Molecular markers of the locus qRS.4DS associated with resistant starch content in wheat grains and its application

By developing the molecular marker AX-94546744 on the short arm of wheat 4D chromosomes and converting it into KASP marker, the problem of breeding of wheat varieties lacking high-resistant starch wheat varieties in the prior art was solved, and rapid and accurate screening of high-resistant starch wheat varieties was achieved, improving the nutritional quality of wheat and the development of healthy functional dietary fiber.

CN116064895BActive Publication Date: 2025-08-12HENAN CROP MOLECULAR BREEDING RES INST
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202211011555.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-08-23
Publication Date
2025-08-12
Estimated Expiration
2042-08-23

AI Technical Summary

Technical Problem

The lack of effective molecular markers in the prior art is used to breed wheat varieties with high resistant starch content, which limits the improvement of wheat nutritional quality and the development of healthy functional dietary fiber.

Method used

AX-94546744, a molecular marker on the short arm of wheat 4D chromosomes, was developed and converted into a KASP marker for identification of resistant starch content in the grains, screened and designed for genotyping by genome-wide association analysis.

Benefits of technology

It has achieved rapid and accurate screening of germplasm resources with high resistant starch content during the wheat seedling stage, saving time and labor costs, and improving the efficiency of wheat nutritional quality breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116064895B_ABST
    Figure CN116064895B_ABST
Patent Text Reader

Abstract

The present invention discloses a molecular marker AX-94546744 at the locus qRS.4DS associated with the resistant starch content in wheat grains, as well as a set of KASP primer sets associated with the molecular marker and their applications. The molecular marker is located on the short arm of wheat chromosome 4D. There is a C / T allele mutation at the 36th base of the molecular marker sequence. When the 36th base is T, the resistant starch content in the grain is higher, and when the 36th base is C, the resistant starch content in the grain is lower. The present invention also discloses an identification method for the KASP marker associated with the resistant starch content in wheat grains and the application of its association analysis method. The development and utilization of the marker has important theoretical significance and application value for breeding varieties with high resistant starch content through molecular marker-assisted selection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology for resistant starch content in wheat grains, and relates to molecular markers of qRS.4DS, a site related to resistant starch content in wheat grains, and their applications. Background Technology

[0002] Wheat is my country's second largest staple food crop, accounting for about 22% of total grain production. Approximately half of my country's population relies on wheat as their staple food, and wheat products are one of the main sources of nutrition for residents. To ensure national food supply, early research focused on breeding high-yield wheat varieties. However, with the improvement of people's living standards and the development of modern agricultural technology, people have placed higher demands on the nutritional quality of wheat.

[0003] Resistant starch is a general term for starch and its degradation products that are not absorbed by the small intestine of healthy humans. Resistant starch in flour not only improves the taste and quality of flour products, but also, as a functional dietary fiber, has certain preventive effects against intestinal diseases, diabetes, and cancer. Therefore, breeding wheat varieties with high resistant starch content is of great significance for improving wheat processing and nutritional quality, improving the dietary structure of Chinese residents, and enhancing the overall health of the population.

[0004] Existing research has constructed the starch biosynthesis pathway, and the genes involved and their functions have been studied in depth. Amylose synthesis is mainly catalyzed by granule-bound starch synthases encoded by Waxy family genes such as Wx-A1, Wx-B1, and Wx-D1; amylopectin is formed through the combined action of multiple genes, including soluble starch synthase, starch branching enzyme, and debranching enzyme. The resistant starch content in crop grains is controlled by multiple loci and is a quantitative trait. Several loci controlling resistant starch content have been located in rice, maize, and barley; however, research on the localization of resistant starch-related genes in wheat is limited, resulting in a lack of molecular markers for breeding high-resistant starch wheat varieties, severely restricting the selection of such varieties. Summary of the Invention

[0005] The purpose of this invention is to develop a molecular marker that can be used for breeding wheat varieties with high resistant starch content. This invention uses GWAS to screen for SNPs related to resistant starch content in wheat grains and converts one of the SNPs into a KASP marker, which can be used to identify the resistant starch content in grains, providing new molecular marker resources and applications for improving the nutritional quality of wheat.

[0006] The inventors constructed an association study population containing 207 varieties and identified the genotypes of the varieties using a wheat 660K SNP chip. The Megazyme kit was used to determine the resistant starch content in the grains of the varieties grown in three locations within one year. Genome-wide association studies were used to identify SNPs associated with resistant starch content in wheat grains. From the SNPs obtained through the screening process, a molecular marker (AX-94546744) on the short arm of chromosome 4D, associated with resistant starch content in wheat grains, was identified. Based on the sequence of the AX-94546744 marker, a KASP marker was developed. Sequence analysis showed that the 36th base of this marker sequence is a C / T allele mutation. Genotyping analysis was performed using the polymorphism at this site; when the base at this site is T, the resistant starch content in wheat grains is higher.

[0007] In a first aspect, the present invention provides the application of the molecular marker AX-94546744 of the wheat grain resistant starch content related site qRS.4DS in the improvement of wheat grain resistant starch content. The molecular marker AX-94546744 is located on the short arm of wheat chromosome 4D, and its 36th base is a C / T polymorphic site. The sequence of the molecular marker AX-94546744 is: TATGTATTCCCGACATTTACCATTGAACCTCGCGCRAGTTGTAGCTTCGAAAACGAACAAACCAAAAATAA (SEQ ID NO. 1), where R represents the base C / T.

[0008] When the 36th base is T, it represents a genotype with high resistant starch content in wheat grains. The base sequence is shown in SEQ ID No. 5, as follows:

[0009] TATGTATTCCCGACATTTACCATTGAACCTCGCGCTAGTTGTAGCTTCGAAAACGAACAAACCAAAAATAA (SEQ ID No. 5);

[0010] When the 36th base is C, it represents a genotype with low resistant starch content in wheat grains. The base sequence is shown in SEQ ID No. 6, as follows:

[0011] TATGTATTCCCGACATTTACCATTGAACCTCGCGCCAGTTGTAGCTTCGAAAACGAACAAACCAAAAATAA (SEQ ID No. 6).

[0012] Secondly, the present invention provides a substance for detecting the resistant starch content of wheat grains, wherein the substance is a set of primers for detecting the genotype of the 36th position of the molecular marker AX-94546744 shown in SEQ ID No. 1 on chromosome 4D in the wheat genome, or a detection reagent or kit containing the set of primers.

[0013] Furthermore, the primer set contains two upstream primers and one downstream primer;

[0014] The upstream primers are designed based on the 36th deoxyribonucleotide of the sequence shown in SEQ ID No. 1 on chromosome 4D of the wheat genome and its upstream sequence, with one upstream primer having a 3' end deoxyribonucleotide of T and the other upstream primer having a 3' end deoxyribonucleotide of C;

[0015] The downstream primer was designed based on the downstream sequence of the 36th deoxyribonucleotide of the sequence shown in SEQ ID No. 1 on chromosome 4D of the wheat genome.

[0016] Furthermore, the upstream primers are AX-94546744-F1 and AX-94546744-F2, whose sequences are shown in SEQ ID No. 2 and SEQ ID No. 3, respectively, and the downstream primer is AX-94546744-R12, whose sequence is shown in SEQ ID No. 4.

[0017] Thirdly, the present invention provides the use of the substance of the second aspect of the present invention in any of the following:

[0018] (A) To identify or assist in the identification of resistant starch content in wheat grains;

[0019] (B) Compare the levels of resistant starch content in the wheat grains to be tested;

[0020] (C) Select or screen wheat plants, lines, strains or varieties with relatively high resistant starch content in their grains.

[0021] (D) Select or screen wheat plants, lines, strains or varieties with relatively low resistant starch content in grains;

[0022] (E) Prepare products for identifying or assisting in the identification or comparison of the resistant starch content of wheat grains to be tested;

[0023] (F) Prepare products for breeding or screening wheat plants, lines, strains or varieties with relatively high resistant starch content in grains.

[0024] (G) Prepare products for breeding or screening wheat plants, lines, strains or varieties with relatively low resistant starch content in grains.

[0025] Fourthly, the present invention also provides any of the following methods:

[0026] Method A: A method for comparing the resistant starch content of wheat grains, comprising the following steps:

[0027] (A1) Detect the genotype at position 36 of the molecular marker shown in SEQ ID No. 1 on chromosome 4D in the wheat genome;

[0028] (A2) The resistant starch content of the wheat grains to be tested is determined as follows: if the deoxyribonucleotide at position 36 of the molecular marker shown in SEQ ID No. 1 on chromosome 4D in the genome is homozygous for T, then the resistant starch content of the wheat grains to be tested is the highest; if the deoxyribonucleotide at position 36 of the molecular marker shown in SEQ ID No. 1 on chromosome 4D in the genome is homozygous for C, then the resistant starch content of the wheat grains to be tested is the lowest.

[0029] Method B: A method for breeding or screening wheat individual plants, lines, strains, or varieties with relatively high resistant starch content, comprising the following steps:

[0030] (B1) Detect the genotype at position 36 of the molecular marker shown in SEQ ID No. 1 on chromosome 4D in the wheat genome;

[0031] (B2) Select the test wheat that is homozygous for T at the 36th deoxyribonucleic acid position as the parent for breeding, and select the homozygous wheat that is T at the 36th deoxyribonucleic acid position in each generation of breeding, so as to finally obtain wheat single plants, lines, strains or varieties with relatively high resistant starch content in the grains.

[0032] Method C: A method for breeding or screening wheat plants, lines, strains, or varieties with relatively low resistant starch content, comprising the following steps:

[0033] (C1) Detect the genotype at position 36 of the molecular marker shown in SEQ ID No. 1 on chromosome 4D in the wheat genome;

[0034] (C2) Select the test wheat that is homozygous for C at the 36th deoxyribonucleic acid position as the parent for breeding, and select wheat that is homozygous for C at the 36th deoxyribonucleic acid position in each generation of breeding, so as to finally obtain wheat single plants, lines, strains or varieties with relatively low resistant starch content in the grains.

[0035] Furthermore, the specific operation of (A1)(B1)(C1) is as follows:

[0036] The detection reagent or kit described in the second aspect of this invention is used to perform PCR amplification of the wheat genomic DNA to be tested. The amplified product is then scanned for fluorescence signals, and the scan data is analyzed. The 36th deoxyribonucleotide (SEQ ID No. 1) on chromosome 4D of the wheat gene to be tested is then determined as follows:

[0037] If the fluorescence signal data of the amplification product of the wheat to be tested is orange, then the 36th deoxyribonucleotide of the molecular marker shown in SEQ ID No. 1 on chromosome 4D of the wheat genome to be tested is a homozygous T.

[0038] If the fluorescence signal data of the amplification product of the wheat to be tested is blue, then the 36th deoxyribonucleotide of the molecular marker shown in SEQ ID No. 1 on chromosome 4D of the wheat genome to be tested is a homozygous C.

[0039] Furthermore, the PCR reaction system is designed as follows:

[0040] 2×KASP Master Mix, 5 μl; Primer Mix, 1.4 μl; MgCl2, 0.08 μl; 100ng / μl DNA, 1 μl; water, 2.52 μl.

[0041] Compared to existing technologies, this invention obtains a significant marker AX-94546744 on the short arm of chromosome 4D, which is associated with resistant starch content in grains. Sequence analysis shows that the 36th base of this marker sequence is a C / T allele mutation. This invention designs and develops the KASP marker based on AX-94546744, utilizing DNA extracted from wheat seedling leaf tissue. This allows for rapid and accurate screening and identification of wheat germplasm resources with high resistant starch content in the early stages of growth, saving significant time and labor costs. Attached Figure Description

[0042] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments will be briefly introduced below.

[0043] Figure 1 In this invention, Manhattan plots were used to locate SNP markers related to grain resistant starch content using BLUP values ​​under different environments: the red dashed line represents the significance threshold (-log) used in the invention. 10 P = 3);

[0044] Figure 2 Genotypic analysis of the KASP marker at the AX-94546744 locus in the populations analyzed in the association study;

[0045] Figure 3 The correlation between the KASP marker developed for this invention and grain resistant starch content was investigated: blue indicates grain resistant starch content of wheat varieties (lines) with genotype CC; orange indicates grain resistant starch content of wheat varieties (lines) with genotype TT. The results showed that the differences between the two genotypes were extremely significant (P<0.01). Detailed Implementation

[0046] The embodiments of the technical solution of the present invention will now be described in detail with reference to the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and are therefore merely examples and should not be used to limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning understood by those skilled in the art to which this invention pertains.

[0047] It should be noted that, as a professional agricultural research institution, the applicant has long preserved relevant germplasm materials, and the relevant wheat varieties are all publicly available in the market or in existing germplasm banks.

[0048] Example 1

[0049] An association study population was constructed using 207 wheat varieties (lines) collected from around the world, and these were planted in Yuanyang (YY), Shangqiu (SQ), and Kaifeng (KF) in 2017. Genotyping of the association study population was performed using a wheat 660K SNP microarray, resulting in a high-throughput map containing 224,706 SNP markers. The resistant starch content in the grains of each wheat variety in the association study population was determined using a Megazyme resistant starch assay kit. Combined with the SNP map, a Q+K mixed linear model was used to conduct genome-wide association analysis to identify loci associated with wheat resistant starch content.

[0050] Detection of SNP sites (-log) that are significantly associated with resistant starch content under different environments 10 P≥3)( Figure 1 Among them, a SNP marker qRS.4DS, associated with wheat grain resistant starch content, was identified on the short arm of wheat chromosome 4D. This marker, numbered AX-94546744, explains 5.52%–7.82% of the phenotypic variation. Figure 2 As shown, there is a C / T allele mutation at position 36 of the SNP marker sequence, and its nucleotide sequence is as follows:

[0051] TATGTATTCCCGACATTTACCATTGAACCTCGCGCRAGTTGTAGCTTCGAAAACGAACAAACCAAAAATAA(SEQ ID NO.1), where R represents a C / T base.

[0052] When the 36th base is T, it represents a genotype with high resistant starch content in wheat grains. The base sequence is shown in SEQ ID No. 5, as follows:

[0053] TATGTATTCCCGACATTTACCATTGAACCTCGCGCTAGTTGTAGCTTCGAAAACGAACAAACCAAAAATAA (SEQ ID No. 5);

[0054] When the 36th base is C, it represents a genotype with low resistant starch content in wheat grains. The base sequence is shown in SEQ ID No. 6, as follows:

[0055] TATGTATTCCCGACATTTACCATTGAACCTCGCGCCAGTTGTAGCTTCGAAAACGAACAAACCAAAAATAA (SEQ ID No. 6).

[0056] Example 2

[0057] Based on the nucleotide sequence of the SNP site AX-94546744 identified in Example 1, corresponding KASP marker primers were designed, and the effectiveness of the marker was further verified in the association analysis population. The specific experimental procedure is briefly described below.

[0058] (1) Primer design

[0059] The primer sequences used to convert the SNP marker (AX-94546744) to the KASP marker are as follows:

[0060] AX-94546744-F1:5'-GAAGGTGACCAAGTTCATGCTACATTTACCATTGAACCTCGCGCT-3'(SEQ ID No.2),

[0061] AX-94546744-F2:5'-GAAGGTCGGAGTCAACGGATTACATTTACCATTGAACCTCGCGCC-3'(SEQ ID No.3),

[0062] AX-94546744-R12:5'-GGTGTTTGAGGCATTGCGCTGATT-3' (SEQ ID No. 4).

[0063] (2) Genotyping

[0064] First, the three primers, each with a concentration of 10 μmol / L, were mixed with water in a volume ratio of 12(AX-94546744-F1):12(AX-94546744-F2):30(AX-94546744-R12):46(water) to form a Primer Mix.

[0065] Then, the PCR reaction was performed, and the 10 μl reaction system was designed as follows:

[0066] 2×KASP Master Mix, 5ul;

[0067] Primer Mix, 1.4ul;

[0068] MgCl2, 0.08 μL;

[0069] DNA (100 ng / ul), 1ul;

[0070] Water, 2.52 ul;

[0071] The reaction program was as follows: 95℃ for 15 min; 95℃ for 20 s, 65℃ for 1 min, 10 cycles (decreasing by 1℃ in each cycle); 95℃ for 20 s, 57℃ for 1 min, 30 cycles; 37℃ for 1 min; genotyping analysis was performed after the reaction was completed.

[0072] Example 3

[0073] Using the KASP marker and reaction system and procedure described above (AX-94546744), the genotypes of the association analysis population were identified, and the correlation between genotyping results and resistant starch content was analyzed. Figure 3 The effect of the AX-94546744 site polymorphism on the resistant starch content of grains (Table 1).

[0074] Table 1 Genotypes and resistant starch content of marker AX-94546744 in natural wheat populations

[0075]

[0076]

[0077]

[0078]

[0079]

[0080] Table 2. Correlation between polymorphism at the AX-94546744 site and grain resistant starch content.

[0081] genotype Number of varieties Resistant starch content (%) CC 26 4.93 TT 171 5.16 Deletion genotype 9 - P-value CC / TT 0.001807763

[0082] As shown in Table 2, the resistant starch content of grains of varieties (lines) with genotype TT is significantly higher than that of varieties (lines) with genotype CC. Selecting materials with genotype TT during breeding will help accelerate the breeding of wheat varieties with high resistant starch.

[0083] Unless otherwise specifically stated, the numerical values ​​set forth in these embodiments do not limit the scope of the invention. In all examples shown and described herein, any specific value should be interpreted as merely exemplary and not as a limitation, unless otherwise specified; therefore, other examples of exemplary embodiments may have different values.

Claims

1. Use of a substance for detecting the resistant starch content in wheat grains in any of the following applications: (A) Identifying or assisting in identifying the resistant starch content in wheat grains; (B) Comparison of the resistant starch content of the tested wheat grains; (C) breeding or screening wheat plants, lines, varieties or cultivars having a relatively high grain resistant starch content; (D) breeding or screening wheat plants, lines, varieties or cultivars having relatively low grain resistant starch content; (E) preparing a product for identifying or assisting in identifying or comparing the resistant starch content of wheat grains to be tested; (F) preparing a product for breeding or screening wheat plants, lines, strains or varieties having a relatively high grain resistant starch content; (G) preparing a product for breeding or screening wheat plants, lines, strains or varieties having a relatively low grain resistant starch content; (H) Improvement of resistant starch content in wheat grains; The substance is a set of primers for detecting the 36th genotype of the molecular marker AX-94546744 shown in SEQ ID No. 1 on chromosome 4D in the wheat genome, or a detection reagent or kit containing the set of primers, wherein the set of primers contains two upstream primers and one downstream primer, the upstream primers are AX-94546744-F1 and AX-94546744-F2, whose sequences are shown in SEQ ID No. 2 and SEQ ID No. 3, respectively, and the downstream primer is AX-94546744-R12, whose sequence is shown in SEQ ID No. 4; When the 36th base is a homozygous T, it is a genotype with a high resistant starch content in the wheat grain. When the 36th base is a homozygous C, it is a genotype with a low resistant starch content in the wheat grain.

2. Use any of the following methods: Method A: A method for comparing the resistant starch content of wheat grains to be tested, comprising the following steps: (A1) Detecting the genotype of the 36th position of the molecular marker represented by SEQ ID No. 1 on chromosome 4D in the wheat genome; (A2) determining the resistant starch content of the wheat grain to be tested as follows: if the 36th deoxyribonucleotide of the molecular marker represented by SEQ ID No. 1 on chromosome 4D in the genome is a homozygous T, the resistant starch content of the wheat grain to be tested is the highest; if the 36th deoxyribonucleotide of the molecular marker represented by SEQ ID No. 1 on chromosome 4D in the genome is a homozygous C, the resistant starch content of the wheat grain to be tested is the lowest; Method B: A method for breeding or screening wheat plants, lines, varieties, or varieties with relatively high grain resistant starch content, comprising the following steps: (B1) detecting the genotype of the 36th position of the molecular marker represented by SEQ ID No. 1 on chromosome 4D in the wheat genome; (B2) selecting a wheat plant to be tested that is homozygous for T at the 36th deoxyribonucleotide as a parent for breeding, and selecting a wheat plant that is homozygous for T at the 36th deoxyribonucleotide in each breeding generation, ultimately obtaining a wheat plant, plant line, strain, or variety with a relatively high grain resistant starch content; Method C: A method for breeding or screening wheat plants, lines, strains, or varieties with relatively low grain resistant starch content, comprising the following steps: (C1) detecting the genotype of the 36th position of the molecular marker represented by SEQ ID No. 1 on chromosome 4D in the wheat genome; (C2) selecting a wheat plant to be tested in which the 36th deoxyribonucleotide is homozygous for C as a parent for breeding, and selecting a wheat plant in which the 36th deoxyribonucleotide is homozygous for C in each breeding generation, and ultimately obtaining a wheat plant or plant line or line or variety with a relatively low grain resistant starch content.

3. The method according to claim 2, characterized in that (A1) (B1) (C1) The specific operation is: PCR amplification is performed on the wheat genomic DNA to be tested using a primer set for detecting the genotype at position 36 of the molecular marker AX-94546744 shown in SEQ ID No. 1 on chromosome 4D in the wheat genome, or a detection reagent or kit containing the primer set. The amplified product is scanned for fluorescence signals, the scan data is analyzed, and then the 36th deoxyribonucleotide shown in SEQ ID No. 1 on chromosome 4D in the wheat gene to be tested is determined as follows. The primer set contains two upstream primers and one downstream primer. The upstream primers are AX-94546744-F1 and AX-94546744-F2, whose sequences are shown in SEQ ID No. 2 and SEQ ID No. 3, respectively. The downstream primer is AX-94546744-R12, whose sequence is shown in SEQ ID No. 4: If the fluorescent signal data of the amplified product of the wheat to be tested is displayed as orange, the 36th deoxyribonucleotide of the molecular marker represented by SEQ ID No. 1 on chromosome 4D in the genome of the wheat to be tested is a homozygous T; If the fluorescent signal data of the amplified product of the wheat to be tested is displayed as blue, the 36th deoxyribonucleotide of the molecular marker shown by SEQ ID No. 1 on chromosome 4D in the genome of the wheat to be tested is a homozygous C.

4. The method according to claim 3, characterized in that The PCR reaction system is designed as follows: 2×KASP Master Mix, 5µl; Primer Mix, 1.4µl; MgCl2, 0.08µl; 100ng / µl DNA, 1µl; Water, 2.52µl.