Enzyme, strain for producing salidroside and production method
By knocking out the GAL80 gene in Saccharomyces cerevisiae and introducing the tyrosine decarboxylase mutant TYDCY350F and glucosyltransferase U8GT3, a new rhodiola synthesis pathway was constructed, which solved the shortcomings of wild plant extraction and chemical synthesis methods, and achieved efficient and environmentally friendly industrial production, suitable for medicine and cosmetics.
Patent Information
- Application Number
- CN202211708333.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-29
- Publication Date
- 2025-09-02
- Estimated Expiration
- 2042-12-29
AI Technical Summary
In the prior art, the extraction of rhodiola is dependent on wild plants, with low content, complex extraction process and limited by seasonal climate, and chemical synthesis methods are difficult to industrialize, and the metabolic flux of the existing yeast synthesis pathway is insufficient, making it difficult to meet industrial needs.
By knocking out the GAL80 gene of Saccharomyces cerevisiae, the tyrosine decarboxylase mutant TYDCY350F from poppy origin was introduced, and the glucosyltransferase U8GT3 and other metabolic pathways were combined to construct a new precursor synthesis pathway, decoupling microbial growth and product synthesis, and improving the synthesis efficiency of rhodioside.
It has achieved efficient and rapid production of rhodiola, reduced metabolic pressure, improved fermentation production efficiency, met industrial needs, and is environmentally friendly and has no pathogenic factors. It is suitable for the medical and cosmetic fields.
Smart Images

Figure BDA0004026514920000121 
Figure BDA0004026514920000131 
Figure BDA0004026514920000132
Abstract
Description
Technical Field
[0001] The present application relates to the field of biotechnology, and in particular to an enzyme, a strain for producing salidroside, and a production method. Specifically, the application of glucosyltransferase U8GT3 and / or tyrosine decarboxylase and / or tyrosine decarboxylase mutants derived from poppy in improving the yield of salidroside synthesized by yeast, the application of tyrosine decarboxylase and / or tyrosine decarboxylase mutants derived from poppy in improving the yield of tyrosol synthesized by yeast, a strain for producing salidroside, a biological material, a whole-cell catalyst, and a method for producing salidroside and / or tyrosol using yeast. Background Art
[0002] Salidroside is an important active substance in the Rhodiola rosea plant. It has multiple physiological activities such as improving immunity, anti-aging, anti-radiation, anti-fatigue, and anti-Alzheimer's disease. It is widely used in functional cosmetics such as whitening, anti-aging, and anti-ultraviolet radiation.
[0003] Currently, salidroside available on the market is primarily extracted from Rhodiola rosea, a rare wild plant found in high-altitude, pollution-free areas. However, its content in the plant is only 0.5% to 0.8%, making the extraction process relatively complex, subject to seasonal climate constraints, and requiring high labor and time costs. Current chemical synthesis methods are also cumbersome, making them difficult to commercialize. In response to growing market demand, the production of salidroside using microbial cell factories has become a more promising option.
[0004] Currently reported and publicly available methods for de novo synthesis of salidroside by yeast using glucose as a carbon source all involve converting 4-hydroxyphenylpyruvate (4-HPP) to 4-hydroxyphenylacetaldehyde (4-HPAA) via phenylpyruvate decarboxylase (ARO10), followed by the Ehrlich pathway to synthesize the key precursor tyrosol. While a series of metabolic pathway optimizations can improve the metabolic flux of the target product, the metabolic flux of its precursors still needs to be further improved for industrial production.
[0005] Therefore, designing and developing new precursor synthesis pathways and decoupling the cell growth of engineered yeast and the product synthesis of salidroside will greatly promote the industrial application of biological synthesis of salidroside and improve the economic benefits of fermentation production of salidroside. Summary of the Invention
[0006] In response to the deficiencies in the prior art, the present application provides an enzyme, a strain for producing salidroside, and a production method, specifically relating to the use of glucosyltransferase U8GT3 and / or tyrosine decarboxylase and / or tyrosine decarboxylase mutants derived from poppy in increasing the yield of salidroside synthesized using yeast, the use of tyrosine decarboxylase and / or tyrosine decarboxylase mutants derived from poppy in increasing the yield of tyrosol synthesized using yeast, a strain for producing salidroside, a biomaterial, a whole-cell catalyst, and a method for producing salidroside and / or tyrosol using yeast.
[0007] The purpose of this application is to overcome the existing technical difficulties. First, by knocking out the GAL80 gene in Saccharomyces cerevisiae and combining it with a galactose-inducible promoter, the cell growth of the brewing engineering bacteria and the synthesis of salidroside products are decoupled, thereby reducing the metabolic pressure caused by the target pathway on the engineering bacteria, thereby achieving efficient and rapid production of salidroside. Secondly, the tyrosine decarboxylase (TYDC) gene from poppy (Papaver somniferum) is introduced to mutate the codon encoding the 350th amino acid to the codon encoding phenylalanine (TYDC). Y350F ), the TYDC Y350F The mutant can directly catalyze the synthesis of 4-hydroxyphenylacetaldehyde (4-HPAA) from tyrosine, thereby constructing a new precursor synthesis pathway. Combining the two aforementioned new and old metabolic pathways can further direct the metabolic flow towards the synthesis of the target product salidroside, thereby improving the economic benefits of fermentation production of salidroside.
[0008] Specifically, this application involves the following aspects:
[0009] 1. Use of glucosyltransferase U8GT3 and / or tyrosine decarboxylase and / or tyrosine decarboxylase mutants derived from poppy in increasing the yield of salidroside synthesized by yeast.
[0010] 2. Use of tyrosine decarboxylase and / or tyrosine decarboxylase mutants derived from poppy in increasing the yield of tyrosol synthesis using yeast.
[0011] 3. The use according to item 1 or 2,
[0012] The amino acid sequence of the tyrosine decarboxylase mutant is shown in SEQ ID NO.7;
[0013] The amino acid sequence of the poppy-derived tyrosine decarboxylase is shown in SEQ ID NO.8;
[0014] The amino acid sequence of the glucosyltransferase U8GT3 is shown in SEQ ID NO.10;
[0015] 4. The use according to item 1, 2 or 3,
[0016] The nucleic acid molecule of the tyrosine decarboxylase mutant is shown in SEQ ID NO.1;
[0017] The nucleic acid molecule of the tyrosine decarboxylase derived from poppy is shown in SEQ ID NO.2;
[0018] The nucleic acid molecule of the glucosyltransferase U8GT3 is shown in SEQ ID NO.4.
[0019] 5. A strain for producing salidroside, comprising heterologously expressing one or more genes of a) to c) below in yeast;
[0020] a) a gene encoding glucosyltransferase U8GT3;
[0021] b) a gene encoding tyrosine decarboxylase from opium poppy;
[0022] c) A gene encoding a tyrosine decarboxylase mutant.
[0023] 6. The strain according to item 5,
[0024] The amino acid sequence of the glucosyltransferase U8GT3 is shown in SEQ ID NO.10;
[0025] The amino acid sequence of the poppy-derived tyrosine decarboxylase is shown in SEQ ID NO.8;
[0026] The tyrosine decarboxylase mutant is a tyrosine decarboxylase mutant in which the tyrosine at position 350 is mutated to phenylalanine, and its amino acid sequence is shown in SEQ ID NO.7.
[0027] 7. The strain according to item 5 or 6,
[0028] The nucleic acid molecule of the tyrosine decarboxylase derived from poppy is shown in SEQ ID NO.2;
[0029] The nucleic acid molecule of the tyrosine decarboxylase mutant is shown in SEQ ID NO.1;
[0030] The nucleic acid molecule of the glucosyltransferase U8GT3 is shown in SEQ ID NO.4.
[0031] 8. The strain according to item 5,
[0032] Furthermore, a gene encoding phenylpyruvate decarboxylase ARO10 and / or a gene encoding benzoate dehydrogenase TYR1 was heterologously expressed in yeast;
[0033] Preferably,
[0034] The amino acid sequence of the phenylpyruvate decarboxylase ARO10 is shown in SEQ ID NO.11;
[0035] The amino acid sequence of the benzoate dehydrogenase TYR1 is shown in SEQ ID NO.12;
[0036] More preferably,
[0037] The nucleic acid molecule of the phenylpyruvate decarboxylase ARO10 is shown in SEQ ID NO.5;
[0038] The nucleic acid molecule of the benzoate dehydrogenase TYR1 is shown in SEQ ID NO.6.
[0039] 9. Biomaterial, wherein the biomaterial is any of the following:
[0040] A1) a nucleic acid molecule encoding a tyrosine decarboxylase and / or a tyrosine decarboxylase mutant derived from opium poppy;
[0041] A2) an expression cassette containing the nucleic acid molecule described in A1);
[0042] A3) A recombinant vector containing the nucleic acid molecule described in A1), or a recombinant vector containing the expression cassette described in A2).
[0043] 10. The biomaterial according to item 9,
[0044] The amino acid sequence of the tyrosine decarboxylase mutant is shown in SEQ ID NO.7;
[0045] The amino acid sequence of the poppy-derived tyrosine decarboxylase is shown in SEQ ID NO.8;
[0046] Preferably,
[0047] The nucleic acid molecule of the tyrosine decarboxylase mutant is shown in SEQ ID NO.1.
[0048] The nucleic acid molecule of the tyrosine decarboxylase derived from poppy is shown in SEQ ID NO.2;
[0049] 11. Biomaterial, wherein the biomaterial is any of the following:
[0050] B1) a nucleic acid molecule encoding glucosyltransferase U8GT3;
[0051] B2) an expression cassette containing the nucleic acid molecule described in B1);
[0052] B3) a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2).
[0053] 12. The biomaterial according to item 10,
[0054] The amino acid sequence of the glucosyltransferase U8GT3 is shown in SEQ ID NO.10;
[0055] Preferably,
[0056] The nucleic acid molecule of the glucosyltransferase U8GT3 is shown in SEQ ID NO.4.
[0057] 13. A whole-cell catalyst comprising the strain described in any one of items 5 to 8 or the biological material described in any one of items 9 to 12.
[0058] 14. A method for producing salidroside and / or tyrosol using yeast, comprising fermenting salidroside and / or tyrosol using the strain described in any one of items 5 to 8, the biological material described in any one of items 9 to 12, or the whole-cell catalyst described in item 13.
[0059] 15. The method according to claim 14,
[0060] The process includes: fermentation to OD 600 When the temperature is 8-15, add galactose;
[0061] Preferably, the concentration of galactose is 1-4 g / L;
[0062] More preferably, the fermentation time is 90-120 hours.
[0063] 16. The use described in any one of items 1-4, the strain described in items 5-8, the biomaterial described in any one of items 9-12, the whole-cell catalyst described in item 13, or the method described in item 14 or 15, wherein the strain is yeast, preferably Saccharomyces cerevisiae.
[0064] 17. A method for producing salidroside, comprising the following steps:
[0065] Synthesizing tyrosol using a carbon source; and
[0066] Synthesis of salidroside using tyrosol;
[0067] Among them, in the step of synthesizing tyrosol using a carbon source, benzoate dehydrogenase and phenylpyruvate decarboxylase are used to synthesize tyrosol.
[0068] And in the step of synthesizing salidroside from tyrosol, glucosyltransferase is used to synthesize salidroside.
[0069] 18. The method according to claim 16,
[0070] The glucosyltransferase is derived from Rhodiola rosea;
[0071] Preferably,
[0072] The nucleic acid molecule of the glucosyltransferase is shown in SEQ ID NO.4;
[0073] The amino acid sequence of the glucosyltransferase U8GT3 is shown in SEQ ID NO.10.
[0074] 19. The method according to claim 16,
[0075] The method further comprises using poppy-derived tyrosine decarboxylase and / or a tyrosine decarboxylase mutant to synthesize tyrosol in the step of synthesizing tyrosol using a carbon source.
[0076] 20. The method according to claim 19,
[0077] The amino acid sequence of the tyrosine decarboxylase mutant is shown in SEQ ID NO.7;
[0078] The amino acid sequence of the poppy-derived tyrosine decarboxylase is shown in SEQ ID NO.8;
[0079] The amino acid sequence of the glucosyltransferase U8GT3 is shown in SEQ ID NO.10;
[0080] Preferably,
[0081] The nucleic acid molecule of the tyrosine decarboxylase mutant is shown in SEQ ID NO.1;
[0082] The nucleic acid molecule of the tyrosine decarboxylase derived from poppy is shown in SEQ ID NO.2;
[0083] The nucleic acid molecule of the glucosyltransferase U8GT3 is shown in SEQ ID NO.4.
[0084] Effect of this application
[0085] (1) This application achieves the decoupling of microbial growth and product synthesis, reduces the metabolic pressure of the target pathway on the engineered bacteria, and further improves production efficiency while increasing cell density.
[0086] (2) This application introduces the tyrosine decarboxylase mutant TYDC Y350F , designed and constructed a new precursor synthesis pathway, pulling the metabolic flow towards the synthesis of the target product salidroside, and improving the economic benefits of fermentation production of salidroside.
[0087] (3) The engineered yeast strain of this application can directly synthesize salidroside by metabolizing glucose, methanol, galactose, glycerol, or trehalose. Compared with traditional plant extraction, it is not restricted by climate and geographical conditions, is environmentally friendly, and the fermentation substrate is common and inexpensive, meeting the strategic needs of national green biomanufacturing. It also contains no potential pathogenic factors, and the quality and safety of the product are guaranteed, making it suitable for use in the fields of medicine, cosmetics, etc. BRIEF DESCRIPTION OF THE DRAWINGS
[0088] Figure 1 This is a diagram showing the fermentation results of the strain synthesizing salidroside de novo;
[0089] Figure 2 Liquid chromatograms of salidroside standard and salidroside produced by recombinant strain under the same conditions. DETAILED DESCRIPTION
[0090] The present application is further described below with reference to examples. It should be understood that the examples are only used to further illustrate and explain the present application and are not intended to limit the present application.
[0091] Unless otherwise defined, technical and scientific terms used in this specification have the same meaning as those commonly understood by those skilled in the art. Although methods and materials similar or identical to those described herein may be used in experiments or practical applications, the materials and methods are described herein below. In the event of a conflict, the present specification, including definitions, will prevail. In addition, the materials, methods, and examples are provided for illustrative purposes only and are not intended to be limiting. The present application is further described below with reference to specific examples, which are not intended to limit the scope of this application.
[0092] Enzymes
[0093] Benzoate dehydrogenase, derived from Saccharomyces cerevisiae, catalyzes the conversion of pre-phenate to 4-hydroxyphenylpyruvate, thereby participating in tyrosine synthesis. Overexpression of this benzoate dehydrogenase can promote tyrosine synthesis and thus promote metabolic flow to salidroside.
[0094] Benzoate dehydrogenase in this application is referred to as TYR1.
[0095] Phenylpyruvate decarboxylase, derived from Saccharomyces cerevisiae, catalyzes the decarboxylation of phenylpyruvate to phenylacetaldehyde, the first specific step in the Ehrlich pathway. Overexpression of this enzyme can increase tyrosol levels in Saccharomyces cerevisiae, thereby enhancing the accumulation of salidroside precursors.
[0096] Phenylpyruvate decarboxylase in this application is referred to as ARO10.
[0097] Glucosyltransferase is derived from Rhodiola rosea. Under the catalysis of this enzyme, uridine diphosphate glucose (UDPG) serves as a glycosylation donor, and tyrosol undergoes glycosidation to produce salidroside.
[0098] The glucosyltransferase in this application is UDP-glucosyltransferase, referred to as U8GT3 or RvU8G3.
[0099] Tyrosine decarboxylase is a pyridoxal phosphate (PLP)-dependent decarboxylase derived from poppy. Tyrosine is catalyzed by the enzyme to produce tyramine, which is then catalyzed by monoamine oxidase to produce 4-hydroxyphenylacetaldehyde (4-HPAA). 4-HPAA is reduced by 4-hydroxybenzylalcoholdehydrogenase (areB) to synthesize tyrosol, the aglycone of salidroside.
[0100] In one embodiment of the present application, the tyrosine decarboxylase is a tyrosine decarboxylase derived from poppy. In one embodiment of the present application, the tyrosine decarboxylase is a tyrosine decarboxylase mutant of the present application.
[0101] The tyrosine decarboxylase mutant of the present application is referred to as TYDC. Y350F , which means that the original tyrosine at position 350 mutates to phenylalanine, and its function changes from catalyzing the decarboxylation of tyrosine to form tyramine to catalyzing tyrosine directly to generate 4-hydroxyphenylacetaldehyde.
[0102] DNA
[0103] In the present application, the glucosyltransferase is derived from Rhodiola rosea.
[0104] In the present application, the GeneBank number of the glucosyltransferase encoding gene is AUI41117.
[0105] In some embodiments of the present application, the amino acid sequence of the glucosyltransferase U8GT3 is shown as SEQ ID NO.10.
[0106] In some embodiments of the present application, the nucleic acid molecule of the glucosyltransferase U8GT3 is shown as SEQ ID NO.4.
[0107] In the present application, the tyrosine decarboxylase is derived from poppy (Papaver somniferum).
[0108] In some embodiments of the present application, the amino acid sequence of the poppy-derived tyrosine decarboxylase is shown as SEQ ID NO.8.
[0109] In some embodiments of the present application, the nucleic acid molecule of the opium poppy-derived tyrosine decarboxylase is shown in SEQ ID NO. 2. In the present application, the tyrosine decarboxylase mutant is a mutant in which the tyrosine at position 350 is mutated to phenylalanine.
[0110] In some embodiments of the present application, the amino acid sequence of the tyrosine decarboxylase mutant is shown in SEQ ID NO.7.
[0111] In some embodiments of the present application, the nucleic acid molecule of the tyrosine decarboxylase mutant is shown as SEQ ID NO.1.
[0112] In some embodiments of the present application, the tyrosine decarboxylase is derived from Arabidopsis thaliana, wherein the nucleic acid molecule of the tyrosine decarboxylase derived from Arabidopsis thaliana is shown as SEQ ID NO.3.
[0113] In the present application, the GeneBank number of the phenylpyruvate decarboxylase encoding gene is 851987.
[0114] In some embodiments of the present application, the amino acid sequence of the phenylpyruvate decarboxylase ARO10 is shown as SEQ ID NO.11.
[0115] In some embodiments of the present application, the nucleic acid molecule of the phenylpyruvate decarboxylase ARO10 is shown as SEQ ID NO.5.
[0116] In the present application, the GeneBank number of the benzoate dehydrogenase encoding gene is 852464.
[0117] In some embodiments of the present application, the amino acid sequence of the benzoate dehydrogenase TYR1 is shown as SEQ ID NO.12.
[0118] In some embodiments of the present application, the nucleic acid molecule of the benzoate dehydrogenase TYR1 is shown as SEQ ID NO.6.
[0119] Biomaterials
[0120] The present application provides a biomaterial, which is any of the following:
[0121] A1) a nucleic acid molecule encoding a tyrosine decarboxylase and / or a tyrosine decarboxylase mutant derived from opium poppy;
[0122] A2) An expression cassette containing the nucleic acid molecule described in A1):
[0123] A3) a recombinant vector containing the nucleic acid molecule described in A1), or a recombinant vector containing the expression cassette described in A2);
[0124] A4) A recombinant microorganism containing the nucleic acid molecule described in A1), or a recombinant microorganism containing the expression cassette described in A2), or a recombinant microorganism containing the recombinant vector described in A3), preferably a yeast.
[0125] Tyrosine decarboxylase from opium poppy is described above.
[0126] Tyrosine decarboxylase mutants are described above.
[0127] The present application provides a biomaterial, which is any of the following:
[0128] B1) a nucleic acid molecule encoding a glucosyltransferase U8GT3, wherein the glucosyltransferase is derived from Rhodiola rosea;
[0129] B2) An expression cassette containing the nucleic acid molecule described in B1):
[0130] B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);
[0131] B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3), preferably a yeast.
[0132] Glucosyltransferase U8GT3 is described above.
[0133] Production Process
[0134] The present application provides the use of the above-mentioned glucosyltransferase U8GT3 and / or the above-mentioned poppy-derived tyrosine decarboxylase and / or the above-mentioned tyrosine decarboxylase mutant in increasing the yield of salidroside synthesized by yeast.
[0135] The present application provides the use of the poppy-derived tyrosine decarboxylase and / or the tyrosine decarboxylase mutant in increasing the yield of tyrosol synthesized by yeast.
[0136] The present application provides the use of the above-mentioned biomaterial in the synthesis of tyrosol.
[0137] The present application provides a strain for producing salidroside, comprising heterologously expressing one or more genes of the following a) to c) in yeast;
[0138] a) a gene encoding glucosyltransferase U8GT3;
[0139] b) a gene encoding tyrosine decarboxylase from opium poppy;
[0140] c) a gene encoding a tyrosine decarboxylase mutant;
[0141] Glucosyltransferase U8GT3, opium poppy-derived tyrosine decarboxylase, and tyrosine decarboxylase mutants are described above.
[0142] In some embodiments of the present application, a gene encoding phenylpyruvate decarboxylase ARO10 and / or a gene encoding benzoate dehydrogenase TYR1 is further heterologously expressed in yeast.
[0143] Phenylpyruvate decarboxylase ARO10 and benzoate dehydrogenase TYR1 are described above.
[0144] The present application provides a whole-cell catalyst containing the above-mentioned strain or the above-mentioned biological material.
[0145] The present application provides a method for producing salidroside and / or tyrosol by using yeast, wherein the above-mentioned strain, the above-mentioned biological material or the above-mentioned whole-cell catalyst is used to ferment and produce salidroside and / or tyrosol.
[0146] The present application provides a method for producing salidroside, comprising the following steps: synthesizing tyrosol from a carbon source; and synthesizing salidroside from tyrosol; wherein, in the step of synthesizing tyrosol from a carbon source, benzoate dehydrogenase and phenylpyruvate decarboxylase are used to synthesize tyrosol, and in the step of synthesizing salidroside from tyrosol, glucosyltransferase is used to synthesize salidroside.
[0147] This application explores tyrosine decarboxylase TYDC and tyrosine decarboxylase mutant TYDC Y350F Effects on the synthesis of precursors of the tyrosine decarboxylase mutant TYDC Y350F It can greatly increase the accumulation of the precursor 4-HPAA, while tyrosine decarboxylase TYDC converts tyrosine into a by-product tyramine, reducing the synthesis of the precursor.
[0148] In some embodiments of the present application, the method for producing salidroside comprises the following steps: synthesizing tyrosol using a carbon source; and synthesizing salidroside using tyrosol; wherein, in the step of synthesizing tyrosol using a carbon source, benzoate dehydrogenase, phenylpyruvate decarboxylase and poppy-derived tyrosine decarboxylase and / or a tyrosine decarboxylase mutant are used to synthesize tyrosol, and in the step of synthesizing salidroside using tyrosol, glucosyltransferase is used to synthesize salidroside.
[0149] Tyrosine decarboxylase TYDC Y350FThe mutant refers to a mutation in which the tyrosine at position 350 is changed to phenylalanine, and its function is changed from catalyzing the decarboxylation of tyrosine to form tyramine to catalyzing the direct generation of 4-hydroxyphenylacetaldehyde from tyrosine.
[0150] Glucosyltransferase U8GT3, opium poppy-derived tyrosine decarboxylase, and tyrosine decarboxylase mutants are described above.
[0151] Phenylpyruvate decarboxylase ARO10 and benzoate dehydrogenase TYR1 are described above.
[0152] In some embodiments of the present application, yeast is used as the starting strain, and the above-mentioned enzymes encoding benzoate dehydrogenase TYR1, phenylpyruvate decarboxylase ARO10, tyrosine decarboxylase TYDC are introduced. Y350F and nucleic acid molecules of glucosyltransferase U8GT3 are used to construct the yeast engineering bacteria, wherein the introduced genes are all controlled by a galactose-inducible promoter.
[0153] In some embodiments of the present application, the method for producing salidroside is fermentation using engineered bacteria.
[0154] In some embodiments of the present application, the strain is an optional yeast suitable for the system of the present application, such as Saccharomyces cerevisiae, Candida, Rhodotorula, Pichia pastoris, Saccharomyces cerevisiae, Candida, wine yeast, Pasteurella, aroma yeast and Geotrichum candidum, etc., preferably, Saccharomyces cerevisiae.
[0155] In some embodiments of the present application, the fermentation culture is carried out to OD 600 When the OD value of the fermentation culture is 8 to 15, galactose is added; for example, 600 The concentration of galactose may be 8, 9, 10, 11, 12, 13, 14, 15 or any range therebetween. In some embodiments of the present application, the concentration of galactose is 1-4 g / L; for example, the concentration of galactose may be 1 g / L, 2 g / L, 3 g / L, 4 g / L or any range therebetween.
[0156] In some embodiments of the present application, the fermentation time is 90-120 h; for example, the fermentation time is 90 h, 95 h, 100 h, 105 h, 110 h, 115 h, 120 h or any range therebetween.
[0157] The present application provides an enzyme combination, which includes: benzoate dehydrogenase, phenylpyruvate decarboxylase, and glucosyltransferase; or, the enzyme combination includes: benzoate dehydrogenase, phenylpyruvate decarboxylase, glucosyltransferase, and tyrosine decarboxylase.
[0158] The term "enzyme combination" refers to a combination of benzoate dehydrogenase, phenylpyruvate decarboxylase, and glucosyltransferase in this application; or a combination of benzoate dehydrogenase, phenylpyruvate decarboxylase, glucosyltransferase, and tyrosine decarboxylase. In this application, the term "enzyme combination" is intended to represent a functional combination of enzymes, i.e., a physical mixture of three or four enzyme proteins. For example, it can be a direct mixture of purchased pure enzymes, or a direct mixture of crude enzyme solutions or purified enzymes produced by genetic recombinant expression using molecular biological methods. The enzyme combination can be a fusion protein formed by fusing three or four enzymes into a three-dimensional protein structure, as long as each enzyme can perform its corresponding function. Similarly, it can be a simple mixture of a fusion protein of any two enzymes and two other enzymes, or a simple mixture of a fusion protein of any three enzymes and another enzyme, or a simple mixture of a fusion protein of any two enzymes and a fusion protein of two other enzymes. Alternatively, it can be a simple mixture of a fusion protein of any two enzymes and another enzyme, or a fusion protein of any three enzymes, or a fusion protein of any three enzymes.
[0159] Likewise, in this application, there is no limitation on the process of producing enzymes by gene recombination expression using molecular biological methods, and any known method can be used. In this application, the same host can be used to simultaneously express four enzymes or a fusion protein of three enzymes using a single plasmid, or different hosts can be used to produce one or two of the enzymes or fusion proteins of the enzymes.
[0160] In some embodiments of the present application, the combination is a fusion protein formed by benzoate dehydrogenase, phenylpyruvate decarboxylase, and glucosyltransferase; or
[0161] The combination is a composition of a fusion protein formed by benzoate dehydrogenase, phenylpyruvate decarboxylase and glucosyltransferase; or
[0162] The combination is a fusion protein formed by benzoate dehydrogenase, phenylpyruvate decarboxylase, glucosyltransferase and tyrosine decarboxylase; or
[0163] The combination is a composition of a fusion protein formed by benzoate dehydrogenase, phenylpyruvate decarboxylase, glucosyltransferase and tyrosine decarboxylase; or
[0164] The combination is a composition of a fusion protein formed by benzoate dehydrogenase and phenylpyruvate decarboxylase, glucosyltransferase and tyrosine decarboxylase; or
[0165] The combination is a composition of a fusion protein formed by benzoate dehydrogenase and phenylpyruvate decarboxylase and a fusion protein formed by glucosyltransferase and tyrosine decarboxylase.
[0166] In some embodiments of the present application, the combination is a mixture of a crude fermentation enzyme solution for benzoate dehydrogenase, a crude fermentation enzyme solution for phenylpyruvate decarboxylase, and a crude fermentation enzyme solution for glucosyltransferase.
[0167] In some embodiments of the present application, the combination is a mixture of a crude fermentation enzyme solution for benzoate dehydrogenase, a crude fermentation enzyme solution for phenylpyruvate decarboxylase, a crude fermentation enzyme solution for glucosyltransferase, and a crude fermentation enzyme solution for tyrosine decarboxylase.
[0168] In some embodiments of the present application, the combination is a fusion protein formed by benzoate dehydrogenase, phenylpyruvate decarboxylase, glucosyltransferase and tyrosine decarboxylase; or a composition of a fusion protein of benzoate dehydrogenase and phenylpyruvate decarboxylase with glucosyltransferase and tyrosine decarboxylase; or a composition of a fusion protein of benzoate dehydrogenase and phenylpyruvate decarboxylase with glucosyltransferase and tyrosine decarboxylase.
[0169] The present application provides a whole-cell catalyst containing the above-mentioned genetically engineered bacteria or a combination of the above-mentioned genetically engineered bacteria.
[0170] The present application provides a method for producing salidroside, comprising the above-mentioned enzyme combination.
[0171] Example
[0172] Example 1 Cloning of genes required for salidroside synthesis.
[0173] The plant or microbial enzymes required for the salidroside synthesis pathway were identified from different plant sources through the National Center for Bioinformation (NCBI) (https: / / www.ncbi.nlm.nih.gov / ) and literature searches, and the corresponding amino acid sequences or gene sequences were found.
[0174] The obtained gene sequence was codon optimized by the codon optimization algorithm developed by GenScript Biotechnology Co., Ltd. and optimized according to the corresponding yeast host, as shown in the sequence table, wherein the tyrosine decarboxylase TYDC Y350F The nucleic acid molecule of the target gene is shown in SEQ ID NO. 1, and the nucleic acid molecule of the glucosyltransferase U8GT3 is shown in SEQ ID NO. 4. The target gene is directly synthesized in the universal plasmid pESC series with a galactose promoter (pGAL1 or pGAL10) to obtain a recombinant plasmid with the target gene, as shown in Table 1.
[0175] Table 1 Plasmids used for strain construction
[0176]
[0177] Example 2 Construction of engineered bacteria.
[0178] 2.1 Experimental Materials
[0179] The experimental materials used in this example are primers 1-F and 1-R, and primers 2-F and 2-R.
[0180] Primer 1-F: ttaacgtcaaggagaaaaaaccccggatccatggtatcagaggataagattgagc (SEQID NO.13)
[0181] Primer 1-R: tagctagccgcggtaccaagcttactcgagttatgtatttcttttttcagcggcc (SEQID NO.14)
[0182] Primer 2-F: tccttgtaatccatcgatactagtgcggccgcctattttttatttcttttaagtgccgct (SEQ ID NO.15)
[0183] Primer 2-R:tcgaattcaaccctcactaaagggcggccgcatggcacctgttacaattgaaaag (SEQ ID NO.16)
[0184] 2.2 Construction of pESC-TYR1-Aro10 recombinant plasmid
[0185] 1) Construction of vector fragment
[0186] The pESC vector was treated with the enzyme digestion system shown in Table 2 using both NotI and BamHI (both purchased from New England Biolabs). The digestion system was then incubated in a 37°C water bath for 1 hour. DNA from the backbone and promoter fragments was purified using a gel recovery kit from Thermo Fisher Scientific to obtain the purified Backbone1 fragment and the Gal1-Gal10 dual promoter fragment.
[0187] Table 2 Enzyme digestion system
[0188]
[0189] 2) Amplification and recovery of target genes
[0190] Table 3 PCR reaction system (2×Phanta Flash Master Mix)
[0191]
[0192] Table 4 PCR reaction program (2×Phanta Flash Master Mix)
[0193]
[0194] TYR1 and Aro10 genes were cloned using 2× Phanta Flash Master Mix purchased from Nanjing Novozymes Biotechnology Co., Ltd. as the amplification enzyme, and primers 1-F, 1-R, 2-F, and 2-R, respectively. The PCR reaction system and reaction procedures are shown in Tables 3 and 4. Amplified Aro10 and TYR1 genes were purified and recovered using a gel recovery kit purchased from Thermo Fisher Scientific.
[0195] 3) In vitro multi-fragment ligation using SOE-PCR
[0196] Table 5 SOE-PCR reaction system (2×Phanta Flash Master Mix)
[0197]
[0198] The purified TYR1, Aro10, and Gal1-Gal10 promoter fragments were ligated and amplified using the SOE-PCR method. PCR was performed using the TYR1, Aro10, and Gal1-Gal10 promoter fragments as templates, 2× Phanta Flash Master Mix (purchased from Nanjing Novozymes Biotechnology Co., Ltd.), and primers 1-F and 2-R, respectively. The PCR reaction system and procedure are shown in Table 5 and Table 4, respectively. DNA from the ligated amplified TYR1-Gal1-Gal10-Aro10 gene was purified using a gel recovery kit (purchased from Thermo Fisher Scientific).
[0199] 4) Gibson connection
[0200] The TYR1-Gal1-Gal10-Aro10 fragment was ligated with the Backbone1 fragment by Gibson ligation to construct the recombinant plasmid pESC-TYR1-Aro10. HiFi DNA Assembly Master Mix was obtained from NEB. The ligation reaction system is shown in Table 6, with a vector-to-insert gene ratio of 1:2. The prepared ligation system was placed in a 50°C water bath. After 60 minutes, the ligation product was removed and transformed into E. coli DH5α.
[0201] Table 6 Gibson connection system
[0202]
[0203] 5) Chemical transformation of Escherichia coli
[0204] Remove the E. coli competent cells DH5α from the ultra-low temperature freezer and place them on ice to thaw. Add 10 μL of the Gibson ligation product to the thawed competent cells, flick to mix, and place on ice for 30 minutes. Heat shock in a 42°C water bath for 90 seconds, remove and place on ice for 2 minutes. Add 200 μL of LB liquid culture medium and culture at 37°C, 220 rpm for 60 minutes. In the clean bench, take an appropriate amount of bacterial liquid and spread it on LB solid culture medium containing ampicillin (100 mg / L) and culture it upside down in a 37°C constant temperature incubator overnight.
[0205] 6) Sequencing verification
[0206] After a single colony grows on the plate, use colony PCR to screen and identify the recombinant plasmids. 2× Rapid Taq Master Mix purchased from Nanjing Novozymes Biotechnology Co., Ltd. was used as the amplification enzyme. The colony PCR reaction system is shown in Table 7. After preparation, use a sterile pipette tip to pick up a single E. coli colony in 10 μL of sterile water in a clean bench. After fully dissolving, 1 μL is added as a template to the colony PCR reaction system. Gene amplification is performed according to the reaction protocol in Table 8.
[0207] Table 7 PCR reaction system (2×Rapid Taq Master Mix)
[0208]
[0209] Table 8 PCR reaction program (2×Rapid Taq Master Mix)
[0210]
[0211] PCR products were verified by agarose gel electrophoresis. Single colonies containing the target bands were selected and inoculated into LB medium containing ampicillin (100 mg / L) and cultured overnight at 37°C and 220 rpm. The corresponding plasmids were extracted using a plasmid extraction kit purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. and delivered to Suzhou Genewise for gene sequencing verification.
[0212] 2.2 Construction of SAD1, SAD2, SAD3, SDA4, and SAD5 strains
[0213] The genes in Table 9 were used as templates with integration plasmids, and PCR was used to amplify linearized fragments for yeast genome integration (reaction system and procedure are shown in Tables 3 and 4). The target gene fragments containing homology arms of the integration site were obtained by agarose gel electrophoresis and gel recovery. Yeast transformation was then performed according to the method described in Application Example 1. The transformed yeast used the 40 bp homology arms on the left and right of the integration site on the target fragment to perform homologous recombination with the chassis host genome, and the expression cassette containing the fusion gene was integrated into the target site of the yeast chassis genome. ARO10 and TYR1 were integrated into the UAR3 defective position of Saccharomyces cerevisiae (denoted as CEN.PK2-ΔURA3::ARO10-TYR1, and the yeast was named SAD1). Based on this chassis strain (SAD1), UGT3 was integrated into the GAL80 site (denoted as SAD2-ΔHIS3::TYDC Y350F , yeast named SAD2); TYDC was integrated on this chassis bacteria (SAD2) Y350F to the HIS3 site (denoted as SAD2-ΔHIS3::TYDC Y350F , the yeast was named SAD3); based on this chassis strain (SAD2), tyrosine decarboxylase from poppy (abbreviated as TYDC) was integrated into the HIS3 site (denoted as SAD2-ΔHIS3::TYDC, the yeast was named SAD4); based on this chassis strain (SAD2), tyrosine decarboxylase from Arabidopsis thaliana (abbreviated as AtTYDC) was integrated into the HIS3 site (denoted as SAD2-ΔHIS3::AtTYDC, the yeast was named SAD5).
[0214] PCR verification of yeast transformants
[0215] Invert the plate coated with the transformation and culture it at 30°C for 2-3 days. After a single colony grows on the plate, pick a single colony grown on the solid plate and inoculate it into SC liquid medium. Culture it overnight at 30°C and 220rpm. Use a yeast genome extraction kit to extract the genome of the overnight yeast culture and use it as a template for PCR verification. The PCR method and procedure are shown in Tables 3 and 4. For the transformants on the plate, pick a spot to break the cell, and select two primers on the genome (see Table 10 for details) to use PCR to verify whether the target gene has been integrated into the genome. If the band size is correct and the sequencing results are correct, it means that the genome integration is successful.
[0216] in
[0217] Table 9 Primers used for genomic integration of heterologous genes
[0218]
[0219]
[0220] Table 10 Primers used for genome verification of heterologous genes
[0221]
[0222] Example 3
[0223] The engineered Saccharomyces cerevisiae strain that synthesizes salidroside from scratch was fermented in shake flasks. SAD1, SAD2, SAD3, SDA4, and SAD5 were all cultured under the same conditions. First, a single colony was streaked on a YPD plate, and then inoculated into 50 mL of YPD liquid medium. At 30°C and 250 rpm, SAD1, SAD2, SAD3, SDA4, and SAD5 were cultured until the bacterial OD 600 Reach about 6, then use the initial OD 600 =0.4 was transferred to 20 mL YPD liquid medium (glucose concentration was 2%). 600 When the pH reaches about 12, the concentration of added galactose needs to be stabilized at 2g / L, and the entire fermentation cycle is maintained at about 120h.
[0224] Table 11 The yield of salidroside produced by each strain in shake flasks
[0225]
[0226] 1 mL of fermentation supernatant was filtered through a 0.22 μm organic filter. A 10 μL sample was then separated using a Shimadzu LC-20A HyPURITY™ C18 HPLC column (250 mm × 4.6 mm, 3 μm, Ultimate LP-C18). Mobile phase A consisted of 0.1% formic acid in water, and mobile phase B consisted of 0.1% acetonitrile. Intermediates and products were separated using an isocratic elution system consisting of 8% mobile phase B and 92% mobile phase A. Salidroside was detected using a UV detector at a wavelength of 224 nm.
[0227] The results are as follows Figure 1 and Figure 2 As shown in the figure, the production of salidroside by fermentation of SAD3 strain with SDA4 and SAD5 strains shows that the heterologous expression of TYDC in the strains Y350F The yield of salidroside can reach 803.1 mg / L compared with the heterologous expression of AtTYDC from Arabidopsis and SDA4 of RvU8G3 and TYDC from poppy and SAD5 of RvU8G3, which greatly improved the yield of salidroside.
[0228] Although the present invention has been disclosed above with reference to the embodiments, they are not intended to limit the present invention. Anyone with ordinary knowledge in the art may make slight changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention shall be determined by the scope of the patent application attached hereto.
[0229] Sequence Listing
[0230]
[0231]
[0232]
[0233]
[0234]
[0235]
[0236]
[0237]
Claims
1. Application of glucosyltransferase U8GT3 and tyrosine decarboxylase mutants in increasing the yield of salidroside synthesis in Saccharomyces cerevisiae; The yeast Saccharomyces cerevisiae heterologously expresses a gene encoding phenylpyruvate decarboxylase ARO10 and a gene encoding benzoate dehydrogenase TYR1; The amino acid sequence of the glucosyltransferase U8GT3 is shown in SEQ ID NO.10; The amino acid sequence of the tyrosine decarboxylase mutant is shown in SEQ ID NO.7; The amino acid sequence of the phenylpyruvate decarboxylase ARO10 is shown in SEQ ID NO.11; The amino acid sequence of the benzoate dehydrogenase TYR1 is shown in SEQ ID NO.
12.
2. The use according to claim 1, characterized in that The nucleic acid sequence of the tyrosine decarboxylase mutant is shown in SEQ ID NO.1; The nucleic acid molecule sequence of the glucosyltransferase U8GT3 is shown in SEQ ID NO.
4.
3. A strain for producing salidroside, characterized in that: The method comprises heterologously expressing the following genes a) to b) in Saccharomyces cerevisiae; a) a gene encoding glucosyltransferase U8GT3; b) a gene encoding a tyrosine decarboxylase mutant; The amino acid sequence of the glucosyltransferase U8GT3 is shown in SEQ ID NO.10; The amino acid sequence of the tyrosine decarboxylase mutant is shown in SEQ ID NO.7; The yeast Saccharomyces cerevisiae heterologously expresses a gene encoding phenylpyruvate decarboxylase ARO10 and a gene encoding benzoate dehydrogenase TYR1; The amino acid sequence of the phenylpyruvate decarboxylase ARO10 is shown in SEQ ID NO.11; The amino acid sequence of the benzoate dehydrogenase TYR1 is shown in SEQ ID NO.
12.
4. The strain according to claim 3, characterized in that The nucleic acid sequence of the tyrosine decarboxylase mutant is shown in SEQ ID NO.1; The nucleic acid molecule sequence of the glucosyltransferase U8GT3 is shown in SEQ ID NO.
4.
5. The strain according to claim 3, characterized in that The nucleic acid sequence of the phenylpyruvate decarboxylase ARO10 is shown in SEQ ID NO.5; The nucleic acid molecule sequence of the benzoate dehydrogenase TYR1 is shown in SEQ ID NO.
6.
6. A whole-cell catalyst, characterized in that Contains the strain according to any one of claims 3 to 5.
7. A method for producing salidroside and / or tyrosol, characterized in that: Salidroside and / or tyrosol are produced by fermentation using the strain according to any one of claims 3 to 5 or the whole-cell catalyst according to claim 6.
8. The method according to claim 7, characterized in that It includes: The fermentation culture was continued until OD 600 When the temperature is between 8 and 15, add galactose.
9. The method according to claim 8, characterized in that The concentration of the galactose is 1-4 g / L.
10. The method according to claim 8, characterized in that The fermentation time is 90-120 hours.
11. A method for producing salidroside using Saccharomyces cerevisiae, characterized in that: The steps include: Synthesizing tyrosol using a carbon source; and Synthesis of salidroside using tyrosol; Among them, in the step of synthesizing tyrosol using a carbon source, benzoate dehydrogenase and phenylpyruvate decarboxylase are used to synthesize tyrosol. and using glucosyltransferase to synthesize salidroside in the step of synthesizing salidroside from tyrosol; The amino acid sequence of the glucosyltransferase U8GT3 is shown in SEQ ID NO.10; the amino acid sequence of the phenylpyruvate decarboxylase ARO10 is shown in SEQ ID NO.11; The amino acid sequence of the benzoate dehydrogenase TYR1 is shown in SEQ ID NO.
12.
12. The method according to claim 11, characterized in that The nucleic acid molecule sequence of the glucosyltransferase is shown in SEQ ID NO.
4.
13. The method according to claim 11, characterized in that The method further comprises using a tyrosine decarboxylase mutant to synthesize tyrosol in the step of synthesizing tyrosol using a carbon source, wherein the amino acid sequence of the tyrosine decarboxylase mutant is shown in SEQ ID NO.7.
Citation Information
Patent Citations
Enzyme, genetically engineered bacterium and method for catalytically producing ergothioneine by using genetically engineered bacterium
CN115851655A
Enzyme, strain for producing salidroside, and production method
WO2024140379A1