Method and kit for evaluating mast cell polarization typing

By detecting the expression of mast cell characteristic enzymes TPSB2 and cytokines CCL27, TNF-α, CCL3, IL-16, and VEGFA, a MC1 and MC2 polarization detection kit was constructed, which solved the evaluation problem of mast cell polarization typing, achieved rapid and accurate polarization status recognition, and provided an effective tool for cancer diagnosis and treatment.

CN120350122APending Publication Date: 2025-07-22NORTH CHINA PETROLEUM BUREAU GENERAL HOSPITAL +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510548963.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-28
Publication Date
2025-07-22

AI Technical Summary

Technical Problem

The prior art has not yet clearly defined that mast cells appear as pro-tumor or anti-tumor phenotypes under different conditions, lack effective polarization typing markers and evaluation methods, affecting the target selection of cancer treatment.

Method used

By detecting the expression levels of mast cell characteristic enzymes TPSB2 and cytokines CCL27, TNF-α, CCL3, IL-16, and VEGFA, a MC1 and MC2 polarization detection kit was constructed, and the mast cell polarization was induced by LPS and C48/80, combined with qRT-PCR and ELISA technology, the polarization status of mast cells was rapidly evaluated.

Benefits of technology

It provides a fast and accurate method of mast cell polarization typing evaluation, helping to identify functions of different polarization states, providing immunotherapeutic targets for cancer diagnosis and treatment, and assisting in the diagnosis and treatment of cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350122A_ABST
    Figure CN120350122A_ABST
Patent Text Reader

Abstract

The invention discloses application of a mast cell polarization typing detection kit, and belongs to the field of biological medicine. The kit comprises a mast cell characteristic enzyme TPSB2 detection reagent, and one or more of a mast cell MC1 type polarization detection reagent and a mast cell MC2 type polarization detection reagent, the MC1 type polarization is CCL27, and the expression of TNF-alpha is up-regulated; and the MC2 type polarization comprises expression up-regulation of CCL3, IL-16 and VEGFA (vascular endothelial growth factor A). Mstoma cells have dual effects in a tumor microenvironment, can promote tumor progression, and also can enhance anti-tumor immune response. The mastocyte polarization typing is identified through the expression level of the biomarker, so that the mastocyte polarization typing can be rapidly and accurately evaluated, identification indexes and tools are provided for further discussing the functions of mastocytes in different polarization states, cancer diagnosis can be assisted, the onset risk of cancer can be reduced, and the method is suitable for popularization and application. And an immunotherapy target is provided for clinical treatment of cancers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and particularly to a method and kit for rapidly evaluating the polarization classification of mast cells by detecting related characteristic cytokines. Background Art

[0002] Mast cells (MCs), as tissue-resident immune cells, are involved in the pathological processes of various diseases such as inflammation and cancer. Mast cells are the main participants in allergic reactions. Through the activation of the FcεRI receptor mediated by IgE, they release mediators such as histamine and leukotrienes, triggering symptoms such as itching and tearing. They can sense tissue damage signals through multiple receptors, release inflammatory mediators and chemokines, and produce inflammatory responses. They participate in antibacterial, anti-parasitic and antiviral infections by recognizing pathogen-associated molecular patterns through pattern recognition receptors, and can secrete growth factors to participate in tissue repair and wound healing.

[0003] The activation of mast cells is mainly mediated by their surface receptors, including high-affinity IgE receptors and other non-IgE pathway receptors. When these receptors are activated, mast cells degranulate, releasing pre-synthesized mediators (such as histamine, leukotrienes, prostaglandins) and newly synthesized cytokines and chemokines. The granules of mast cells are the material basis for their function, and are divided into two major categories: preformed granules and newly formed granules. The latest research shows that activated MCs promote tumor cell proliferation, change the composition of the TME, affect fibroblast polarization and immune cell infiltration, and reducing MCs can limit tumor growth. However, some studies have also found that MCs can inhibit neuroendocrine prostate cancer by promoting the production of stromal cell protein and osteopontin.

[0004] Since MCs can infiltrate solid tumors and promote or limit tumor growth, some scholars have proposed that MCs may exhibit different phenotypes of promoting or anti-tumor under different conditions. However, the existing research has not clearly defined the markers for the polarization classification of mast cells, nor accurately defined the roles of different types of mast cells in cancer. Summary of the Invention

[0005] Aiming at the deficiencies of the prior art, the present invention proposes a method and kit for evaluating the polarization classification of mast cells, which helps to rapidly evaluate the polarization state of mast cells. The present invention identifies the polarization classification of mast cells by detecting the expression levels of characteristic cytokines of MCs, provides identification indexes and tools for further exploring the functions of mast cells in different polarization states, and provides immune therapy targets for cancer clinical treatment.

[0006] The object of the present invention can be achieved by the following technical solutions:

[0007] In a first aspect of the present invention, there is provided a kit for detecting the polarization state of mast cells, comprising: a detection reagent for the mast cell characteristic enzyme TPSB2, and one or more of a detection reagent for MC1-type polarization of mast cells and a detection reagent for MC2-type polarization of mast cells;

[0008] The detection reagent for MC1-type polarization comprises detection reagents for CCL27 and TNF-α, and the detection reagent for MC2-type polarization comprises detection reagents for CCL3, IL-16, and VEGFA;

[0009] The MC1-type polarization is characterized by up-regulated expression of CCL27 and TNF-α; the MC2-type polarization is characterized by up-regulated expression of CCL3, IL-16, and VEGFA.

[0010] In a second aspect of the present invention, there is provided the use of a detection reagent for the mast cell characteristic enzyme TPSB2, and one or more of a detection reagent for MC1-type polarization of mast cells and a detection reagent for MC2-type polarization of mast cells, in the preparation of a kit for detecting mast cell polarization; the mast cell polarization state includes MC1-type polarization and / or MC2-type polarization; the MC1-type polarization is characterized by up-regulated expression of CCL27 and TNF-α; the MC2-type polarization is characterized by up-regulated expression of CCL3, IL-16, and VEGFA.

[0011] Optionally, the detection reagent includes: qRT-PCR reagent, ELISA reagent, or specific primers.

[0012] Optionally, the specific primers include: CCL27-F and CCL27-R, with nucleotide sequences GCAGCATTCCTACT GCCAC and AGGTGAAGCACGAAAGCCTG respectively; TNF-α-F and TNF-α-R, with nucleotide sequences CCCTGGTATGAGCCCATCTATC and AAAGTAGA CCTGCCCAGACTCG respectively; CCL3-F and CCL3-R, with nucleotide sequences GCTC TCTGCAACCAGTTCTCT and GGCTTCGCTTGGTTAGGAAGA respectively; IL-16-F and IL-16-R, with nucleotide sequences CCTTCAGTCTGGTCAGTCCGTTA TC and AGCACCTTCCTCCTTGTGTAAGATG respectively; VEGFA-F and VEGFA-R, with nucleotide sequences CTGGAGCGTGTACGTTGGT and TTTAACTCA AGCTGCCTCGC respectively; TPSB2-F and TPSB2-R, with nucleotide sequences CAGCGAGTGGGCATCGTT and TGCATCCAGTATCGGTCGC respectively.

[0013] The third aspect of the present invention relates to the use of a kit for detecting the polarization state of mast cells in the preparation of a product for esophageal cancer diagnosis or prognosis assessment, characterized in that the polarization state of mast cells includes MC1-type polarization and / or MC2-type polarization; the MC1-type polarization is the up-regulation of the expression of CCL27 and TNF-α; the MC2-type polarization includes the up-regulation of the expression of CCL3, IL-16 and VEGFA.

[0014] The fourth aspect of the present invention relates to the use of LPS in the preparation of a reagent for inducing MC1-type polarization of mast cells, characterized in that the MC1-type polarization is the up-regulation of the expression of CCL27 and TNF-α.

[0015] The fifth aspect of the present invention relates to a method for inducing mast cell polarization in vitro, comprising the following steps: treating mast cells in vitro with lipopolysaccharide.

[0016] The sixth aspect of the present invention relates to a method for constructing a cell model for functional analysis of cytokines CCL27, TNF-α, CCL3, IL-16 and VEGFA as mast cell polarization markers, comprising the following steps:

[0017] Detecting and analyzing the characteristic cytokines produced by HMC-1 cells under the action of LPS and C48 / 80, and observing the effect of the characteristic cytokines on the cell polarization state of mast cells;

[0018] Constructing a characteristic cytokine profile through RT-PCR and ELISA experiments, analyzing the expression level and concentration of the characteristic cytokines, and identifying the mast cell polarization classification.

[0019] Specifically, a high-throughput liquid chip technology is used to detect and analyze the characteristic cytokines produced by HMC-1 cells under the action of lipopolysaccharide and N-methyl p-methoxyphenethylamine formaldehyde condensate, and observe the effect of the characteristic cytokines on the polarization state of mast cells;

[0020] Constructing a characteristic cytokine profile through RT-PCR and ELISA experiments, analyzing the expression level and concentration of the characteristic cytokines, and identifying the mast cell polarization classification.

[0021] Optionally, the detection of characteristic cytokines includes: the average value, standard deviation and difference level of the production of each cytokine.

[0022] Optionally, the characteristic cytokine profile constructed by the RT-PCR experiment is the mRNA expression level of the characteristic cytokines.

[0023] Optionally, the characteristic cytokine profile constructed by the ELISA experiment is the concentration of the characteristic cytokines.

[0024] The reagents are qRT-PCR reagents and ELISA reagents for detecting the expression levels of CCL27, TNF-α, CCL3, IL-16, VEGFA, and TPSB2.

[0025] The reagents include specific primers that can recognize the cytokines CCL27, TNF-α, CCL3, IL-16, VEGFA, and TPSB2.

[0026] The capture antibody and detection antibody of the kit bind to different antigenic epitopes of each cytokine respectively.

[0027] Optionally, the detection antibody carries a detectable label.

[0028] Optionally, the method of using the kit includes: the capture antibody of each cytokine captures the target antigen to form a stable antigen-antibody complex, the detection antibody binds to the target antigen to form an "antigen-capture antibody-detection antibody" complex, and after the reaction, it is detected using an enzyme-linked immunosorbent assay (ELISA) reader.

[0029] Advantages of the present invention:

[0030] The present invention for the first time reveals the application of the identification of mast cell polarization typing, and for the first time proposes markers for LPS- and C48 / 80-induced mast cell polarization typing. Based on the expression of TPSB2, which serves as a marker of mast cell function, the markers of the MC1 anti-cancer phenotype induced by LPS are CCL27 and TNF-α, and the markers of the MC2 pro-cancer phenotype induced by C48 / 80 are CCL3, IL-16, and VEGFA. A kit for detecting mast cell polarization typing is established based on qRT-PCR and ELISA sandwich method, which can quickly and efficiently obtain the expression of characteristic cytokines, help to quickly and accurately identify and evaluate the polarization state of mast cells, and provide a new and effective method for detecting mast cell polarization typing. It is helpful for the auxiliary diagnosis of cancer and provides immune therapy targets for the clinical treatment of cancer. Description of the drawings

[0031] The present invention will be further described below with reference to the drawings.

[0032] Figure 1 : Differentiation and identification of mast cells in the examples of the present invention;

[0033] Figure 2 : Activation of mast cells by LPS and C48 / 80 in the examples of the present invention;

[0034] Figure 3 : Effects of LPS- and C48 / 80-induced mast cells on esophageal cancer cells in the examples of the present invention;

[0035] Figure 4 : The cytokine volcano plot and heat map of LPS- and C48 / 80-induced HMC-1 cells in the examples of the present invention;

[0036] Figure 5 : The cytokine spectra of different polarization phenotypes of LPS- and C48 / 80-induced HMC-1 cells in the examples of the present invention;

[0037] Figure 6 : The result map of polarization typing of mast cells detected by qRT-PCR in the examples of the present invention;

[0038] Figure 7 : The result map of polarization typing of mast cells detected by ELISA in the examples of the present invention;

[0039] Figure 8 : The result map of the infiltration level of mast cells in esophageal cancer tissues and adjacent tissues in the examples of the present invention;

[0040] Figure 9 : The result map of toluidine blue staining of mast cell activation in esophageal cancer tissues in the examples of the present invention.

[0041] Figure 10 : The cytokine expression feature map of mast cell subsets in esophageal cancer tissues in the examples of the present invention.

[0042] Figure 11 : The expression of different cytokines in MC1 type and MC2 type. Detailed implementation manners

[0043] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0044] Example 1 Mast cell function markers and activation phenotypes

[0045] 1. Extraction of mast cell BMMC

[0046] 1) For C57BL / 6 male mice, after decapitation, the femurs and tibias are separated in a laminar flow hood. The separated femurs and tibias are placed in a 10-cm culture dish and soaked in 5 mL of 75% ethanol for 3 min;

[0047] 2) After soaking, take a new 10-cm culture dish, add 5 mL of PBS, and place the tibias and femurs in PBS for soaking;

[0048] 3) Place a 100-μm cell sieve on a 50-mL centrifuge tube. Use scissors sterilized by high pressure to cut off both ends of the femur and tibia, and use a 1-mL sterile syringe to aspirate PBS to rinse the bone marrow cavity and filter it through a 100-mesh cell sieve.

[0049] 4) For the filtered cells, centrifuge at 500 g for 5 min, discard the supernatant, add 1× red blood cell lysate to resuspend, let stand for 5 min, centrifuge at 500 g for 5 min, discard the supernatant, and then resuspend with the special medium for BMMC.

[0050] 5) Take out 10 μL of the resuspended cells and mix them with trypan blue staining solution (9:1). Use a cell counter to count the number of viable cells. If the viable cell count > 90%, it can be used for subsequent cell culture. Adjust the cell concentration to 3×10 6 / mL, place it in a 75-cm2 culture flask, and culture it at 37 °C and 5% CO2. Change the medium once every 7 days. After culturing for 4 - 6 weeks, identify the differentiation results of BMMC cells by toluidine blue staining, flow cytometry, and WB.

[0051] 2. Identification of BMMC cells

[0052] 1) Identification of BMMC surface markers (CD117 and FcεR1α) by flow cytometry

[0053] ① Adjust the concentration of cells at different differentiation times to 2×10 6 / mL, set up a blank group, a single-staining group with APC-CD117, a single-staining group with FITC-FcεR1α, and a double-staining group with APC-CD117 and FITC-FcεR1α, and incubate them with APC-CD117 and FITC-FcεR1α respectively.

[0054] ② After incubating at room temperature in the dark for 30 min, wash twice with PBS and resuspend with 400 μL of PBS.

[0055] ③ Detect by flow cytometry, and analyze the purity of bone marrow-derived mast cells BMMC. If the purity is greater than 95%, it can be used for subsequent experiments.

[0056] 2) Identification of BMMC functional marker (TPSB2) by WB

[0057] ① Tissue protein extraction: Take 30 mg of fresh esophageal cancer tissue and its adjacent tissue, add 500 μL of RIPA lysis buffer, 1× protease inhibitor, and 1× phosphatase inhibitor. Additionally, add 2 steel beads and grind in a tissue grinder. The grinding conditions are 4 °C, 50 HZ, and 5 min; after grinding, lyse on ice for 30 min, centrifuge at 13,000 rpm and 4 °C for 15 min, and collect the supernatant.

[0058] ② Protein BCA quantification: Take 2 μL of each sample, dilute it 10 times, and then perform BCA quantification. Calculate the protein content of the sample according to the standard curve. Add 1× SDS loading buffer and boil it in a boiling water bath at 100 °C for 5 min.

[0059] ③ SDS electrophoresis: The loading amount is 40 μg per well. Add 5 μL of the three-color prestained protein marker to the leftmost well. Electrophorese at 90 V until the upper stacking gel runs out, then change to 120 V and stop electrophoresis at an appropriate position.

[0060] ④ Transfer membrane: Cut PVDF membranes matching the number of loaded samples and soak them in methanol for 30 s. Place them in the transfer tank in the order of cathode sponge pad - gel - membrane - sponge pad - anode according to the sandwich structure, and then transfer the membrane in a chromatography cabinet at 4 °C. Determine the transfer time according to the size of the protein kDa. Generally, the transfer condition is 400 mA for 1.2 h.

[0061] ⑤ Incubate with primary antibody: After the transfer is completed, wash the membrane 3 times with 1× TBST for 5 min each time, then add 5 mL of skim milk powder to block for 2 h. Cut the membrane according to the size of the gene kDa, place it in the corresponding primary antibody dilution solution, and incubate overnight at 4 °C on a shaker (70 rpm).

[0062] ⑥ Incubate with secondary antibody: After the incubation with the primary antibody is completed, wash the membrane 5 times with 1× TBST for 5 min each time, then add the corresponding species-specific secondary antibody dilution solution and incubate on a shaker (80 rpm) for 2 h. After the incubation is completed, wash the membrane 3 times with 1× TBST for 5 min each time. Add the substrate for color development and then analyze the gray value of each band using Image J software. The ratio of the target gene to the internal reference gene is used as the relative expression level of this gene.

[0063] 3) Results:

[0064] Detect the double-positive staining of the surface markers CD117 and FcεR1A of bone marrow cells (BMC) at different time periods by flow cytometry. As Figure 1 shown in A - C of Figure 1 , the double-positive rate of cells at 10 days is only 54.9% ( Figure 1 A of Figure 1 ), the double-positive rate at 20 days is 85.3% ( Figure 1 B of

[0065] ), and until 30 days, the double-positive rate reaches 99.1% ( Figure 1 C of Figure 1 ), and they are basically differentiated into bone marrow-derived mast cells (BMMC) ( Figure 1 A - C of

[0065] ). TPSB2 is a trypsin specifically expressed in mast cells. The protein expression levels of TPSB2 in BMC and BMMC were analyzed by WB experiments. The results showed that the protein expression of TPSB2 in BMMC cells was significantly higher than that in BMC (P < 0.05), indicating that BMMC cells were well differentiated and active.Figure 1 in D-E).

[0066] 3. Resuscitation and culture of mast cells HMC-1, BMMC cells and esophageal cancer cells EC109

[0067] The HMC-1 cells, BMMC cells, and EC109 cells cryopreserved at -80 °C were placed in a 37 °C constant temperature water bath and quickly thawed within two minutes. After thawing, fresh 1640 complete medium was added to the HMC-1 cells and EC109 cells, and fresh BMMC special medium was added to the BMMC cells. They were cultured in a 5% CO2, 37 °C constant temperature cell culture incubator. Passage was performed after 1-2 days. The HMC-1 cells and BMMC cells are suspension cells. After centrifugation, they were washed with PBS, and after centrifugation again, fresh medium was added and aliquoted into clean suspension cell-specific culture flasks. When the EC109 cells reached 80%, they were rinsed with PBS and then digested with trypsin digestion solution for 2 min. After adding fresh medium to terminate the digestion, they were aliquoted into clean medium again.

[0068] 4. Activation of mast cells

[0069] 1) Determination of β-hexosaminidase release to analyze the activation status of cells

[0070] ① Centrifuge to collect HMC-1 cells and BMMC cells, dilute LPS and C48 / 80 to the treatment concentration with the corresponding medium, resuspend the above cells with this, and inoculate them in a 96-well plate at 1×10 6 / well, and after co-culturing for 24 h, centrifuge at 1800 rpm / min for 5 min, aspirate 50 μL of the supernatant into another 96-well plate, and add 50 μL of 4-nitrophenyl N-acetyl-β-D-glucosamine to each well and incubate at 37 °C for 1 h.

[0071] ② Add 50 μL of 0.1% Triton X-100 to the cell pellet in each well to lyse the cells at room temperature for 10 min. Centrifuge at 1800 rpm / min for 5 min, aspirate 50 μL of the supernatant into another 96-well plate, and add 50 μL of 4-nitrophenyl N-acetyl-β-D-glucosamine to each well and incubate at 37 °C for 1 h.

[0072] ③ After incubation, measure the absorbance at 405 nm. Calculate the release of β-hexosaminidase in MCs according to Formula 2.

[0073] 2) Toluidine blue staining to analyze the activation status of cells

[0074] ①Cover slip treatment: 10 mg of polylysine was dissolved in 1 mL of ultrapure water and stored at -20 °C for later use. 0.1 mg / mL of polylysine was added to a 12-well plate and incubated at 4 °C overnight for coating. Subsequently, the polylysine was aspirated, and the plate was dried in an incubator at 37 °C for 2 h. After rinsing with PBS before use, it could be used for cell culture.

[0075] ②Cell treatment: 1.5×10 6 cells were seeded in a 6-well plate coated with polylysine for 24 h and then treated with different concentrations of LPS and C48 / 80 for 24 h.

[0076] ③Staining: Toluidine blue dye was used to stain HMC-1 and BMMC cells after different treatments for 5 min, and then differentiated with 95% ethanol for 2 min. After differentiation, the cells were washed 3 times with PBS, air-dried, and the cell staining was observed under a microscope.

[0077] 3) Results:

[0078] The release of β-hexosaminidase is a specific indicator of mast cell activation. To understand the activation status of MCs under the action of exogenous LPS and C48 / 80, the release of β-hexosaminidase from mast cells was analyzed under the action of different concentrations of LPS and C48 / 80. The results showed that LPS at a concentration of 0.001 μg / mL and C48 / 80 at a concentration of 1 μg / mL promoted the release of β-hexosaminidase from mast cells (P<0.05), suggesting that both LPS and C48 / 80 could activate mast cells ( Figure 2 in A-D).

[0079] Mast cell degranulation is a key phenotype of mast cell activation. The toluidine blue staining results showed that the cytoplasm of mast cells in the control group presented dense blue and the cells were oval-shaped, while the cytoplasm color of mast cells treated with LPS and C48 / 80 became lighter, the cell morphology was irregular, and scattered dots appeared around the cells, which were the granular substances released by mast cell activation, indicating that both LPS and C48 / 80 could induce mast cell degranulation ( Figure 2 in a-f).

[0080] Example 2 Different effects of LPS and C48 / 80-mediated different polarization phenotypes of mast cells on esophageal cancer cells

[0081] 1. Transwell assay

[0082] 1) Cell treatment: HMC-1 cells and BMMC cells were treated with 0.001 μg / mL LPS and 1 μg / mL C48 / 80 for 24 h, and the cell supernatants were collected and hereinafter referred to as special medium. Esophageal cancer cells (EC109) in the logarithmic phase were seeded at 5×10 5 cells per well in 6-mm culture dishes. After 24 h, they were cultured with the special medium and fresh medium at a ratio of 1:1 for 24 h.

[0083] 2) Cell migration: Single-cell suspensions were prepared by trypsin digestion. 3×10 5 cells were seeded in each chamber. The upper chamber of the chamber was filled with serum-free medium to make up 200 μL, and the lower chamber was added with 600 μL of complete medium containing 20% FBS and cultured for 24 h. After the culture, the chambers were fixed in methanol for 10 min, stained with crystal violet for 15 min, the dye was washed off, and after drying, the number of cells passing through the chambers was photographed and counted under a microscope.

[0084] 3) Cell invasion: The Transwell chambers were pre-coated with a 1:9 matrix gel and placed in a refrigerator at 4 °C for standby. The chambers were placed in an incubator at 37 °C and heated for 1 h. The chambers were taken out, and the upper layer of uncoagulated liquid was aspirated. The cells were digested and collected, and single-cell suspensions were prepared using serum-free medium. 5×10 5 cells were seeded in each chamber. The upper chamber of the chamber was filled with serum-free medium to make up 200 μL, and the lower chamber was added with 600 μL of complete medium containing 20% FBS and cultured for 24 h. After the culture, the chambers were fixed in methanol for 10 min, stained with crystal violet for 15 min, the dye was washed off, and after drying, the number of cells passing through the chambers was photographed and counted under a microscope.

[0085] 4) Results:

[0086] The effects of LPS- and C48 / 80-activated HMC-1 cells and BMMC cells on the invasion and migration of EC109 cells were analyzed by Transwell experiments. The results showed that mast cells treated with LPS decreased the invasion and migration abilities of EC109 cells, while mast cells treated with C48 / 80 increased the invasion and migration abilities of EC109 cells ( Figure 3 A-D in).

[0087] 2. Plate clone experiment

[0088] 1) Cell treatment: HMC-1 cells and BMMC cells were treated with 0.001 μg / mL LPS and 1 μg / mL C48 / 80 for 24 h, and the cell supernatants were collected and hereinafter referred to as special medium. EC109 cells were seeded at 200 cells per well in 6-well plates. After attachment, the special medium for treating mast cells was added and cultured for 2-3 weeks, and the medium was changed every 3 days.

[0089] 2) Clone counting: When single cell clones grow out (50 single cells are visible under the microscope), stop culturing. After rinsing 3 times with PBS, fix with formaldehyde for 10 min, stain with crystal violet for 20 min, then wash off the dye and take pictures to count the number of cell clone formations.

[0090] 3) Results:

[0091] The colony formation assay was used to detect the effects of HMC-1 cells and BMMC cells activated by LPS and C48 / 80 on the colony formation ability of EC109 cells. The results showed that mast cells treated with LPS inhibited the colony formation ability of EC109 cells, while mast cells treated with C48 / 80 enhanced the colony formation ability of EC109 cells ( Figure 3 E in

[0092] 3. Definition of mast cell polarization phenotypes:

[0093] The above results indicate that mast cells induced by LPS and C48 / 80 have opposite effects on esophageal cancer cells, suggesting that LPS and C48 / 80 can induce different mast cell activation phenotypes and play different functions of inhibiting or promoting cancer in the occurrence and development of esophageal cancer. Therefore, we defined the cancer-inhibiting mast cell phenotype induced by LPS as MC1 type, and the cancer-promoting mast cell phenotype induced by C48 / 80 as MC2 type.

[0094] Example 3 Cytokineomics analysis of mast cell polarization phenotypes

[0095] 1) Cell treatment: HMC-1 cells were treated with 0.001 μg / mL LPS and 1 μg / mL C48 / 80 for 24 h. After removing the supernatant, continue culturing with fresh medium for 24 h and collect the supernatant. Centrifuge the cell supernatant sample at 10,000 rpm for 10 min, take the supernatant, and load 50 μL of the original solution for detection.

[0096] 2) Standard preparation: Add 250 μL of StandardDiluent to the standard vial, vortex for 5 s, and incubate on ice for 30 min to dilute the standard curves S1-S8.

[0097] 3) Detection operation:

[0098] ① Sample incubation: Take the beads and shake them at 1,400 rpm on an oscillator for 30 s. Dilute the beads with AssayBuffer; shake the diluted beads again at 1,400 rpm on an oscillator for 30 s, add 50 μL to each well of a 96-well plate, and wash 3 times with a plate washer; take 50 μL of the prepared standard, sample, and Blank and add them to the 96-well plate, stick on a sealing film, place on a plate oscillator, shake at 850 rpm, and incubate at room temperature in the dark for 30 min.

[0099] ② Incubate with detection antibody: Discard the samples and wash the plate 3 times using a plate washer; Add 25 μL of the diluted Detection Antibody to each well, affix the sealing film, place on a plate shaker and shake at 850 rpm, incubate at room temperature in the dark for 30 min.

[0100] ③ Color development: Discard the detection antibody and wash the plate 3 times using a plate washer; Add 50 μL of the diluted Streptavidin-PE to each well, affix the sealing film, place on a plate shaker and shake at 850 rpm, incubate at room temperature in the dark for 10 min; Wash the plate 3 times using a plate washer; Resuspend with 125 μL of Assay Buffer in each well, affix the sealing film, place on a plate shaker and shake at 850 rpm at room temperature in the dark for 2 min; Read the values in a calibrated Bio-Plex machine.

[0101] ④ Standard quality control data: In this example, two replicates of the standard were set for detection. According to the fluorescence detection values (FI) obtained from the standards, the standard curve was fitted using the multi-parameter mode to obtain the standard curve (Standard Curve) and its equation, with the concentration unit of pg / mL. In the standard curve fitting, the software automatically corrects some deviated points and fits the valid points.

[0102] ⑤ Detection of sample concentration: Substitute the original fluorescence detected for each sample into the standard curve formula to calculate the sample concentration, which can be used for comparison between samples.

[0103] ⑥ Data analysis: According to the cytokine concentrations of each sample obtained, analyze the differentially secreted cytokines and perform visual analysis through a heat map.

[0104] 4) Results:

[0105] A total of 75 cytokines were detected in the cytokine profiling analysis based on liquid-phase chip. According to the "limma" package of R version 4.1.2 software, the differentially expressed cytokines produced by HMC-1 cells under the action of LPS and C48 / 80 were analyzed. The average values, standard deviations and their differential levels of each cytokine are shown in Table 1. The results showed that compared with the control group, 1 cytokine (TNFSF10) increased and 4 cytokines decreased in HMC-1 cells under the action of LPS, including LIF, CCL22, M-CSF, CCL3. The volcano plot is as Figure 4A in [specific context]; compared with the control group, 20 cytokines increased in HMC-1 cells under the action of C48 / 80, including CCL3, CCL4, CCL5, CCL8, G-CSF, HGF, IFN-g, IL-15, IL-16, IL-1ra, IL-4, IL-8, M-CSF, MIF, SDF-1a, SCF, VEGF, CCL2, CCL15, TNFSF10, and 6 cytokines decreased, including TNF-α, CCL22, CCL26, CCL25, CXCL16, GM-CSF. The volcano plot is as shown in Figure 4 B in Figure 4 C in Figure 5 ).

[0106] Table 1 Analysis of cytokine groups in HMC-1 cells induced by LPS and C48 / 80

[0107]

[0108]

[0109]

[0110] Note: *P<0.05

[0111] Example 4 Construction and detection kit for mast cell polarization classification markers

[0112] 1. Verification by qRT-PCR and establishment of mast cell polarization classification markers

[0113] 1) Cell treatment: HMC-1 cells were treated with 0.001 μg / mL LPS and 1 μg / mL C48 / 80 for 24 h, the cells were collected, and Trizol was added to extract total RNA.

[0114] 2) Reverse transcription: A 20 μL reverse transcription system was used, adding 1 μg of total RNA, 1 μL of gDNA remover, 4 μL of 5×RT master mix, and DEPC water was added to make up to 20 μL. Incubate at 42 °C for 15 min in a PCR system, and after 85 °C for 5 s, the reverse-transcribed cDNA was stored at 4 °C for standby.

[0115] 3) qPCR amplification: Prepare a 10 μL PCR system, including 5 μL SYBR Mix, 0.2 μL Forward Primer, 0.2 μL Reverse Primer, 1 μL cDNA, and 3.6 μL DEPC water. The reaction program is pre-denaturation at 95°C for 3 min, denaturation at 95°C for 10 s, annealing of the target specific primer at 60°C for 30 s, extension at 72°C for 30 s (40 cycles), and fluorescence signal collection during extension at 72°C for 30 s.

[0116] 4) Data processing and analysis:

[0117] The expression level of the cytokine to be detected is normalized to Actin as the reference gene, and 2 -△t is used to represent its relative level. The larger the 2 -△t value, the higher the actual content.

[0118] 5) Results and analysis:

[0119] Based on the cytokine profile in Example 3, qRT-PCR was further used for verification. The results are as Figure 6 , CCL3, IL-16, and VEGFA decreased in the LPS group (*P < 0.05), while increased in the C48 / 80 group (#P < 0.05); CCL27 and TNF-α increased in the LPS group (*P < 0.05) and decreased in the C48 / 80 group (#P < 0.05). Although some other cytokines showed statistical differences compared with the control group, they did not have this characteristic.

[0120] In summary, based on the upregulation of the key enzyme gene TPSB2 indicating mast cell function, we defined the LPS-induced anti-cancer mast cell polarization phenotype as MC1 type, and for the first time identified its characteristic cytokine expression markers as CCL27 and TNF-α; the C48 / 80-induced pro-cancer mast cell polarization phenotype was defined as MC2 type, and for the first time identified its characteristic cytokine expression markers as CCL3, IL-16, and VEGFA.

[0121] The constructed qRT-PCR mast cell polarization typing kit, in addition to the aforementioned reverse transcription and qPCR reagents, consists of six pairs of specific primers (see Table 2). The judgment criteria for its detection results are as follows: TPSB2 is used as a marker of mast cell function, and the upregulation of CCL27 and TNF-α defines the polarization typing of mast cells as MC1 type, while the upregulation of CCL3, IL-16, and VEGFA defines the polarization typing of mast cells as MC2 type. It also includes LPS and C48 / 80 inducers as the positive standards for MC1 and MC2 type mast cell polarization typing respectively, and the untreated HMC-1 extract as the negative standard.

[0122] Table 2 Cytokine-specific primer sequences of qRT-PCR kits

[0123]

[0124] 2. Mast cell polarization typing ELISA detection kit

[0125] 1) Cell treatment: HMC-1 and BMMC cells were treated with 0.001 μg / mL LPS and 1 μg / mL C48 / 80 for 24 h. After removing the supernatant, the cells were cultured with fresh medium for another 24 h and the supernatant was collected. The cell supernatant samples were centrifuged at 10,000 rpm for 10 min and 50 μL of the stock solution was loaded for detection.

[0126] 2) Double antibody sandwich incubation method:

[0127] ① Add 350 μL of 1× washing solution to the 96-well plate coated with six antibodies (antibodies against TPSB2, CCL27, TNF-α, CCL3, IL-16 and VEGFA) and wash three times, leaving it to stand for 40 seconds each time.

[0128] ②Add 100 μL of the corresponding standard and sample respectively, set up 3 replicate wells, seal the plate and incubate at 37°C for 1-2 hours.

[0129] ③After incubation, wash the plate three times. As in ①, add 100 μL of 1× biotin antibody prepared 15 minutes ago, seal the plate and incubate at 37°C for 30 minutes to 1 hour.

[0130] ④After incubation, wash the plate three times. As in ①, add 100 μL of 1×HRP-streptavidin prepared 15 min before, seal the plate and incubate at 37°C for 30 min.

[0131] ⑤After incubation, wash the plate 3 times. As in ①, add 100 μL TMB substrate to each well, incubate at 36℃ in the dark for 15-20 minutes, then add 50 μL stop solution, immediately place in a preheated microplate reader, measure the OD value at 450nm within 5 minutes, and use the OD value at 570nm to correct non-coloring substances. Calculate the standard curve and the concentration of the corresponding substance.

[0132] 3) Experimental results

[0133] Untreated HMC-1 and BMMC culture supernatants were used as controls, and TPSB2 was used as a marker of mast cell function. LPS could induce upregulation of CCL27 and TNF-α levels in HMC-1 and BMMC, so it was defined as a marker of MC1 type mast cells; C48 / 80 could induce upregulation of CCL3, IL-16 and VEGFA levels in HMC-1 and BMMC, so it was defined as a marker of MC2 type mast cells ( Figure 7)。

[0134] The kit also includes LPS and C48 / 80 inducer as the positive standards for the polarization typing of MC1 and MC2 mast cells respectively, and untreated HMC-1 extract as the negative standard.

[0135] Clinical analysis results of esophageal cancer with mast cell polarization typing in Example 5

[0136] 1. Expression analysis of key genes for mast cell function in esophageal cancer tissues and adjacent tissues

[0137] 1) qRT-PCR analysis of TPSB2

[0138] ① Tissue RNA extraction: Accurately weigh 30 mg each of cancer tissues and adjacent tissues from esophageal cancer patients and place them in 1.5 mL enzyme-free EP tubes. Add 2 steel beads and 1 mL of TRIZOL RNA extraction reagent, and grind in a tissue grinder at 4°C, 50 HZ for 5 min; after grinding, add 200 μL of chloroform, vortex and mix well, and centrifuge at 4°C, 13,000 rpm for 15 min; aspirate the supernatant after centrifugation, add an equal volume of isopropanol, let stand on ice for 10 min, and then centrifuge at 4°C, 10,000 rpm for 10 min; discard the supernatant, add 1 mL of 75% ethanol pre-cooled at 4°C and wash twice, centrifuge at 4°C, 80,000 rpm for 5 min; remove the ethanol, invert and dry at room temperature on filter paper for 10 min; measure the RNA concentration and purity on a nucleic acid concentration detector, and the purity A260 / 280 is preferably between 1.8 - 2.0.

[0139] ② Reverse transcription: Add 1 μg of RNA, 1 μL of gDNA remover, 4 μL of 5×TransScriptAll-in-One SuperMix for qPCR to a 20 μL system, and make up to 20 μL with DEPC water. Incubate in an Eppendorf MasterCycler NexusPCR system according to the following program: 42°C for 15 min, 85°C for 5 s, and then store at 4°C for standby.

[0140] ③ qPCR amplification: Prepare a 10 μL PCR system, including 5 μL of ChamQ SYBR qPCR Master Mix, 0.2 μL of Forward Primer, 0.2 μL of Reverse Primer, 1 μL of cDNA, and 3.6 μL of DEPC water. The reaction program is pre-denaturation at 95°C for 3 min, denaturation at 95°C for 10 s, annealing of the target specific primer at Tm for 30 s, extension at 72°C for 30 s (40 cycles), and fluorescence signals are collected when extending at 72°C for 30 s.

[0141] ④ Calculate the gene expression level: Using Actin as the internal reference gene, the 2-ΔΔt method was used to analyze the relative expression differences of genes in tumor tissues and adjacent non-tumor tissues.

[0142] 2) WB analysis of TPSB2

[0143] ① Tissue protein extraction: Take 30 mg of fresh esophageal cancer tissue and its adjacent tissue, add 500 μL of RIPA lysis buffer, 1× protease inhibitor, and 1× phosphatase inhibitor. Additionally, add 2 steel beads and grind in a tissue grinder at 4°C, 50 HZ for 5 min; after grinding, lyse on ice for 30 min, centrifuge at 13,000 rpm at 4°C for 15 min, and collect the supernatant.

[0144] ② Protein BCA quantification: Take 2 μL of each sample, dilute it 10 times, and then perform BCA quantification. Calculate the protein content of the sample according to the standard curve. Add 1× SDS loading buffer and boil in a 100°C water bath for 5 min.

[0145] ③ SDS electrophoresis: The loading amount is 40 μg per well. Add 5 μL of the prestained protein marker in three colors to the leftmost well. Electrophorese at 90 V until the upper concentrated gel runs out, then change to 120 V and stop electrophoresis at the appropriate position.

[0146] ④ Transfer membrane: Cut a PVDF membrane that matches the number of loaded samples and soak it in methanol for 30 s. Place it in the transfer tank in the order of the sandwich structure: cathode sponge pad - gel - membrane - sponge pad - anode, and then transfer the membrane in a 4°C chromatography cabinet. Determine the transfer time according to the size of the protein kDa. Generally, the transfer conditions are 400 mA for 1.2 h.

[0147] ⑤ Incubate with primary antibody: After the transfer is completed, wash the membrane 3 times with 1× TBST, 5 min each time, and then add 5 mL of skim milk powder to block for 2 h. Cut the membrane according to the size of the gene kDa and place it in the corresponding primary antibody dilution solution, and incubate overnight at 4°C on a shaker (70 rpm).

[0148] ⑥ Incubate with secondary antibody: After the incubation with the primary antibody is completed, wash the membrane 5 times with 1× TBST, 5 min each time, and then add the corresponding species secondary antibody dilution solution and incubate on a shaker (80 rpm) for 2 h. After the incubation is completed, wash the membrane 3 times with 1× TBST, 5 min each time. After adding the substrate for color development, analyze the gray value of each band using the Imag J software. The ratio of the target gene to the internal reference gene is used as the relative expression level of the gene.

[0149] 3) Results:

[0150] The mRNA and protein expression levels of TPSB2 in cancer tissues and adjacent tissues of esophageal cancer patients were analyzed by qRT-PCR and WB experiments to evaluate the relationship between mast cell function and esophageal cancer. The results showed that the mRNA level of TPSB2 in esophageal cancer tissues was higher than that in adjacent tissues ( Figure 8 A in Figure 2), and the protein level of TPSB2 was also significantly increased in esophageal cancer tissues ( Figure 8 B and C in the figure indicate that the level of mast cell infiltration in esophageal cancer tissue is significantly higher than that in adjacent tissues.

[0151] 2. Relationship between mast cell activation and clinical pathological characteristics in esophageal cancer tissue

[0152] 1) Toluidine blue staining

[0153] ① Dewaxing: The collected paraffin sections were placed in xylene for 10 min, anhydrous ethanol, 95% ethanol, 85% ethanol, and 75% ethanol for 5 min each, and then soaked in distilled water for 5 min until the esophageal cancer tissue sections were completely dewaxed.

[0154] ② Staining and observation: Place the slices in toluidine blue staining solution for 10 minutes, then wash off the dye with distilled water, dry and seal the slices, and observe the infiltration type and location of mast cells in the tissue sections under a microscope.

[0155] 2) Results:

[0156] Using tissue sections from patients with esophageal cancer, the relationship between the activation state of mast cells and the clinical pathological characteristics of esophageal cancer was analyzed by toluidine blue staining. Toluidine blue staining can specifically stain mast cells. Mast cells in a resting state have dense blue cytoplasm after toluidine blue staining, while activated mast cells are characterized by blue dye particles around the cells. Figure 9 The results showed that two types of MCs (quiescent and activated) were infiltrated in esophageal cancer tissues, but activated MCs were mainly distributed in the muscularis propria (P<0.05). The number of activated MCs infiltrating the squamous epithelium was 0.67±3.46, Figure 9 a / b / c in the tumor nest (4.48±9.63, Figure 9 f / g / h) and muscularis propria (36.33±37.84, Figure 9 k / i / m in ).

[0157] The infiltration of activated MCs in EC tissues was related to age and esophageal cancer stage. The infiltration was higher in patients aged 65 years or older than that in those aged 65 years or younger, and the infiltration of activated MCs in Stage III patients was higher than that in Stage I and Stage II patients (Table 3). The above results further indicate that activated mast cells are related to the progression of esophageal cancer.

[0158] Table 3 Relationship between mast cells and clinicopathological features in esophageal cancer

[0159]

[0160] Note: *P < 0.05

[0161] 3. Cytokine expression characteristics of mast cell subsets in esophageal cancer tissues

[0162] 1) Single-cell sequencing: Esophageal cancer and adjacent tissues of volunteers were collected to prepare single-cell suspensions, and the DNBelab C series high-throughput single-cell RNA library preparation kit was used to prepare single-cell libraries. After the high-throughput sequencing library preparation processes such as reverse transcription and amplification of mRNA, high-throughput sequencing was performed on the BGI MGI DNBSEQ TM sequencing platform. After the raw data downloaded from the machine was quality controlled, the matching DNBC4tools software was used for bioinformatics analysis such as alignment and quantification, so as to reveal the heterogeneity and gene expression of mast cells at the single-cell level.

[0163] 2) Results:

[0164] Based on the single-cell sequencing data analysis of cancer tissues and adjacent tissues of esophageal cancer patients, the cytokine expression characteristics of mast cell subsets were analyzed. The results showed that all the obtained single-cell data could be clustered into 24 categories. Among them, TPSB2 was highly expressed in cluster11, indicating that these classified cells were mast cells; further analysis of the cytokine expression characteristics of this clustered cell showed that subsets 1, 7, 8, 12, and 13 showed the characteristics of high expression of VEGFA, CCL3, and IL16, indicating that these mast cells were of the MC2 type, suggesting their pro-cancer potential; while subset 9 showed the characteristic of high expression of TNF, indicating that these mast cells were of the MC1 type, suggesting their anti-cancer potential( Figure 10 ).

Claims

1. A kit for detecting the polarization state of mast cells, comprising: Detection reagents for the mast cell characteristic enzyme TPSB2, and one or more of the detection reagents for the MC1 type polarization of mast cells and the detection reagents for the MC2 type polarization of mast cells; The detection reagent for the MC1 type polarization includes the CCL27 and TNF-α detection reagents, and the detection reagent for the MC2 type polarization includes the CCL3, IL-16, and VEGFA detection reagents; The MC1 type polarization is an upregulation of the expression of CCL27 and TNF-α; the MC2 type polarization includes an upregulation of the expression of CCL3, IL-16, and VEGFA.

2. Use of a reagent for detecting the mast cell characteristic enzyme TPSB2, and one or more of a reagent for detecting MC1 polarization of mast cells and a reagent for detecting MC2 polarization of mast cells in the preparation of a kit for detecting mast cell polarization, characterized in that, The MC1 type polarization is an upregulation of the expression of CCL27 and TNF-α; the MC2 type polarization includes an upregulation of the expression of CCL3, IL-16, and VEGFA.

3. Use of the reagent for detecting the mast cell characteristic enzyme TPSB2, and one or more of the reagent for detecting MC1 polarization of mast cells and the reagent for detecting MC2 polarization of mast cells in the preparation of a kit for detecting mast cell polarization, characterized in that, The detection reagents include: qRT-PCR reagents, ELISA reagents, or specific primers.

4. Use of the reagent for detecting the mast cell characteristic enzyme TPSB2, and one or more of the reagents for detecting the MC1 polarization of mast cells and the reagent for detecting the MC2 polarization of mast cells in the preparation of a kit for detecting mast cell polarization, characterized in that, The specific primers include: CCL27-F and CCL27-R, with nucleotide sequences SEQ ID NO.5 and SEQ ID NO.6 respectively; TNF-α-F and TNF-α-R, with nucleotide sequences SEQ ID NO.9 and SEQ ID NO.10 respectively; CCL3-F and CCL3-R, with nucleotide sequences SEQ ID NO.3 and SEQ ID NO.4 respectively; IL-16-F and IL-16-R, with nucleotide sequences SEQ ID NO.1 and SEQ ID NO.2 respectively; VEGFA-F and VEGFA-R, with nucleotide sequences SEQ ID NO.7 and SEQ ID NO.8 respectively; TPSB2-F and TPSB2-R, with nucleotide sequences SEQ ID NO.11 and SEQ ID NO.12 respectively.

5. Use of a kit for detecting the polarization state of mast cells in the preparation of a product for esophageal cancer diagnosis or prognosis assessment, characterized in that, The mast cell polarization state includes MC1 type polarization and / or MC2 type polarization; the MC1 type polarization is an upregulation of the expression of CCL27 and TNF-α; the MC2 type polarization includes an upregulation of the expression of CCL3, IL-16, and VEGFA.

6. Use of the kit for detecting the polarization state of mast cells according to claim 5 in the preparation of a product for diagnosing or prognosticating esophageal cancer, characterized in that, The detection reagents include: qRT-PCR reagents, ELISA reagents, or specific primers.

7. Use of the kit for detecting the polarization state of mast cells according to claim 6 in the preparation of a product for esophageal cancer diagnosis or prognosis assessment, characterized in that, The specific primers include: CCL27-F and CCL27-R, with nucleotide sequences SEQ ID NO.5 and SEQ ID NO.6 respectively; TNF-α-F and TNF-α-R, with nucleotide sequences SEQ ID NO.9 and SEQ ID NO.10 respectively; CCL3-F and CCL3-R, with nucleotide sequences SEQ ID NO.3 and SEQ ID NO.4 respectively; IL-16-F and IL-16-R, with nucleotide sequences SEQ ID NO.1 and SEQ ID NO.2 respectively; VEGFA-F and VEGFA-R, with nucleotide sequences SEQ ID NO.7 and SEQ ID NO.8 respectively; TPSB2-F and TPSB2-R, with nucleotide sequences SEQ ID NO.11 and SEQ ID NO.12 respectively.

8. Use of LPS in the preparation of a reagent for inducing type MC1 polarization of mast cells, characterized in that, The polarization of the MC1 type is up-regulated in the expression of CCL27 and TNF-α.

9. A method for in vitro inducing mast cell polarization, comprising the following steps: Treat mast cells in vitro with lipopolysaccharide.

10. A method for constructing a cell model for the functional analysis of cytokines CCL27, TNF-α, CCL3, IL-16, and VEGFA as mast cell polarization markers, comprising the following steps: Detect and analyze the characteristic cytokines produced by HMC-1 cells under the action of lipopolysaccharide and N-methyl-p-methoxyphenethylamine formaldehyde condensate, and observe the effect of the characteristic cytokines on the cell polarization state of mast cells; Construct a characteristic cytokine profile through RT-PCR and ELISA experiments, analyze the expression levels and concentrations of the characteristic cytokines, and identify the mast cell polarization subtypes.