Molecular markers for the locus qRS.7BS associated with resistant starch content in wheat grains

Abstract

The present invention discloses a molecular marker AX-111140336, which is a locus related to the resistant starch content of wheat grains, qRS.7BS. The molecular marker is located on the short arm of wheat chromosome 7B. There is a C / T allele mutation at the 36th base of the molecular marker sequence. When the 36th base is T, the resistant starch content in the grain is higher, and when the 36th base is C, the resistant starch content in the grain is lower. The flanking DNA sequence of the genome where the molecular marker is located can be used to develop a KASP primer set as a primer, and the KASP marker can be amplified by PCR using the wheat genome to be tested as a template. Alternatively, a probe for identifying the molecular marker can be designed based on the mutation, and then used to screen wheat germplasm resources with high resistant starch content, providing a new molecular marker basis for the selection of wheat breeding parents with high resistant starch content and assisted breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular markers for wheat grain resistant starch content, and relates to a molecular marker for a wheat grain resistant starch content-related site qRS.7BS. Background Art

[0002] Resistant starch is a general term for a type of starch that cannot be digested by amylase in the small intestine and therefore enters the colon, where it is fermented by the colonic microbiome. With improving living standards, people are consuming more easily digestible starch in their daily diets. After consuming foods high in easily digestible starch (such as noodles, steamed buns, and cakes), amylase in the small intestine rapidly breaks it down into glucose and absorbs it, causing elevated blood sugar levels. This triggers insulin secretion and tissue-specific glucose uptake within cells, leading to hypoglycemia. This unstable cycle of high and low blood sugar levels can lead to insulin resistance, which can cause type 2 diabetes and contribute to obesity. Studies have shown that consuming 11.5 grams of resistant starch in a meal reduces blood sugar and insulin responses, while untreated borderline diabetics experience reduced postprandial blood sugar and insulin responses after consuming a meal containing 6 grams of resistant starch. Furthermore, elevated insulin levels can contribute to high blood pressure, high blood lipids, high cholesterol, cardiovascular disease, Alzheimer's disease, and cancer. Consuming foods high in resistant starch can prevent the development of these chronic diseases. After resistant starch enters the colon from the upper digestive tract, it is fermented by colonic bacteria into a variety of beneficial metabolites, including short-chain fatty acids. These metabolites have important biological functions, including reducing colon cancer, regulating macronutrient metabolism, and altering hormone secretion, ultimately improving overall health.

[0003] Currently, most resistant starches consumed are made through a specific process. Regular corn starch is gelatinized under specific pH conditions, treated at high temperature and pressure, and treated with specific enzymes such as α-amylase and glucoamylase to create resistant starch. Other options include high-amylose corn flour and potato flour. Industrially produced natural potato starch can contain up to 78% resistant starch; high-amylose corn flour and raw corn starch can contain around 75% resistant starch; and raw beans, amylose corn flour, and crisped amylose can contain over 15% resistant starch. Wheat, the most important staple food in northern my country, typically contains only 1%-2% resistant starch in its kernels. Therefore, increasing the resistant starch content of wheat kernels is crucial for improving the dietary health of the Chinese people.

[0004] Wheat resistant starch content is a quantitative trait controlled by multiple genes and is also susceptible to environmental factors such as temperature, light, and mineral nutrition during grain development. Therefore, identifying genes that stably control resistant starch content in wheat under multiple environments and developing corresponding molecular markers are crucial for screening and identifying germplasm resources with high resistant starch content, providing technical support for subsequent variety breeding. Summary of the Invention

[0005] The purpose of the present invention is to develop a molecular marker that can be used to select wheat varieties with high resistant starch content. This method uses association analysis to analyze the resistance content of wheat grains grown under multiple environments, and through genome-wide association analysis, it identifies single-nucleotide polymorphisms (SNPs) associated with resistant starch content in wheat grains. Based on the detected SNPs, primers for amplifying the molecular marker and probes for identifying the marker can be designed. These markers can then be used to screen for wheat germplasm with high resistant starch content, providing a new molecular marker foundation for the selection of high-resistant starch wheat breeding parents and assisted breeding.

[0006] The inventors constructed an association analysis population containing 207 varieties and used the wheat 660K SNP chip to identify the genotypes of the varieties. The Megazyme kit was used to measure the resistant starch content of the grains of the varieties in the association analysis population planted in three places within one year. Genome-wide association study was used to explore SNPs associated with the resistant starch content of wheat grains. Among the SNPs markers obtained by the above screening, a molecular marker (AX-111140336) was screened for a site qRS.7BS on the short arm of chromosome 7B that is related to the resistant starch content of grains. The 36th base of the marker sequence is a C / T allele mutation. The polymorphism of this site was used for genotyping analysis. When the base at this site is T, the resistant starch content in the wheat grain is higher.

[0007] In a first aspect, the molecular marker AX-111140336 of the wheat grain resistant starch content-related locus qRS.7BS is used in any of the following methods, wherein the molecular marker AX-111140336 is located on the short arm of wheat chromosome 7B, and its base 36 is a C / T polymorphic site. The sequence of the molecular marker AX-111140336 is: CTGATGGTTAGATGATGACGTCAATTTAGTCTTAARACTTTGGTTGTGTTTGGTTGGCTCATGTGGAAGAC (SEQ ID NO. 1), wherein R represents the base C / T;

[0008] When the 36th base is T, CTGATGGTTAGATGATGACGTCAATTTAGTCTTAATACTTTGGTTGTGTTTGGTTGGCTCATGTGGAAGAC (SEQ ID NO. 2) is a genotype with high resistant starch content in wheat grains.

[0009] When the 36th base is C, CTGATGGTTAGATGATGACGTCAATTTAGTCTTAACACTTTGGTTGTGTTTGGTTGGCTCATGTGGAAGAC (SEQ ID NO. 3) represents a genotype with low resistant starch content in wheat grains;

[0010] The application is specifically:

[0011] (A) Identifying or assisting in identifying the resistant starch content in wheat grains;

[0012] (B) Comparison of the resistant starch content of the tested wheat grains;

[0013] (C) breeding or screening wheat plants, lines, varieties or cultivars having a relatively high grain resistant starch content;

[0014] (D) Breeding or screening wheat plants, lines, varieties or cultivars having relatively low grain resistant starch content;

[0015] (E) preparing a product for identifying or assisting in identifying or comparing the resistant starch content of wheat grains to be tested;

[0016] (F) preparing a product for breeding or screening wheat plants, lines, strains or varieties having a relatively high grain resistant starch content;

[0017] (G) preparing a product for breeding or screening wheat plants, lines, varieties or varieties with relatively low grain resistant starch content.

[0018] (H) Application in improving the resistant starch content of wheat grains.

[0019] In a second aspect, the present invention further provides any of the following methods:

[0020] Method A: A method for comparing the resistant starch content of wheat grains to be tested, comprising the following steps:

[0021] (A1) Detecting the genotype of the 36th position of the molecular marker represented by SEQ ID No. 1 on chromosome 7B in the wheat genome;

[0022] (A2) determining the resistant starch content of the wheat grain to be tested as follows: if the 36th deoxyribonucleotide of the molecular marker represented by SEQ ID No. 1 on chromosome 7B in the genome is a homozygous T, the resistant starch content of the wheat grain to be tested is the highest; if the 36th deoxyribonucleotide of the molecular marker represented by SEQ ID No. 1 on chromosome 7B in the genome is a homozygous C, the resistant starch content of the wheat grain to be tested is the lowest;

[0023] Method B: A method for breeding or screening wheat plants, lines, varieties, or varieties with relatively high grain resistant starch content, comprising the following steps:

[0024] (B1) detecting the genotype of the 36th position of the molecular marker represented by SEQ ID No. 1 on chromosome 7B in the wheat genome;

[0025] (B2) selecting a wheat plant to be tested that is homozygous for T at the 36th deoxyribonucleotide as a parent for breeding, and selecting a wheat plant that is homozygous for T at the 36th deoxyribonucleotide in each breeding generation, ultimately obtaining a wheat plant, plant line, strain, or variety with a relatively high grain resistant starch content;

[0026] Method C: A method for breeding or screening wheat plants, lines, strains, or varieties with relatively low grain resistant starch content, comprising the following steps:

[0027] (C1) detecting the genotype of the 36th position of the molecular marker represented by SEQ ID No. 1 on chromosome 7B in the wheat genome;

[0028] (C2) selecting a wheat plant to be tested in which the 36th deoxyribonucleotide is homozygous for C as a parent for breeding, and selecting a wheat plant in which the 36th deoxyribonucleotide is homozygous for C in each breeding generation, and ultimately obtaining a wheat plant or plant line or line or variety with a relatively low grain resistant starch content.

[0029] Compared to existing technologies, the present invention has identified a significant marker, AX-111140336, on the short arm of chromosome 7B. This molecular marker is associated with grain resistant starch content. Sequence analysis revealed a C / T allele mutation at base 36 of the marker sequence. The AX-111140336 marker of the present invention can be used to extract DNA from wheat seedling leaf tissue, enabling rapid and accurate screening and identification of wheat germplasm with high resistant starch content during early growth stages, saving significant time and labor costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the specific embodiments.

[0031] Figure 1 Manhattan plot of SNP markers related to grain resistant starch content using BLUP values ​​under different environments in the present invention: the red dotted line is the significance threshold (-log 10 P = 3);

[0032] Figure 2 Correlation between the SNP markers developed in this study and grain resistant starch content: Blue represents the resistant starch content of wheat varieties (lines) with the CC genotype; orange represents the resistant starch content of wheat varieties (lines) with the TT genotype. The results showed a highly significant difference between the two genotypes (P < 0.001). DETAILED DESCRIPTION

[0033] The following embodiments of the technical solution of the present invention are described in detail with reference to the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention and are therefore only provided as examples and are not intended to limit the scope of protection of the present invention. It should be noted that, unless otherwise specified, the technical terms or scientific terms used in this application should have the common meanings understood by those skilled in the art to which the present invention belongs.

[0034] It should be noted that as a professional agricultural research institution, the applicant has preserved relevant germplasm materials for a long time, and the relevant wheat varieties are publicly available on the market or in existing germplasm banks.

[0035] Example 1

[0036] An association analysis population was constructed using 207 wheat varieties (lines) collected from around the world and cultivated in Yuanyang (YY), Shangqiu (SQ), and Kaifeng (KF) in 2017. The genotypes of the association analysis population were identified using a wheat 660K SNP array, and a high-throughput map containing 224,706 SNP markers was constructed. The resistant starch content of each wheat variety in the association analysis population was measured using the Megazyme Resistant Starch Assay Kit. Combined with the SNP map, a genome-wide association analysis using a "Q+K" mixed linear model was conducted to identify loci associated with resistant starch content in wheat.

[0037] Detection of SNP sites significantly associated with resistant starch content in different environments (-log 10 P≥3)( Figure 1A significantly associated SNP marker, qRS.7BS, associated with grain resistant starch content, was identified on the short arm of wheat chromosome 7B. This marker, designated AX-111140336, explains 5.48%-6.42% of the phenotypic variation. A C / T allele mutation exists at base 36 of this SNP marker sequence. Its nucleotide sequence is:

[0038] CTGATGGTTAGATGATGACGTCAATTTAGTCTTAARACTTTGGTTGTGTTTGGTTGGCTCATGTGGAAGAC (SEQ ID NO. 1), wherein R represents the base C / T.

[0039] When the 36th base is T, it is a genotype with high resistant starch content in wheat grains, and the base sequence is shown in SEQ ID No. 1, which is as follows:

[0040] CTGATGGTTAGATGATGACGTCAATTTAGTCTTAATACTTTGGTTGTGTTTGGTTGGCTCATGTGGAAGAC (SEQ ID NO. 2);

[0041] When the 36th base is C, it is a genotype with low resistant starch content in wheat grains, and the base sequence is shown in SEQ ID No. 2, which is as follows:

[0042] CTGATGGTTAGATGATGACGTCAATTTAGTCTTAACACTTTGGTTGTGTTTGGTTGGCTCATGTGGAAGAC (SEQ ID NO. 3).

[0043] Example 2

[0044] Based on the SNP site AX-111140336 identified by screening in Example 1, the genotype identification results of the varieties in the association analysis population were determined using the 660K chip to verify its correlation with the resistant starch content in the association analysis population (Table 1).

[0045] Table 1 Correlation between polymorphism of SNP marker AX-111140336 and grain resistant starch content

[0046] genotype Number of varieties Resistant starch content (%) CC 145 5.08 TT 59 5.24 Missing 3 - P-value CC / TT 0.000458091

[0047] Example 3

[0048] The molecular genetic markers of the present application are used to assist in breeding or assisted breeding work, and the specific method is: extracting wheat genomic DNA, using a wheat chip to detect the genotype of the 36th base in SEQ ID NO.1; judging whether the tested individual plant has a CC or TT genotype based on the genotype at this site; selecting the CC genotype as a high-resistant starch germplasm resource or breeding parent, and breeding a wheat variety with a high resistant starch content.

[0049] The marker was used to genotype 207 common wheat materials collected by the inventors. The specific genotypes and grain resistant starch content results are shown in the figure. Figure 2 As shown in Table 2 below.

[0050] Table 2 Genotypes and resistant starch content of AX-111140336 marker in natural wheat populations

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057] Table 2 Combination Figure 2 As can be seen, this marker effectively separates alleles of wheat varieties with different grain resistant starch content. Wheat varieties with the genotype TT account for approximately 25.6%, while 70.0% of wheat varieties contain the genotype CC. The resistant starch content of wheat grains with the genotype TT ranges from 4.73% to 6.13%, while that of wheat grains with the genotype CC ranges from 4.36% to 5.85%.

[0058] The resistant starch content in the grains of wheat varieties with the TT genotype was significantly higher than that of wheat varieties with the CC genotype. This suggests that the TT genotype is an excellent allele for increasing the resistant starch content in grains and can be used to screen wheat varieties with high resistant starch content and improve wheat quality traits.

[0059] Unless otherwise specified, the numerical value set forth in these embodiments does not limit the scope of the present invention. In all examples shown and described here, unless otherwise specified, any specific value should be interpreted as merely exemplary, rather than as restriction, and therefore, other examples of exemplary embodiments can have different values.

Claims

1. Use of a reagent for detecting the molecular marker AX-111140336 of the locus qRS.7BS associated with resistant starch content in wheat grains in any of the following applications, characterized in that: The molecular marker AX-111140336 is located on the short arm of wheat chromosome 7B, and its base 36 is a C / T polymorphic site. The sequence of the molecular marker AX-111140336 is: CTGATGGTTAGATGATGACGTCAATTTAGTCTTAARACTTTGGTTGTGTTTGGTTGGCTCATGTGGAAGAC (SEQ ID NO. 1), wherein R represents the base C / T; when the homozygous base 36 is T, it is a genotype with a high resistant starch content in the wheat grain, and when the homozygous base 36 is C, it is a genotype with a low resistant starch content in the wheat grain; The application is specifically: (A) Identifying or assisting in identifying the resistant starch content in wheat grains; (B) Comparison of the resistant starch content of the tested wheat grains; (C) breeding or screening wheat plants, lines, varieties or cultivars having a relatively high grain resistant starch content; (D) Breeding or screening wheat plants, lines, strains, or varieties with relatively low grain resistant starch content (H) Application in improving the resistant starch content of wheat grains.

2. Use any of the following methods: Method A: A method for comparing the resistant starch content of wheat grains to be tested, comprising the following steps: (A1) Detecting the genotype of the 36th position of the molecular marker represented by SEQ ID No. 1 on chromosome 7B in the wheat genome; (A2) determining the resistant starch content of the wheat grain to be tested as follows: if the 36th deoxyribonucleotide of the molecular marker represented by SEQ ID No. 1 on chromosome 7B in the genome is a homozygous T, the resistant starch content of the wheat grain to be tested is the highest; if the 36th deoxyribonucleotide of the molecular marker represented by SEQ ID No. 1 on chromosome 7B in the genome is a homozygous C, the resistant starch content of the wheat grain to be tested is the lowest; Method B: A method for breeding or screening wheat plants, lines, varieties, or varieties with relatively high grain resistant starch content, comprising the following steps: (B1) detecting the genotype of the 36th position of the molecular marker represented by SEQ ID No. 1 on chromosome 7B in the wheat genome; (B2) selecting a wheat plant to be tested that is homozygous for T at the 36th deoxyribonucleotide as a parent for breeding, and selecting a wheat plant that is homozygous for T at the 36th deoxyribonucleotide in each breeding generation, ultimately obtaining a wheat plant, plant line, strain, or variety with a relatively high grain resistant starch content; Method C: A method for breeding or screening wheat plants, lines, strains, or varieties with relatively low grain resistant starch content, comprising the following steps: (C1) detecting the genotype of the 36th position of the molecular marker represented by SEQ ID No. 1 on chromosome 7B in the wheat genome; (C2) selecting a wheat plant to be tested in which the 36th deoxyribonucleotide is homozygous for C as a parent for breeding, and selecting a wheat plant in which the 36th deoxyribonucleotide is homozygous for C in each breeding generation, and ultimately obtaining a wheat plant or plant line or line or variety with a relatively low grain resistant starch content.

Images