTCTAGAGAATGAAAGTCAGAAAAAAATTAAACA

[0492] ATACATAAACACAAACCCAACCACAAAACTTGTGATCTACAGACTGTTCTCAATGCAAAATATGCTAGGGCAAT

[0493] GGGGGCACAAATCTTAGAGAAATAATTAAACAACATTTGATTTGACTTAAATCTCATTCCATGACATGGAACTC

[0494] ATGAACACTGTTTGGCAGACCAAGATCTAGAGACTAAATAGACCAATGACCTATGATAAACCAAATACTACTGG

[0495] CTTAAAACAAAAGTATCACTAACATGACTCCTGATGATATTCTGCTATCTCATAGATTGTGCTTTATTTAGCCATC

[0496] ATCAGGTAGGCTTCCTCATACATCACGGTTAGGGTTAGGCTTAGGGGTTAGGGTTAGCATTAGAGTTAGGTCCCA

[0497] GAAAATTTGGAGATCTGCAGTCTTTTAAAATATCTTTCATGACAAAAAGGAGCAATCTCTGCCCCAAAGGGAA

[0498] GGTTTGACTTTCCTGTTGCATGAGTTAACTGGAATATTTGCATCATAAATTTAGTTTGAAACTGTAATATATCTTG

[0499] TAACATATAAAAATTTCAAGACTACATATGATGGCTTAAAGGCTGGCACTATGGCTTAGCCAGTAAAAGTACTT

[0500] GGCACAAATTGTGATGACCTGAATTTGATCCCAGAACTTACATCTGACTATTTAACTTGCCTTCTGACAATGTTT

[0501] CTCCCCCCTCTCTCTGCCATTATGTAACTCTCTCCATCTCTCAATAAATAACATTATTTTAAAATTATTTTTATTTT

[0502] TAAACTTGAAGTTTAAGAATGAATAACATAATTAAGTCAAACAATGATCCTCAAATGGATAAGATCAA

Claims

1. A method for integrating a target gene fragment, comprising the following steps: 1) obtaining a target gene fragment, wherein the length of the target gene fragment exceeds 100 kb, wherein the target gene fragment in step 1) is obtained from a BAC vector; 2) cloning the target gene fragment into a circular YAC vector, inserting a truncated neomycin analog resistance expression cassette 1 into the obtained vector containing the target gene fragment, wherein the expression cassette 1 contains a mutant Loxp1, a part of the HPRT intron and a part of the resistance gene in the 5' to 3' direction; 3) transforming the vector containing the target gene fragment into yeast cells; 4) introducing the vector containing the target gene fragment in the yeast into a recipient cell, wherein the recipient cell is a eukaryotic cell, wherein a truncated neomycin analog resistance expression cassette 2 has been site-specifically introduced into the genome of the recipient cell, wherein the expression cassette 2 comprises a portion of the HPRT intron, a mutant Loxp2, a resistance gene b portion, a fusion protein CreERT2 containing a mutant of the ligand binding region of the estrogen receptor and the Cre recombinase, and an IRES-PuroR structure in the 5' to 3' direction; 5) Inducing the recombinase activity of CreERT2 by adding Tamoxifen, the Cre recombinase mediates the site-specific integration of the target gene fragment into the genome of the recipient cell, and at the same time, the expression cassette 1 and the expression cassette 2 form a neomycin analog resistance expression cassette expressing a complete resistance gene; 6) screening the recipient cells whose genomes have been site-specifically integrated with the target gene fragment, wherein the mutant Loxp1 in the truncated neomycin analogue resistance expression cassette 1 in step 2) and / or the mutant Loxp2 in the truncated neomycin analogue resistance expression cassette 2 in step 4) are used to site-specifically introduce the expression cassette into the genome of the recipient cell, The resistance gene part a contained in the resistance expression cassette 1 in step 2) and the resistance gene part b contained in the resistance expression cassette 2 in step 4) and the 5' end part of the Neo gene are functionally complementary. The HPRT intron and resistance gene part a contained in the truncated neomycin analog resistance expression cassette 1 in step 2), the HPRT intron and resistance gene part b contained in the truncated neomycin analog resistance expression cassette 2 in step 4), and the neomycin analog resistance expression cassette expressing the complete resistance gene formed in step 5) are used to screen cell recombinants after site-specific integration of the target gene fragment; The neomycin analog is G418, the mutant Loxp1 is the Loxp66 sequence, and the resistance gene a part is the 3' end part of the neomycin analog resistance gene Neo gene; The mutant Loxp2 is the Loxp71 sequence, and the resistance gene b part is the 5' end part of the Neo gene.

2. The method according to claim 1, wherein the 5' end portion of the Neo gene and the 3' end portion of the Neo gene are truncated at position 92, In step 6), the antibiotic G418, which is specific to the resistance gene, is added to screen the recipient cells in which the target gene fragment is site-specifically integrated in the genome.

3. The method according to claim 2, wherein the 92nd amino acid of the neomycin analog is encoded by the last nucleotide of the 5' end portion of the Neo gene and the start nucleotide of the 3' end portion of the Neo gene.

4. The method according to claim 2, wherein the 92nd amino acid of the neomycin analog is encoded by the last two nucleotides of the 5' end portion of the Neo gene and the first nucleotide at the beginning of the 3' end portion of the Neo gene.

5. The method according to any one of the preceding claims, wherein in the vector containing the target gene fragment obtained in step 1), there is a FRT sequence upstream of the target gene fragment, and in the expression cassette in step 4), there is a FRT sequence downstream of the IRES-PuroR structure, And after the step 6), the method further comprises the step 7): transferring the plasmid containing FLP into the recipient cell to remove the expression cassette.

6. The method according to any one of claims 1 to 4, wherein the target gene fragments in step 1) include prokaryotic and eukaryotic gene fragments.

7. The method according to claim 1, wherein the circular YAC vector is obtained by homologous recombination splicing technology, or a combination of homologous recombination splicing technology and genome editing technology.

8. The method according to claim 7, wherein the circular YAC vector is obtained by yeast transformation-coupled recombination technology, or a combination of yeast transformation-coupled recombination technology and genome editing technology.

9. The method according to claim 7 or 8, wherein the homologous recombination splicing technology is selected from one or more of the following: sequence-dependent in vitro assembly technology, yeast transformation-coupled recombination technology and bacterial Red / ET homologous recombination technology.

10. The method according to claim 1, wherein the target gene fragment in step 1) is obtained by cutting a chromosome or a vector using genome editing technology.

11. The method according to claim 1, wherein in step 4), the expression cassette and its downstream large DNA fragment are site-specifically and stably introduced into the genome of the recipient cell by genome editing technology.

12. The method according to any one of claims 7, 8, 10 and 11, wherein the genome editing technology is selected from one or more of the following: zinc finger nuclease technology, transcription activator-like effector nuclease technology and clustered regularly interspaced short palindromic repeat sequence technology.

13. The method according to claim 12, wherein the clustered regularly interspaced short palindromic repeats technology comprises CRISPR / Cas9 and CRISPR-Cpf1.

14. The method according to any one of claims 1 to 4, wherein the yeast is Saccharomyces cerevisiae.

15. The method according to any one of claims 1 to 4, wherein in said step 4) the vector containing the target gene fragment in the microorganism is introduced into the recipient cell using yeast spheroplast fusion technology.

16. The method according to any one of claims 1 to 4, wherein the recipient cells in step 4) are non-human animal embryonic stem cells.

17. The method according to any one of claims 1 to 4, wherein the length of the target gene fragment exceeds 300 kb.

18. The method according to any one of the preceding claims 1 to 4, wherein the length of the target gene fragment exceeds 400 kb.

Images