A piperine 2-ene reductase, encoding gene and application

Abstract

The present invention relates to a 2-alkene reductase derived from pepper and a coding gene thereof, and application of the 2-alkene reductase in the catalytic preparation of tetrahydropiperine by microorganisms. The amino acid sequence of the pepper 2-alkene reductase is shown in SEQ ID NO.2, and the nucleotide sequence of the coding gene is shown in SEQ ID NO.1. The present invention provides a 2-alkene reductase capable of catalytically preparing tetrahydropiperine and a coding gene thereof, and the enzyme can be used to efficiently prepare tetrahydropiperine by taking piperine as a reaction substrate.

Description

(I) Technical field

[0001] The invention relates to a 2-alkene reductase derived from pepper and a coding gene thereof, and application of the 2-alkene reductase in preparing tetrahydropiperine by microbial catalysis, belonging to the technical field of enzyme catalysis. (II) Background technology

[0002] Tetrahydropiperine is an active ingredient derived from the dried nearly mature or mature fruit of the Piper nigrum L. plant of the Piperaceae family, and has the effects of anticonvulsant, antiepileptic and analgesic. In addition, tetrahydropiperine is also an efficient, safe and natural plant permeation enhancer, which can promote the absorption and utilization of some effective active ingredients by skin tissue by increasing the fluidity of the lipid bilayer and increasing the affinity of drug molecules or nutrients with cell membranes. It is widely used in the fields of food, medicine and cosmetics to improve the absorption and utilization of nutrients, effective ingredients and functional ingredients. The yield of tetrahydropiperine in pepper is low, and the extraction is difficult, so the price is high, while piperine is also extracted from the dried nearly mature or mature fruit of pepper, and its content can account for 4% to 9% of the pepper fruit, and the price is relatively low, and its structure is similar to tetrahydropiperine. Therefore, tetrahydropiperine can be obtained by hydrogenating piperine. (III) Summary of the invention

[0003] The invention aims to provide a 2-alkene reductase derived from pepper and a coding gene thereof, as well as application of the 2-alkene reductase in preparing tetrahydropiperine by microbial catalysis.

[0004] The technical solution adopted by the present invention is:

[0005] A piperine 2-ene reductase, the amino acid sequence of which is shown as SEQ ID NO.2.

[0006] The invention finds a 2-alkene reductase gene Pnaer in pepper, and the protein expressed by the gene can catalyze piperine to generate tetrahydropiperine. The production of tetrahydropiperine by using piperine 2-alkene reductase can greatly reduce the cost of tetrahydropiperine.

[0007] The present invention also relates to a gene encoding the piperine 2-ene reductase.

[0008] Specifically, the nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0009] The present invention also relates to a recombinant vector containing a gene encoding the piperine 2-ene reductase.

[0010] The invention also relates to a genetically engineered bacterium containing the gene of the piperine 2-ene reductase.

[0011] The invention also relates to the application of the piperine 2-ene reductase in the preparation of tetrahydropiperine by microbial catalysis.

[0012] The present invention also relates to a method for preparing tetrahydropiperine by using piperine 2-ene reductase, the method comprising: taking piperine as a reaction substrate, fermenting a fermentation liquid obtained by fermenting a genetically engineered bacterium into which a piperine 2-ene reductase gene shown in SEQ ID NO.1, and subjecting the fermentation liquid to cell crushing to obtain a crude enzyme liquid as a catalyst, reacting for 2 to 48 hours at a pH of 6.0 to 8.0 and a temperature of 25 to 50° C., and obtaining tetrahydropiperine in the reaction liquid.

[0013] Furthermore, the reaction can be added with coenzymes NAD(P)H and NAD(P) + , carried out in a coenzyme circulation system, wherein the coenzyme circulation system is an alcohol dehydrogenase / isopropanol, formate dehydrogenase / formate or glucose dehydrogenase / glucose system.

[0014] The beneficial effects of the present invention are mainly reflected in the following aspects: the present invention provides a 2-alkene reductase and its encoding gene that can catalyze the preparation of tetrahydropiperine. The enzyme is used with piperine as a reaction substrate. After 12 hours of reaction, the conversion rate of piperine is greater than 85%, and the highest product tetrahydropiperine concentration reaches 13.23 g L -1 , which can achieve efficient preparation of tetrahydropiperine. (IV) Description of the drawings

[0015] Figure 1 Schematic diagram of the reaction of piperine to tetrahydropiperine catalyzed by piperonene 2-ene reductase.

[0016] Figure 2 This is a nucleic acid gel image of the piperine 2-ene reductase gene.

[0017] Figure 3 This is the phylogenetic tree of piperine 2-ene reductase.

[0018] Figure 4 Analysis of piperine 2-ene reductase by SDS-PAGE.

[0019] Figure 5 This is the HPLC test result of the enzymatic reaction product of tetrahydropiperine. (V) Specific implementation methods

[0020] The present invention is further described in detail below in conjunction with specific embodiments, but the present invention is not limited to the following embodiments:

[0021] Unless otherwise specified, the methods used in the examples of the present invention are all conventional methods, and the reagents used are all commercially available.

[0022] LB solid medium composition: 5 g yeast extract, 10 g tryptone, 10 g NaCl, 20 g agar, distilled water to 1000 mL, pH 7.0.

[0023] LB liquid culture medium composition: 5 g yeast extract, 10 g tryptone, 10 g NaCl, and distilled water to 1000 mL, pH 7.0.

[0024] Example 1: Cloning of pepper Pnaer gene

[0025] Take 50 mg of nearly mature or mature pepper fruit, grind it with liquid nitrogen, add 500 μL of RNA lysis solution, mix well; add 500 μL of RNA diluent, mix well by inversion, centrifuge at 4°C, 14000×g for 10 min; carefully pipette the supernatant into a new 2.0 mL nuclease-free centrifuge tube, add 0.5 times the volume of anhydrous ethanol, and mix well with a pipette; transfer the mixture into the centrifuge column in batches (maximum volume 600 μL each time), centrifuge at 13000rpm for 1 min at 4°C, and discard the filtrate; add 600 μL of RNA washing solution to the centrifuge column, centrifuge at 13000rpm at 4°C for 1 min, and discard the filtrate; add 600 μL of RNA washing solution to the centrifuge column, centrifuge at 13000×g at 4°C Centrifuge at rpm for 45s and discard the filtrate; add 50μL of DNase I to the centrifuge column and incubate at room temperature for 15min; continue to add 600μL of RNA washing solution to the centrifuge column, centrifuge at 12000-14000rpm for 45s at 4℃, and discard the filtrate; repeat, centrifuge at 13000rpm at 4℃ for 2min in an empty column; add 50μL of RNase-free water to the centrifuge column, let it stand for 2min, centrifuge at 13000rpm for 1min at 4℃, collect RNA, and after detection on 1.5% agarose gel and determination of concentration, it can be directly used for cDNA synthesis.

[0026] Total RNA was converted into cDNA using a cDNA first-strand synthesis kit, and 4 μL of 4×gDNA wiper Mix, Oligo(dT) 23 VN (50μM) 1μL, Random hexamers (50ng / μL) 1μL, Total RNA 10pg-1μg or Poly A+RNA 10pg-100ng, add RNase-free water to a total system of 16μL, mix well, and incubate at 42℃ for 2min. Then add 10×RTMix 2μL and HiScript II Enzyme Mix 2μL, mix well, and incubate at 50℃ for 15min and 85℃ for 2min.

[0027] According to the pepper genome data, the cDNA sequence of the pepper Pnaer gene was found, and the full-length primers were designed using Primer Premier 5 software, Primer-F: 5'-ATGGCCGTGGTGCTA AAC-3'; Primer-R: 5'-TCAATGCTCATATGCTACTCGG-3', and synthesized. The first strand of cDNA was used as a template for full-length PCR amplification, and the amplification system was:

[0028]

[0029] PCR reaction conditions:

[0030]

[0031] After the PCR reaction is completed, take 5 μL of PCR product and add 1 μL of 6× DNA Loading buffer, mix well, and detect by 1% agarose gel electrophoresis (180V, 10min), and observe whether there is a target band on the gel imager. Perform gel electrophoresis on the remaining PCR product with the target band and recover the DNA product.

[0032] Add 4 μL of the recovered product to 1 μL of pEASY-Blunt Zero Vector and mix well. Connect in a PCR instrument at 25°C for 15 minutes. Add the connected product (5 μL) to 50 μL of DH5α competent cells and place on ice for 30 minutes. Heat shock in a 42°C water bath for 45 seconds and place on ice for 2 minutes. Add 500 μL of LB medium and culture on a shaker at 37°C, 170 rpm for 1 hour. In the clean bench, evenly spread the bacterial solution on the LB+Amp solid culture medium plate with a spreader. After the bacterial solution is completely absorbed, seal it and invert it in a 37°C incubator for 12 to 16 hours. In the clean bench, pick monoclonal colonies from the culture plate with a white gun tip, pick 6 single colonies from each plate, and transfer them to 2.0 mL centrifuge tubes containing 1 mL of LB+Amp liquid culture medium. Culture on a shaker at 37°C, 250 rpm for more than 1 hour for the preparation of the bacterial solution PCR system.

[0033] Bacterial liquid PCR reaction system:

[0034]

[0035] PCR reaction conditions:

[0036]

[0037] Take 7 μL of PCR product and add 2 μL of 6×DNA loading buffer to run 1% agarose gel electrophoresis (180V, 10 min). Observe whether there is a target band on the gel imager. Send the bacterial solution with the target fragment band for sequencing. The obtained gene sequence is SEQ ID NO.1.

[0038] Example 2: Expression of piperine 2-ene reductase

[0039] The amino acid sequence of the cloned pepper Pnaer gene (SEQ ID NO.2) was analyzed and aligned by Blast analysis on the NCBI website, and a phylogenetic tree was drawn. Figure 3 The function of the protein expressed by the Pnaer gene was predicted by phylogenetic tree analysis. The sequence of Pnaer is similar to that of 2-alkene reductase from Cinnamomum micranthum f.kanehirae.

[0040] Primer design:

[0041] Pnaer-F: 5'- CGCGGATCCGAATTCGAGCT ATGGCCGTGGTGCTAA AC-3′;

[0042] Pnaer-R: 5'- TGGTGGTGGTGCTCGAGTGC TCAATGCTCATATGCT ACTCGG-3'.

[0043] After the ORF of the cloned pepper Pnaer gene (SEQ ID NO. 1) was amplified (the amplification system and method were the same as in Example 1), it was constructed into the pET28a expression vector (SacI-HindIII) by seamless cloning and ligation.

[0044] Enzyme digestion reaction system:

[0045]

[0046] After the system is mixed, the enzyme digestion is carried out at 37°C for more than 1 hour.

[0047] The digested products and amplified products were separated by agarose gel electrophoresis (150V, 30min), and the target DNA was recovered by gel cutting. Seamless cloning and ligation reaction system:

[0048]

[0049] *According to the formula n×V plamid ×C plamid ×L DNA =V DNA ×C DNA ×L plamidCalculate the volume of the two: n refers to the molar ratio of DNA to linear vector, which is approximately 3:1 to 10:1, V refers to volume, C refers to molar concentration, and L refers to the base length of DNA or Plasmid.

[0050] Connect in a PCR instrument at 50°C for 30 minutes, add the connected product to 50 μL of DH5α competent cells, and culture overnight at 37°C. Pick a single colony for bacterial liquid PCR verification and sequencing verification, and transform the successfully constructed vector into E. coli BL21 competent cells.

[0051] BL21 Escherichia coli carrying the pET-28a-Pnaer gene was added to 5 mL of kanamycin (50 mg L -1 ) in LB liquid medium at 37°C, 200 rpm for 5-6 hours. Inoculate at a ratio of 1 / 1000 and expand the culture to 40 mL of LB+Kan liquid medium, and culture at 37°C, 200 rpm for 3-4 hours until OD 600 When the value reaches 0.6-0.8, IPTG is added to make the final concentration 0.5mM. Induce and culture for 12h at 25℃ and 200rpm. Centrifuge at 12000×g for 10min to collect the bacteria. Resuspend with 10mL of 1×PBS and use ultrasonic crusher to ultrasonically crush for 10min. Centrifuge at 4℃ and 12000×g for 10min and collect the supernatant. SDS-PAGE analysis of protein expression, the results are shown in Figure 4 The left side of the picture shows the sample protein band, and the right side shows the protein marker. It can be seen that the target protein band appears in the sample at around 40kDa, proving that Pnaer is successfully expressed.

[0052] Example 3: Tetrahydropiperine enzymatic reaction and product detection

[0053] The obtained cell disruption supernatant is used to prepare an enzymatic system for catalytic reaction. The enzymatic system is as follows:

[0054]

[0055] The coenzyme circulation system in the system is alcohol dehydrogenase / isopropanol. The buffer pH is 7.0, the reaction temperature is 30°C, and the reaction time is 2h. After the reaction is completed, it is extracted with ethyl acetate, and the ethyl acetate is removed by a rotary evaporator. The substrate is re-dissolved with methanol, and the product is detected by HPLC after passing through a microporous filter membrane. The results are shown in Figure 5 The peak time of the reference substance piperine is about 5.7min, and the peak time of the reference substance tetrahydropiperine is about 6.3min. Piperine and tetrahydropiperine can be detected in the sample at the same time.

[0056] HPLC detection conditions: UV detector, agilent C18 (250 mm×4.6 mm, 5 μm), mobile phase: mobile phase: water: acetonitrile = 55:45; detection wavelength is 230 nm, injection volume is 10 μL, flow rate: 1 mL / min, detection temperature: 40°C.

[0057] Example 4: Optimization of Tetrahydropiperine Enzymatic Reaction Conditions

[0058] The pH value of the reaction system was optimized, and the following reaction system was prepared using the Pnaer protein expressed in Example 2:

[0059]

[0060] The coenzyme circulation system in the system is alcohol dehydrogenase / isopropanol. Phosphate buffers of different pH values ​​were used to set reaction systems of different pH values, the pH values ​​of the reaction systems were 6.0, 7.0 and 8.0, the reaction temperature was 30°C, and the reaction time was 2h. The extraction and analysis of the reaction products were the same as in Example 3, and the reaction results are shown in Table 1. It can be seen that when the pH value of the reaction system was 7.0, the concentration of the reaction products was the highest.

[0061] Table 1: Effect of different pH on tetrahydropiperine production

[0062]

[0063] The reaction temperature was optimized and the following reaction system was prepared using the Pnaer protein expressed in Example 2:

[0064]

[0065] The coenzyme circulation system in the system is alcohol dehydrogenase / isopropanol. The pH of the reaction system is 7.0, the reaction temperatures are 25°C, 30°C, 35°C, 40°C, 45°C and 50°C, and the reaction time is 2h. The extraction and analysis of the reaction products are the same as in Example 3. The reaction results are shown in Table 2. It can be seen that when the reaction temperature is 30°C, the concentration of the reaction product is the highest.

[0066] Table 2: Effect of different reaction temperatures on tetrahydropiperine production

[0067]

[0068] The reaction time was optimized and the following reaction system was prepared using the Pnaer protein expressed in Example 2:

[0069]

[0070] The coenzyme circulation system in the system is alcohol dehydrogenase / isopropanol. The pH of the reaction system is 7.0, the reaction temperature is 30°C, and the reaction time is 48h. During the reaction, samples are taken to monitor the concentration of the product. The extraction and analysis of the reaction product are the same as in Example 3. The reaction results are shown in Table 3. It can be seen that the concentration of the reaction product increases with the increase of the reaction time, and the equilibrium is reached at the 12th hour of the reaction. The maximum reaction product concentration is 13.23g L -1 , the substrate conversion rate was 87%.

[0071] Table 3: Product concentration of tetrahydropiperine at different reaction times

[0072]

Claims

1. A piperine 2-ene reductase, the amino acid sequence of which is shown in SEQ ID NO.

2.

2. A gene encoding the piperine 2-ene reductase according to claim 1.

3. The gene according to claim 2, characterized in that The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

4. A recombinant vector containing a gene encoding the piperine 2-ene reductase according to claim 1.

5. A genetically engineered bacterium containing a gene encoding the piperine 2-ene reductase according to claim 1.

6. Use of the piperine 2-ene reductase according to claim 1 in catalyzing the preparation of tetrahydropiperine from piperine.

7. A method for preparing tetrahydropiperine using piperine 2-ene reductase, the method comprising: Piperine is used as a reaction substrate, fermentation liquid obtained by fermenting a genetically engineered bacterium into which a piperine 2-ene reductase gene shown in SEQ ID NO.1 is introduced, and the cells are crushed to obtain a crude enzyme liquid as a catalyst, and the reaction is carried out at a pH of 6.0-8.5 and a temperature of 25-50° C. for 2-48 hours to obtain tetrahydropiperine in the reaction liquid. NADPH is added to the reaction and the reaction is carried out in a coenzyme circulation system, wherein the coenzyme circulation system is an alcohol dehydrogenase / isopropanol, formate dehydrogenase / formate or glucose dehydrogenase / glucose system.

Images