Primer set for specific identification of molecular markers of transgenic glyphosate-resistant cotton ZD131 and its application

Abstract

The present invention discloses a primer set for specific identification of molecular markers of transgenic glyphosate-resistant cotton ZD131 and its application. The primer set comprises two pairs of primers, namely primer pair ZD131LB and primer pair ZD131RB; the sequences of primer pair ZD131LB are SEQ ID NO.1 and SEQ ID NO.2; the sequences of primer pair ZD131RB are SEQ ID NO.3 and SEQ ID NO.4. The present invention designs and constructs primer pairs ZD131LB and ZD131RB, which can specifically identify and identify the insertion site of ZD131 exogenous gene.

Description

Technical Field

[0001] The invention belongs to the field of transgenic technology and relates to a primer set and application thereof, and in particular to a novel glyphosate-resistant cotton strain ZD131 and a specific molecular marker, a primer set and application thereof for identification. Background Art

[0002] Cotton is an important cash crop, an important raw material for textiles and fine chemicals, and an important strategic material. Cottonseeds are rich in fat and protein, and their cottonseed oil and cottonseed cake are used in industries such as edible oil, industrial oil, and feed.

[0003] The growth of cotton under natural conditions is affected by many factors. These factors include biological factors such as pests and diseases, bacteria, fungi and weeds, as well as non-biological factors such as drought, high temperature, cold, high salt and heavy metal pollution. Weeds compete with crops for water, fertilizer, light, etc., which is a biological factor that competes with crops. They seriously affect the growth and development of cotton individuals, resulting in reduced cotton yield and quality, and are a major threat to many agricultural systems. Glyphosate is a herbicide with epoch-making significance in world agriculture. It is a systemic broad-spectrum herbicide. It is the most effective broad-spectrum, non-selective, post-emergence all-purpose herbicide with no soil residual activity, which is convenient for economical control of weed growth and has low risks to humans and the environment. Cotton itself is not resistant to glyphosate, but through genetic engineering technology, glyphosate-resistant genes can be transformed into the cotton genome to create glyphosate-resistant cotton, providing the possibility of rapid weed control in cotton fields.

[0004] It is particularly necessary to independently develop transgenic cotton varieties with high levels of glyphosate resistance. In addition, clarifying the insertion location of exogenous genes and developing primer sets that specifically identify the insertion site are important means of cotton variety identification. Summary of the invention

[0005] In order to solve the problems existing in the background technology, the present invention provides a specific molecular marker primer set for identifying a transgenic glyphosate-resistant cotton ZD131 strain and an identification method thereof.

[0006] The technical solution adopted by the present invention is:

[0007] 1. A primer set for specific identification of molecular markers of transgenic glyphosate-resistant cotton ZD131:

[0008] The primer set includes two pairs of primers, namely primer pair ZD131LB and primer pair ZD131RB;

[0009] The sequences of primer pair ZD131LB are: 5'-ACAGTTAGGGGCAAAATCAGA-3' and 5'-TCTAAGCCCCCATTTGGACG-3', as SEQ ID NO. 1 and SEQ ID NO. 2, respectively;

[0010] The sequences of primer pair ZD131RB are: 5'-TGACCATGATGCATGTGCTGG -3' and 5'-AAATGGCCTCCATTATTTGGCT -3', as SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

[0011] Application in specific molecular markers and identification of transgenic glyphosate-resistant cotton ZD131.

[0012] The transgenic glyphosate-resistant cotton ZD131 is specifically transgenic glyphosate-resistant cotton, named transgenic glyphosate-resistant cotton ZD131 strain. The transgenic glyphosate-resistant cotton ZD131 is obtained by inserting exogenous genes into the cotton genome. The exogenous genes are composed of two glyphosate-resistant genes CP4 EPSPS with the same sequence in series. The gene sequence of the glyphosate-resistant gene CP4 EPSPS is as shown in SEQ ID NO.5.

[0013] The nucleotide sequence on the left side of the exogenous gene site is SEQ ID NO.6, and the nucleotide sequence on the right side of the exogenous gene site is SEQ ID NO.7.

[0014] 2. Identification method of primer set:

[0015] Nucleotide sequencing confirmed that the insertion site of the exogenous gene in the ZD131 strain was located at 51474116 nt of chromosome 7 of cotton subgroup D, and the insertion site was unique.

[0016] According to the flanking sequences of the exogenous gene and the flanking sequences of the insertion site on the genome of the ZD131 strain, the specific primers on both sides of the insertion site designed by the present invention are used to specifically identify the cotton ZD131 strain ZD131LB and ZD131RB, and the non-transgenic control material WT is also specifically identified.

[0017] If a pair of primers from the ZD131LB and ZD131RB sets can be used to amplify a band, it can be considered a descendant of the ZD131 strain.

[0018] The specific identification process is as follows:

[0019] 1) Use the CTAB (cetyltrimethylammonium bromide) method to extract the DNA of the cotton leaves to be tested;

[0020] 2) PCR amplification of the extracted leaf DNA was performed using primer pair ZD131LB and primer pair ZD131RB, and UBQ (ubiquitin gene) was used as an internal reference gene to monitor DNA quality;

[0021] 3) The PCR amplification product was electrophoresed using 1% agarose gel, stained with GelRed nucleic acid dye, and then exposed to ultraviolet light by a gel imager and photographed;

[0022] The 1% agarose gel refers to a solution formed by dissolving 1g of agarose in 100ml of buffer solution.

[0023] 4) After the genome of ZD131 strain is treated with primer pair ZD131LB and ZD131RB, whether the target fragment band is amplified is determined. If so, it is transgenic glyphosate-resistant cotton ZD131; otherwise, it is not transgenic glyphosate-resistant cotton ZD131.

[0024] In the step 2), the amplification system for PCR amplification is 50 μL, including 50 ng DNA, 0.2 mM of each dNTP, 0.4 μM of each primer, and 0.2 U Taq DNA polymerase (TaKaRa, Japan); the amplification conditions are 94°C pre-denaturation for 3 min, and the thermal cycle system is 94°C denaturation for 30 s, 58°C annealing for 30 s, and 72°C extension for 1 min, the number of cycles is 30, and the final extension is 72°C for 5 min.

[0025] The invention designs a primer set capable of specifically identifying the ZD131 strain, uses the two pairs of primers to perform polymerase chain reaction on cotton DNA, and identifies the reaction products by agarose gel electrophoresis imaging to distinguish the transgenic glyphosate-resistant cotton ZD131 strain.

[0026] The primer set includes two pairs of primers, namely primer pair ZD131LB and primer pair ZD131RB;

[0027] The sequences of primer pair ZD131LB are: 5'-ACAGTTAGGGGCAAAATCAGA-3' and 5'-TCTAAGCCCCCATTTGGACG-3', as SEQ ID NO. 1 and SEQ ID NO. 2, respectively;

[0028] The sequences of primer pair ZD131RB are: 5'-TGACCATGATGCATGTGCTGG -3' and 5'-AAATGGCCTCCATTATTTGGCT -3', as SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

[0029] The primer set of the invention is a molecular marker capable of specifically identifying a novel glyphosate-resistant cotton ZD131 strain.

[0030] The transgenic glyphosate-resistant cotton is specifically the transgenic glyphosate-resistant cotton ZD131 strain. The glyphosate-resistant cotton ZD131 is obtained by inserting two tandem exogenous genes with the same sequence into the cotton genome. The exogenous gene is the glyphosate-resistant gene CP4 EPSPS, such as SEQ ID NO.5.

[0031] The molecular marker in the present invention refers to the position where the exogenous gene is inserted into the cotton genome, and the position where the exogenous gene is inserted into the cotton genome is at 51474116 nt of chromosome 7 of cotton subgroup D.

[0032] The primer pair ZD131LB is used to identify the nucleotide sequence on the left side of the insertion position of the exogenous gene, and the nucleotide sequence on the left side of the insertion position is shown in SEQ ID NO.6.

[0033] The primer pair ZD131RB is used to identify the nucleotide sequence on the right side of the insertion position of the exogenous gene, and the nucleotide sequence on the right side of the insertion position is shown in SEQ ID NO.7.

[0034] Based on the existing tissue culture technology and molecular biology technology, the present invention connects two exogenous genes with the same sequence in series and introduces them into upland cotton to form a new glyphosate-resistant cotton strain named ZD131.

[0035] The cotton strain ZD131 of the invention is a novel glyphosate-resistant cotton with a high level of glyphosate resistance, and provides a new germplasm resource for cotton genetic breeding.

[0036] The beneficial results of the present invention are:

[0037] The two pairs of primers ZD131LB and ZD131RB of the invention can specifically identify the novel glyphosate-resistant cotton ZD131 strain.

[0038] Primer pair ZD131LB is used to identify the nucleotide sequence on the left side of the exogenous gene insertion position, and primer pair ZD131RB is used to identify the nucleotide sequence on the right side of the exogenous gene insertion position. The two pairs of molecular markers can be used simultaneously to identify the integrity of the exogenous gene in the material, providing a new molecular identification method for glyphosate-resistant cotton breeding.

[0039] In addition, any material containing these two pairs or one of the two pairs of molecular markers can be regarded as the offspring of the ZD131 line, providing molecular labels for the traceability of cotton germplasm resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Schematic diagram of the recombinant plasmid;

[0041] Figure 2 This is the DNA PCR identification of the exogenous gene of cotton ZD131; WT is the non-transgenic cotton control; 1, 2, and 3 represent three different plants;

[0042] Figure 3 Southern blot results of CP4 EPSPS gene, the genome was digested by XbaI; M: Marker; 1: positive plasmid; 2: negative control; 3: ZD131 strain;

[0043] Figure 4 This is the PCR identification of the exogenous gene cDNA of cotton ZD131; WT is the non-transgenic cotton control; 1, 2, and 3 represent three different plants;

[0044] Figure 5 This is the result diagram of the relative expression of CP4 EPSPS gene in the leaves of ZD131 strain;

[0045] Figure 6 This is a schematic diagram of the CP4 EPSPS protein antibody test strip test results;

[0046] Figure 7 This is a map of the cotton ZD131 lineage specifically identified by molecular markers ZD131LB and ZD131RB. DETAILED DESCRIPTION

[0047] The present invention will be further described below in conjunction with the accompanying drawings and specific implementation methods.

[0048] Embodiments of the present invention are as follows:

[0049] 1. Obtaining genetically modified cotton

[0050] 1.1) Vector construction and transformation

[0051] a) First, the glyphosate-resistant gene CP4 EPSPS was amplified by PCR, and then two CP4 EPSPS genes were connected in series to the pCAMBIA-1300 vector by enzyme ligation to obtain a recombinant expression vector ( Figure 1 ). The gene sequence of the exogenous glyphosate-resistant gene CP4 EPSPS is shown in SEQ ID NO.5.

[0052] b) The recombinant expression vector constructed above was transformed into Agrobacterium (EHA105), and then transformed into the recipient cotton variety Zhongmiansheng 49 ( G. hirsutum ZMS49), and developed the glyphosate-resistant cotton line ZD131.

[0053] At the same time, the recipient cotton variety Zhongmiansuo 49 without any exogenous gene was used as the control group, called recipient ZMS49, denoted by WT.

[0054] 1.2) Genome identification of transgenic cotton ZD131 line

[0055] The transgenic seedlings were first sprayed with glyphosate to identify the glyphosate-resistant ZD131 strain, and then the DNA of the ZD131 plants and WT plants were extracted respectively for PCR identification of the CP4 EPSPS gene.

[0056] like Figure 2 As shown, three individuals of the ZD131 strain and three individuals of the recipient ZMS49 (WT) of upland cotton were selected for PCR amplification of the target gene, and the upland cotton UBQ housekeeping gene was used as an internal reference. The results showed that the ZD131 strain contained the CP4EPSPS gene, while the control group receptor WT did not contain CP4 EPSPS. Southern blot was performed using a digoxigenin-labeled probe ( Figure 3 The results showed that the ZD131 strain contained a single copy of the foreign inserted gene.

[0057] 1.3) Exogenous gene expression in ZD131 strain

[0058] a) RNA was extracted from glyphosate-resistant cotton ZD131 and WT, reverse transcribed into cDNA, and then PCR was performed to identify the CP4 EPSPS cDNA gene.

[0059] like Figure 4 As shown, three individuals of the ZD131 line and three individuals of the recipient upland cotton ZMS49 (WT) were selected for CP4 EPSPS cDNA gene PCR, and the upland cotton UBQ housekeeping gene was used as an internal reference. The results showed that the ZD131 line contained CP4 EPSPS gene expression, while the control group recipient WT did not have CP4 EPSPS gene expression.

[0060] b) Quantitative detection of target gene expression in leaves of ZD131 strain, with WT as negative control and UBQ as internal reference gene.

[0061] like Figure 5 As shown, the exogenous gene CP4 EPSPS was expressed in the ZD131 strain, but not in the control receptor WT.

[0062] c) Use antibody test strips to detect the expression of the target protein, such as Figure 6 As shown, glyphosate-resistant protein was detected in the ZD131 strain, but not in the control group receptor WT.

[0063] 2. Identification of flanking sequences of exogenous gene insertion sites and design of specific molecular markers

[0064] Nucleotide sequencing determined that the insertion site of the exogenous gene in the ZD131 strain was located at nt 51474116 of chromosome 7 of cotton subgroup D. After repeated experiments and multiple generations of experiments, it was proved that the insertion site was unique.

[0065] According to the sequences on both sides of the exogenous gene and the flanking sequences of the insertion site on the genome of the ZD131 strain, the specific primers on both sides of the insertion site designed by the present invention are used to specifically identify the cotton ZD131 strain ZD131LB and ZD131RB, and the non-transgenic control material ZMS49 (represented by WT in the figure) is also specifically identified.

[0066] The specific identification process is as follows:

[0067] (1) The leaf DNA of ZD131 and WT plants was extracted using the CTAB (cetyltrimethylammonium bromide) method.

[0068] (2) The extracted ZD131 and WT DNA were PCR amplified using primer pairs ZD131LB and ZD131RB, respectively, and UBQ (ubiquitin gene) was used as an internal reference gene to monitor DNA quality. The amplification system was a 50 μL system containing 50 ng DNA, 0.2 mM of each dNTP, 0.4 μM of each primer, and 0.2 U Taq DNA polymerase (TaKaRa, Japan). The amplification conditions were pre-denaturation at 94 °C for 3 min, and the thermal cycle system was denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, and extension at 72 °C for 1 min. The number of cycles was 30, and the final extension was at 72 °C for 5 min.

[0069] (3) The PCR amplification products were electrophoresed using 1% agarose gel, stained with GelRed nucleic acid dye, and then exposed to ultraviolet light using a gel imager and photographed.

[0070] The experiment found that the primer pairs ZD131LB and ZD131RB could amplify the target fragment after processing the ZD131 genome, while the non-transgenic control group WT could not amplify the target fragment ( Figure 7 ).

[0071] like Figure 7As shown, ZD131 can amplify bands using these two primer sets, while no bands can be amplified in WT, which means that these two primer pairs can be used to detect this specific insertion site in ZD131. If there is a DNA material that uses these two primer pairs for PCR and there are bands after electrophoresis, this material can be treated as a descendant of ZD131. Therefore, the primer pair ZD131LB and ZD131RB provide a new identification and authentication method for detecting whether the strain to be tested is the transgenic glyphosate-resistant strain ZD131.

[0072] The primer pair ZD131LB recognizes the nucleotide sequence on the left side of the foreign gene insertion position (SEQ ID NO.6), and the primer pair ZD131RB recognizes the nucleotide sequence on the right side of the foreign gene insertion position (SEQ ID NO.7).

[0073] The gene nucleotide sequence involved in the present invention is as follows:

[0074] SEQ ID NO.1

[0075] Name: Primer pair ZD131LB primer-gene sequence

[0076] Source: Artificial Sequence

[0077] acagttaggggcaaaatcaga

[0078] SEQ ID NO.2

[0079] Name: Primer pair ZD131LB primer 2 gene sequence

[0080] Source: Artificial Sequence

[0081] tctaagcccccatttggacg

[0082] SEQ ID NO.3

[0083] Name: Primer pair ZD131RB primer-gene sequence

[0084] Source: Artificial Sequence

[0085] tgaccatgatgcatgtgctgg

[0086] SEQ ID NO.4

[0087] Name: Primer pair ZD131RB Primer 2 gene sequence

[0088] Source: Artificial Sequence

[0089] aaatggcctccattatttggct

[0090] SEQ ID NO.5

[0091] Name: Glyphosate resistance gene CP4 EPSPS

[0092] Source: Agrobacterium tumefaciens (A. tumifaciens aroA-CP4)

[0093]

[0094] SEQ ID NO.6

[0095] Name: ZD131LB recognizes the nucleotide sequence on the left side of the exogenous gene insertion site

[0096] Source: ZD131 strain (Gossypium hirsutum)

[0097] aaatcagaaaattttgttaggggtcgaaattaaattataattttttatataataaattgtaatttcattttaatagtctatatctttataatttttaaaggattaaatgaaattttatattttacttttaa aattttaaataactaaatagaaaatttttcattttaagagaagcgagacctacaagccccctcctaaatttacccctgattatagtacaaaatttttcgaatgttataagcaaatagctttgtaatatatattc

[0098] SEQ ID NO.7

[0099] Name: ZD131RB recognizes the nucleotide sequence to the right of the exogenous gene insertion site

[0100] Source: ZD131 strain (Gossypium hirsutum)

[0101] actacattgaattaaaatttgtaatggctacttaatgggtaatttgtaatatatatgattaataaacctttttttaattcagtaaaagaaatggttaaaaagaacttaaaatgataattca tcaattcgtaatttattttagccaaaaaatttactcaattcgtatttggttcttgtagacattatcatattaaatttgcactagtttgtaaacttttgattgaatagccaaataatggagg.

Claims

1. A primer set for specific identification of molecular markers of transgenic glyphosate-resistant cotton ZD131, characterized in that: The primer set includes two pairs of primers, namely primer pair ZD131LB and primer pair ZD131RB; The sequences of primer pair ZD131LB are: 5'-ACAGTTAGGGGCAAAATCAGA-3' and 5'-TCTAAGCCCCCATTTGGACG-3', as SEQ ID NO. 1 and SEQ ID NO. 2, respectively; The sequences of primer pair ZD131RB are: 5'-TGACCATGATGCATGTGCTGG -3' and 5'-AAATGGCCTCCATTATTTGGCT -3', as SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

2. The use of the primer set according to claim 1, characterized in that: Application in identification of specific molecular markers of transgenic glyphosate-resistant cotton ZD131; The transgenic glyphosate-resistant cotton ZD131 is specifically transgenic glyphosate-resistant cotton, named transgenic glyphosate-resistant cotton ZD131. The transgenic glyphosate-resistant cotton ZD131 is obtained by inserting an exogenous gene into the cotton genome. The exogenous gene is composed of two glyphosate-resistant genes CP4 EPSPS with the same sequence in series. The gene sequence of the glyphosate-resistant gene CP4 EPSPS is as shown in SEQ ID NO.

5. The insertion site of the exogenous gene is located at the 51474116nt of chromosome 7 of cotton subgroup D.

3. The identification method applied to the primer set according to claim 1, characterized in that: 1) Use the CTAB method to extract DNA from the leaves of the cotton to be tested; 2) PCR amplification of the extracted leaf DNA was performed using primer pair ZD131LB and primer pair ZD131RB, and UBQ was used as an internal reference gene to monitor DNA quality; 3) The PCR amplification product was electrophoresed using 1% agarose gel, stained with GelRed nucleic acid dye, and then exposed to ultraviolet light by a gel imager and photographed; 4) After the genome of ZD131 strain is treated with primer pair ZD131LB and ZD131RB, whether the target fragment band is amplified is determined. If so, it is transgenic glyphosate-resistant cotton ZD131; otherwise, it is not transgenic glyphosate-resistant cotton ZD131.

4. The method for identifying a primer set according to claim 3, wherein: In the step 2), the amplification system for PCR amplification is 50 μL, including 50 ng DNA, 0.2 mM of each dNTP, 0.4 μM of each primer, and 0.2 U Taq DNA polymerase; the amplification conditions are 94°C pre-denaturation for 3 min, the thermal cycle system is 94°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 1 min, the number of cycles is 30, and finally 72°C extension for 5 min.

Images