Circular RNA Kit for the Diagnosis of Neuromyelitis Optica Spectrum Disorder-Associated Optic Neuritis and Its Application

By using the circular non-coding RNA hsa_circRNA_054220 as a diagnostic marker, the specificity and sensitivity of the diagnosis of optic neuritis related to the neuromyelitis optic lineage in the prior art are solved, and more efficient diagnosis and reduced patient burden are achieved.

CN116064768BActive Publication Date: 2025-06-20THE SECOND XIANGYA HOSPITAL OF CENT SOUTH UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211012509.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-23
Publication Date
2025-06-20
Estimated Expiration
2042-08-23

AI Technical Summary

Technical Problem

The prior art has problems of specificity and insufficient sensitivity in diagnosing optic neuritis related to the neuromyelitis optic lineage disease, resulting in low diagnostic efficiency and heavy burden on the patient.

Method used

The circular non-coding RNA hsa_circRNA_054220 was used as a diagnostic molecular marker to detect its expression level by real-time fluorescence quantitative PCR, and a kit for optic neuritis related to the neuromyelitis optic lineage was provided.

Benefits of technology

The hsa_circRNA_054220 was found to be downregulated in cerebrospinal fluid in patients with neuromyelitis optic lineage disease-related optic neuritis, providing a biomarker with high specificity and sensitivity to help improve diagnostic efficiency and reduce the economic and psychological burden of patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The present invention relates to the field of biomedicine, and particularly to a kit for diagnosing neuromyelitis optica spectrum disorder (NMOSD)-associated optic neuritis using circRNA as a molecular marker and its application. Experiments have found that, compared with the control group, the expression of hsa_circRNA_054220 is downregulated in the cerebrospinal fluid of patients with NMOSD-associated optic neuritis. This indicates that hsa_circRNA_054220 is a circRNA with low expression in NMOSD-associated optic neuritis and is a biomarker that helps in the diagnosis of NMOSD-associated optic neuritis. The present invention provides a strong molecular biological basis for the diagnosis of NMOSD-associated optic neuritis, with profound clinical significance and wide applicability.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and particularly to a circRNA kit for diagnosing neuromyelitis optica spectrum disorder-related optic neuritis as a molecular marker and its application. Background Art

[0002] Neuromyelitis optica spectrum disorder-related optic neuritis is a subordinate concept of idiopathic optic neuritis. According to the "Expert Consensus on the Diagnosis and Treatment of Optic Neuritis (2014)", idiopathic optic neuritis includes (1) idiopathic demyelinating optic neuritis, also known as classic multiple sclerosis-related optic neuritis, (2) neuromyelitis optica-related optic neuritis (NMO-ON), and (3) other central nervous system demyelinating disease-related optic neuritis. In 2015, the "International Consensus on the Diagnostic Criteria for NMOSD" consensus cancelled the individual definition of NMO and classified NMO into the neuromyelitis optica spectrum disorder (NMOSD).

[0003] The incidence of neuromyelitis optica spectrum disorder-related optic neuritis (NMOSD-ON) in the Asian population is significantly higher than that in other groups, accounting for 22.4 - 28% of central nervous system inflammatory demyelinating diseases. Due to its characteristics of high recurrence and high disability, it seriously affects the life and mental health of patients.

[0004] In the past 20 years, the diagnosis of NMOSD-ON mainly relied on the detection of autoantibodies in addition to clinical symptoms. For example, aquaporin-4 antibodies (AQP4-IgG), as one of the main diagnostic criteria for NMOSD, can cause inflammatory reactions and demyelination changes in cells by attacking AQP4 distributed on the astrocyte cell membrane; anti-myelin oligodendrocyte glycoprotein antibodies (MOG-IgG) can participate in NMOSD lesions by activating the complement system, etc. However, the diagnostic method based mainly on serum antibodies still has certain limitations. Studies have shown that 10% - 30% of NMOSD patients with clinical symptoms cannot detect AQP4-IgG, and due to the influence of the disease course of patients, serum antibodies cannot be continuously and stably detected.

[0005] More importantly, the non-specific symptoms and cross-reactive positive antibodies among different subtypes of central demyelinating diseases can easily lead to diagnostic confusion. Therefore, in the clinical diagnosis process, it is often necessary to comprehensively consider various examination results to exclude optic nerve lesions such as hereditary, traumatic, toxic, and compressive ones. This process causes serious economic and psychological burdens on patients. Therefore, finding new reliable and accurate clinical biomarkers is of great significance for improving the diagnostic efficiency of NMOSD-ON.

[0006] Currently, there have been many reports on biomarkers for NMOSD-ON. In addition to the above-mentioned AQP4 antibody and MOG antibody, MBP (Myelin basic protein, MBP) antibody and OCB (Oligoclonal bands, OCB) can also assist in diagnosis. Biomarkers of the cytokine and chemokine types include IL-6, IL-8, etc., which reflect the participation of T cells and B cells in the immune response. The disruption of the blood-brain barrier and glial cells can also increase the specificity of some proteins, such as MMP-9, GFAP, etc. Therefore, biomarkers are essentially the products of diseases in the pathological metabolism process. Considering the current research progress, most markers only reflect the inflammatory state of the central nervous system and do not reflect the specific pathological process of NMOSD-ON.

[0007] Therefore, it is of great practical significance to provide biomarkers with high specificity and sensitivity, easy to detect, relatively low economic cost, and applicable to the early diagnosis of diseases. Summary of the Invention

[0008] In view of this, the present invention provides a circRNA kit and its application for diagnosing neuromyelitis optica spectrum disorder-related optic neuritis as a molecular marker.

[0009] To achieve the above invention purpose, the present invention provides the following technical solutions:

[0010] The present invention provides the application of circular non-coding RNA in the preparation of a molecular marker for diagnosing neuromyelitis optica spectrum disorder-related optic neuritis; the circular non-coding RNA is hsa_circRNA_054220.

[0011] In some specific embodiments of the present invention, the expression level of hsa_circRNA_054220 is down-regulated.

[0012] The present invention also provides the application of a product for detecting the expression level of circular non-coding RNA in the preparation of a diagnostic tool for neuromyelitis optica spectrum disorder-related optic neuritis; the circular non-coding RNA is hsa_circRNA_054220.

[0013] In some specific embodiments of the present invention, the expression level of hsa_circRNA_054220 is down-regulated.

[0014] In some specific embodiments of the present invention, the product includes: reagents for detecting the expression level of the circular non-coding RNA by real-time fluorescence quantitative PCR.

[0015] In some specific embodiments of the present invention, the product is a primer for specifically amplifying the circular non-coding RNA, and the sequences are as shown in SEQ ID No.2-3.

[0016] In addition, the present invention also provides a product for detecting the expression level of circular non-coding RNA, including a primer for specifically amplifying the circular non-coding RNA; the circular non-coding RNA is hsa_circRNA_054220.

[0017] In some specific embodiments of the present invention, the sequences of the primers are as shown in SEQ ID No.2-3.

[0018] In some specific embodiments of the present invention, the samples for detection include cerebrospinal fluid, plasma, and whole blood samples.

[0019] In addition, the present invention also provides a kit for detecting the expression level of circular non-coding RNA, including the above product and acceptable reagents.

[0020] The applicant found through experiments that, compared with the control group population, the expression of hsa_circRNA_054220 is down-regulated in the cerebrospinal fluid of patients with neuromyelitis optica spectrum disorder-related optic neuritis. It is suggested that hsa_circRNA_054220 is a low-expression circRNA in neuromyelitis optica spectrum disorder-related optic neuritis and is a biomarker helpful for the diagnosis of neuromyelitis optica spectrum disorder-related optic neuritis. The present invention provides a strong molecular biological basis for the diagnosis of neuromyelitis optica spectrum disorder-related optic neuritis and has far-reaching clinical significance and popularization. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art.

[0022] Figure 1 Shows the heat map of cerebrospinal fluid microarray analysis of the control group and patients with idiopathic optic neuritis; the heat map generated by hierarchical clustering analysis of differentially expressed circular RNAs between the cerebrospinal fluid of the control group (control) and the idiopathic optic neuritis patient group (Test); the color scale shows the relative expression levels of circRNAs in different samples, with red representing up-regulation and green representing down-regulation;

[0023] Figure 2 Volcano plot showing differentially expressed circRNAs in the cerebrospinal fluid of patients with idiopathic optic neuritis; in the figure, the corresponding fold change and P-values are divided by the green straight line, with a fold change up or down by 1.5 times and P < 0.05;

[0024] Figure 3 Results of detecting the target circRNA in cerebrospinal fluid by qPCR amplification; the data in the figure are shown as means±SD (Control n = 4, NMOSD-ON n = 6) *P < 0.05, **P < 0.01, ***P < 0.001; in the figure, hsa_circRNA_054220 is the name in the chip, and the name in circbase is hsa_circRNA_0054220;

[0025] Figure 4 Expression of hsa_circRNA_054220 in cerebrospinal fluid of different groups detected by qPCR; the data in the figure are shown as the median ± interquartile range *P < 0.05; NMOSD-ON is neuromyelitis optica spectrum disorder-related optic neuritis, NC is the control group, and ION is idiopathic optic neuritis;

[0026] Figure 5 ROC curve of hsa_circRNA_054220; AUC = 0.919; P < 0.05;

[0027] Figure 6 Expression of hsa_circRNA_054220 in plasma of different groups detected by qPCR; the data in the figure are shown as the median ± interquartile range *P < 0.05;

[0028] Figure 7 Amplification curve of hsa_circRNA_406587;

[0029] Figure 8 Dissolution curve of hsa_circRNA_406587

[0030] Figure 9 Sequencing of the qPCR product of hsa_circRNA_406587;

[0031] Figure 10 Comparison of the sequencing results of the hsa_circRNA_406587 product with the database sequence;

[0032] Figure 11 Amplification curve of hsa_circ_054220 amplified by the primers shown in SEQ ID No.4 and 5;

[0033] Figure 12 Show the melting curves of the primers shown in hsa_circ_054220 SEQ ID No.4 and 5;

[0034] Figure 13 Show the sequencing of the primer products shown in hsa_circ_054220 SEQ ID No.4 and 5;

[0035] Figure 14 Show the comparison between the qPCR products of the primers shown in hsa_circ_054220 SEQ ID No.4 and 5 and the database sequences;

[0036] Figure 15 Show the qPCR amplification curves of the primers shown in SEQ IDNo.2 and 3;

[0037] Figure 16 Show the qPCR melting curves of the primers shown in SEQ IDNo.2 and 3;

[0038] Figure 17 Show the results of agarose gel electrophoresis of the products after qPCR amplification with two pairs of primers;

[0039] Figure 18 Show the results of agarose gel electrophoresis of the products after qPCR amplification with the primers shown in SEQ ID No.4 and 5. Detailed implementation manners

[0040] The present invention discloses a circRNA kit and its application for diagnosing molecular markers related to neuromyelitis optica spectrum disorder-associated optic neuritis. Those skilled in the art can draw on the content of this article and appropriately modify the process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and those skilled in the art can obviously make changes or appropriate alterations and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0041] The present invention provides a circular non-coding RNA for the early diagnosis of neuromyelitis optica spectrum disorder-associated optic neuritis, which is of great significance for the detection of the onset of NMOSD-ON. The molecular marker hsa_circRNA_054220 (shown in SEQ ID No.1) for the early diagnosis of NMOSD-ON, its sequence is (derived from circbase):

[0042] >hsa_circ_054220|NR_037875|LOC728730

[0043] GAAGAAGAGGATTTATCTGACTCAACTGGAGATGGCTCCCTTCCCTTAT TTATTGTTGCATCCTGAAGCTTCCCCCATGCTGGGCTCAGTGTGAACAAACAGCGCGGGAGAATGCAACCACTGCAGAGGCATATGTTTGAGATACC TGGCCACTGGAGGTCATCTCGTCTACTATATTCACCGCAGATAAAGAAT GAAAAGAGAATACACAACCTTGTGATTGCTAGCAGTGAAAGCTCAGAG TTATGACATAACA

[0044] The present invention also provides the application of the above-mentioned molecular marker hsa_circ_054220. The application of a product for detecting the expression level of hsa_circ_054220 in the preparation of an early diagnosis tool for neuromyelitis optica spectrum disorder-related optic neuritis. The product for detecting the expression level includes: a preparation for detecting the expression level of hsa_circ_054220 by real-time fluorescence quantitative PCR. It includes primers for specifically amplifying hsa_circ_054220. The sequences are shown in Table 1.

[0045] The present invention also provides a kit for the early diagnosis of neuromyelitis optica spectrum disorder-related optic neuritis, which contains reagents for detecting the expression level of hsa_circ_054220, and contains a pair of primers for specifically amplifying hsa_circ_054220 by real-time fluorescence quantitative PCR, and its primer sequences. The applicant found that compared with the control group, the expression of hsa_circRNA_054220 was down-regulated in the aqueous cerebrospinal fluid of patients with neuromyelitis optica spectrum disorder-related optic neuritis. It is suggested that hsa_circRNA_054220 is a low-expression circRNA in neuromyelitis optica spectrum disorder-related optic neuritis and is a biomarker helpful for the diagnosis of neuromyelitis optica spectrum disorder-related optic neuritis. The present invention provides a strong molecular biological basis for the diagnosis of neuromyelitis optica spectrum disorder-related optic neuritis, and has far-reaching clinical significance and popularization.

[0046] The sample used in this technical solution is cerebrospinal fluid. Since neuromyelitis optica spectrum disorder-related optic neuritis is often combined with systemic diseases, other commonly used clinical samples such as plasma and whole blood samples can also be used for the experiment. This experiment has also used plasma for the experiment and found that the statistical difference in the expression level between the patient group and the control group is small, and the diagnostic value is lower than that of cerebrospinal fluid samples. As Figure 6 shown.

[0047] circRNA has the advantages of good stability and non-degradation, and has a high auxiliary diagnostic value, which is conducive to clinical promotion and use. We used circRNA chip detection to obtain the expression spectrum of abnormally expressed cerebrospinal fluid circRNAs, and applied qRT-PCR method for verification, with a rigorous design and mature evaluation system. For the first time, hsa_circRNA_054220 in cerebrospinal fluid was found as an important biological detection indicator. The detection indicator is minimally invasive and inexpensive, and can be widely used in clinical detection to solve the problems of long clinical diagnosis time, cumbersome process, high cost and low sensitivity of optic neuritis associated with neuromyelitis optica spectrum disease. It provides new ideas for the diagnosis of optic neuritis associated with neuromyelitis optica spectrum disease, and at the same time provides new directions for improving the pathogenesis and therapeutic targets of optic neuritis associated with neuromyelitis optica spectrum disease.

[0048] In the diagnostic molecular marker circRNA kit for neuromyelitis optica spectrum disease-associated optic neuritis and its application provided by the present invention, the raw materials and reagents used can be purchased on the market.

[0049] The present invention will be further described below in conjunction with embodiments:

[0050] Example 1 Establishment of circRNA expression profile of idiopathic optic neuritis

[0051] 1. Sample collection

[0052] This study has been approved by the Ethics Committee of the Second Xiangya Hospital of Central South University. All cerebrospinal fluid samples were obtained by lumbar puncture: the patient was asked to take the chest-knee position, the L3 / 4 intervertebral space was used as the puncture point, routine disinfection, puncture after layer-by-layer local anesthesia with 2% lidocaine, and 1ml of cerebrospinal fluid was collected using ordinary tubes, and each tube of cryopreservation tubes was divided into 250ul, and stored in a -80℃ refrigerator within 15 minutes of ex vivo for circRNA biomarker analysis.

[0053] Inclusion criteria for NMOSD-ON: 1) meeting the 2015 International Consensus on Diagnostic Criteria for NMOSD, 2) acute optic neuritis, 3) MRI showing optic nerve swelling, thickening, and demyelinating changes; 4) abnormal VEP. Exclusion criteria: 1) ischemic, traumatic, compressive and infiltrative, toxic, nutritional metabolic, hereditary optic neuropathy, etc.; 2) other retinal diseases, glaucoma and other ophthalmic diseases.

[0054] Inclusion criteria for the control group: 1) Clinical diagnosis of headache; 2) No obvious abnormality in head MRI; 3) Negative results in biochemical, routine, Gram staining, acid-fast, and ink staining of cerebrospinal fluid; 4) No history of ophthalmic diseases, systemic infectious diseases, trauma, and genetic diseases.

[0055] 2. RNA Extraction

[0056] Take out the cerebrospinal fluid from an -80 °C refrigerator. After thawing, centrifuge at 4 °C and 12,000×g for 10 minutes to remove any possible impurities. Take 250 μl of the cerebrospinal fluid and transfer it to a 1.5 ml centrifuge tube. Add 750 μl of TRIzol LS Reagent (Invitrogen life technologies) and manually shake the tube vigorously until well mixed. Incubate at 15 to 30 °C for 5 minutes to completely dissociate the nucleic acid-protein complexes. Add 0.2 ml of chloroform to each tube and tightly cap the tube. Manually shake the tube vigorously for 15 seconds and then incubate at 15 to 30 °C for 2 to 3 minutes. Centrifuge at 12,000×g at 4 °C for 15 minutes. Transfer the upper colorless aqueous phase to a new centrifuge tube and add 500 μl of isopropanol to precipitate the RNA therein. After mixing, incubate at 15 to 30 °C for 10 minutes and centrifuge at 12,000×g at 4 °C for 10 minutes. Remove the supernatant, add at least 1 ml of 75% ethanol to wash the RNA precipitate. After shaking, centrifuge at 7,500×g at 4 °C for 5 minutes. Remove the ethanol solution and air-dry the RNA precipitate for 5 - 10 minutes, and then add 15 μl of RNase-free water.

[0057] 3. cRNA Synthesis and Labeling

[0058] Use Rnase R to remove linear RNA and enrich circRNA. Using the random primer method, amplify circRNA according to the kit instructions and reverse transcribe (Arraystar Super RNA Labeling kit) it into fluorescently labeled cRNA. The labeled cRNA is purified by RNeasy Mini Kit (Qiagen). Use NanoDrop ND-1000 to measure the concentration and activity of the labeled cRNA.

[0059] 4. Microarray Hybridization and Data Analysis

[0060] Hybridize the labeled probe and the microarray (Human Circular RNA Array 2.0) under standard conditions. Use an Agilent Scanner G2505C to scan the fluorescence intensity of the microarray and convert and save the experimental result data. A P value < 0.05 indicates a statistically significant difference.

[0061] 5. Results

[0062] Cerebrospinal fluid is a commonly used body fluid sample in clinical practice. Since it is easily obtainable clinically, has individual specificity, and directly participates in maintaining the microenvironment of the central nervous system, it is suitable as a research object for biomarker-related studies. Currently, there have been various research reports using cerebrospinal fluid as a medium for the diagnosis of central nervous system diseases and it is widely used in clinical practice. Therefore, we believe that cerebrospinal fluid has the potential to be applied to the study of idiopathic optic neuritis. Among 10 cerebrospinal fluid samples (4 in the control group and 6 in the patient group), the chip detection targets included 13,617. After filtering out circRNAs with too low fluorescence intensity, a total of 3,476 target circRNAs ( Figure 1 ) were detected. Among them, the target circRNAs with significant differential expression (Fold Change≥1.5 and P-value<0.05) included 55 up-regulated targets and 149 down-regulated targets ( Figure 2 ). Currently, this is the first established expression profile of cerebrospinal fluid-related circRNAs in idiopathic optic neuritis.

[0063] Example 2 qRT-PCR verification

[0064] Fourteen target circRNAs with significant differential expression were selected from the previously established expression profile and verified again in 10 samples using qPT-PCR. The differential expression levels of 2 circRNAs in the cerebrospinal fluid of the two groups were statistically significant, and the change trend was consistent with that of the chip. hsa_circRNA_406587 and hsa_circRNA_054220 were down-regulated compared with the control group ( Figure 3 ). Then, the circRNA with statistical significance: hsa_circRNA_054220 was selected for further verification.

[0065] Example 3 Further verification with an expanded sample size using qRT-PCR

[0066] The expression level of hsa_circRNA_054220 in cerebrospinal fluid was examined to test its diagnostic value

[0067] 1. Sample collection and total RNA extraction were the same as before.

[0068] 2. cDNA synthesis and qRT-PCR

[0069] Use the RevertAid First Strand cDNA Synthesis Kit (Thermofisher) to prepare the reverse transcription system according to the instructions for reverse transcription. The reverse transcription products can be stored at -20 °C or used immediately. Download the circRNA sequences through the circbase database or the UCSC genome browser, and use the primer design software Primer 5.0 to design primers for the target sequence and the reference sequence. (Table 1) Use 2X FastStart Universal SYBR Green Master (Roche) for qPCR detection. Place the 96-well plate on a Realtime PCR instrument (StepOnePlus TM Real-Time PCR System, Applied Biosystems) for reaction. The conditions are 95 °C for 10 minutes; 40 PCR cycles (95 °C for 10 seconds; 60 °C for 60 seconds). After the amplification reaction, establish the melting curve of the PCR product.

[0070] Table 1 circRNA primer sequences

[0071]

[0072] 3. Calculate the results using the -2ΔΔCt method. Measurement data are expressed as the median ± interquartile range, and the Mann-whitney U test is used. A P value < 0.05 indicates a statistically significant difference (Table 2).

[0073] 4. Results

[0074] We detected the expression level of hsa_circRNA_054220 in 26 cerebrospinal fluid samples (11 samples from NMOSD-ON patients, 6 samples from ION (idiopathic optic neuritis) patients, and 9 control samples, with no statistically significant differences in age and gender). The results showed that the expression level of hsa_circRNA_054220 in NMOSD-ON patients was significantly decreased compared with the control group, while there was no statistically significant difference in the expression level of hsa_circRNA_054220 between ION patients and the control group, indicating that hsa_circRNA_054220 can specifically diagnose NMOSD-ON and differentiate it from ION (Figure 4).

[0075] Table 2 Expression levels of hsa_circRNA_054220 in different groups

[0076]

[0077] 5. To further verify the effectiveness of hsa_circRNA_054220 in diagnosing NMOSD-ON in cerebrospinal fluid, we plotted the receiver operating characteristic (ROC) curve ( Figure 5 ). It was found that the area under the ROC curve of hsa_circRNA_054220 in diagnosing NMOSD-ON in cerebrospinal fluid samples was 0.919. When the diagnostic value of hsa_circRNA_054220 in cerebrospinal fluid was set at 0.433, its diagnostic sensitivity and specificity were 1.00 and 0.889 respectively ( Figure 5 ).

[0078] Example 4 Detection using plasma as a sample

[0079] The present invention has also conducted tests using plasma and found that the statistical difference in expression levels between patients and the control group is relatively small, and the diagnostic value is lower than that of cerebrospinal fluid samples. The results are as Figure 6 shown.

[0080] Example 5 Specificity of NMOSD-ON

[0081] Regarding the index hsa_circ_054220, we can see its specificity for NMOSD-ON from the following figure. The other types of idiopathic optic neuritis group (ION) do not have specificity, as Figure 4 shown.

[0082] hsa_circRNA_406587 could not obtain stable and effective amplification for NMOSD-ON in subsequent qPCR experiments on cerebrospinal fluid ( Figure 7 ), the product specificity was poor ( Figure 8 ), and the product was sequenced ( Figure 9 ) and did not match the database sequence ( Figure 10 ). The hsa_circ_054220 index of the present invention has a reliable amplification curve, melting curve, and product sequencing results for NMOSD-ON ( Figures 11 - 14 ).

[0083] Example 6 Comparison of primer amplification effects

[0084] The method for designing primers against hsa_circ_054220 is as follows: splice the first 150 bp and the last 150 bp of the target circRNA sequence, with the last 150 bp as the first sequence after splicing, and use primer-blast (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome) to design primers for this 300-bp part.

[0085] Verified, primer set 1 could not effectively amplify the target, and the product length was incorrect ( Figure 15 - 17). The amplification curve and melting curve of set 2 are as shown in Figure 18 and its product length is correct.

[0086] Table 3

[0087]

[0088] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. Use of a product for detecting the expression level of circular non-coding RNA in the preparation of a diagnostic tool for neuromyelitis optica spectrum disorder-related optic neuritis; the circular non-coding RNA is hsa_circRNA_054220; The sample for the detection is selected from cerebrospinal fluid.

2. The use according to claim 1, wherein The expression level of hsa_circRNA_054220 is down-regulated.

3. The use according to claim 1 or 2, wherein The product includes: a reagent for detecting the expression level of the circular non-coding RNA by real-time fluorescence quantitative PCR.

4. The use according to claim 3, wherein The product is a primer for specifically amplifying the circular non-coding RNA, and the sequences are shown as SEQ ID No.4-5.

Citation Information

Patent Citations

  • Molecular marker circRNA for diagnosing idiopathic optic neuritis, kit and application

    CN111733227A