Use of an aberrant leucine-rich repeat receptor-like kinase gene in cotton
By regulating the abnormal cotton leucine-rich repeat receptor kinase gene GoanoHBD1, the problem of interspecific reproductive isolation in cotton breeding was solved, the resistance of cotton to Verticillium wilt and Fusarium wilt was improved, and a new breeding method was provided.
Patent Information
- Application Number
- CN202310065320.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-16
- Publication Date
- 2026-02-13
- Estimated Expiration
- 2043-01-16
AI Technical Summary
Existing technologies are insufficient to effectively utilize wild resources to break down interspecific reproductive barriers in cotton breeding, leading to hybrid mortality or hybrid degeneration and affecting breeding outcomes.
By expressing the abnormal cotton leucine-rich repeat receptor kinase gene GoanoHBD1, the lethal phenotype of cotton was regulated, and plants resistant to Verticillium wilt and Fusarium wilt were obtained by silencing this gene. The gene was then introduced into cotton using transgenic technology.
This study enhanced cotton's resistance to Verticillium wilt and Fusarium wilt, providing a new breeding approach and elucidating the molecular mechanism of cotton's disease resistance.
Smart Images

Figure CN116083457B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of biotechnology, and particularly relates to application of abnormal cotton leucine-rich repeat receptor-like kinase gene. BACKGROUND
[0002] As early as the 20th century, people realized that wild resources could compensate for the loss of excellent alleles in modern breeding, but inter-specific reproductive isolation limited the use of wild resources in breeding. Hybrid lethality or hybrid weakness and hybrid breakdown are two main types of post-fertilization reproductive isolation. Hybrid lethality or hybrid weakness occurs in F1 generation, showing plant death, sterility, dwarfism and reduced viability, etc. Some inter-specific crosses can produce normal hybrid F1, but the plants of F2 generation often show weakness or lethality, which is called hybrid breakdown. Clarifying the mechanism behind reproductive isolation can break the reproductive barrier in traditional crop breeding and promote the exchange of inter-specific genomes, which will help to promote the application of excellent traits of wild species in modern breeding.
[0003] The genetic pattern of hybrid lethality is consistent with the Bateson-Dobzhansky-Muller inter-specific hybrid incompatibility model. Hybrid lethality includes two types, hybrid sterility and hybrid breakdown. Hybrid sterility phenotype occurs in F1 generation, which is controlled by one or two pairs of dominant genes; while hybrid breakdown is shown in F2 generation, which is controlled by one or two pairs of recessive genes. Existing studies have focused on hybrid sterility (Zuellig et al., 2018; Jia et al., 2021; Li et al., 2021; Si et al., 2021a; Tezuka et al., 2021; Zhang et al., 2022) and hybrid breakdown (Yamamoto et al., 2007; Jiang et al., 2008; et al., 2017; Yoneya et al., 2021) were mapped in different species, and some of them have been cloned. Alcazar et al. (2010) found that an allelic variation of a gene encoding a Strubbelig receptor family 3 (SRF3) determined the genetic incompatibility between Arabidopsis species. The epistatic interaction of DM1 (DANGEROUS MIX 1) and DM2d (Bomblies et al., 2007; Chae et al., 2014) and DM10 and DM11 (Barragan et al., 2021) encoding leucine-rich repeat (LRR)-NLR proteins in Arabidopsis caused F1 hybrid lethality. Chen et al. (2013) confirmed that two LRR-RLK genes at the Hwil (Hybrid weakness 1) locus and a secreted sublitisin-like protease encoded by Hwi2 determined the hybrid weakness between rice species. Deng et al. (2019) confirmed that the CC-NLR gene was the coding gene at the Le4 locus, which determined the hybrid lethality between Gossypium barbadense and Gossypium hirsutum. Si et al. (2021) found that the Ne2 gene encoding a CC-NLR protein in wheat induced hybrid lethality in wheat. The above studies showed that these pairs of deleterious epistatic interactions were usually members of the receptor kinase (RK) or NLR immune receptor family.
[0004] Hybridization combines genetic material from different genomes together. Genetic interactions in hybrids can result in beneficial phenotypes, known as heterosis. Conversely, such interactions can lead to deleterious phenotypes, such as hybrid lethality. This “genetic incompatibility” was first discovered in Phaseolus vulgaris, where seedlings exhibited symptoms similar to soybean mosaic virus infection (Burkholder et al., 1926). Kostoff et al. (1930) found that necrotic tobacco hybrid seedlings exhibited similar symptoms in response to pathogen, first suggesting that genetic incompatibility involved the plant immune system. With the rapid development of biochemistry and molecular biology, it was confirmed that hybrid lethality caused immune system disorder by activating autoimmunity without external pathogen infection (Li et al., 2021). Hybrid lethality is typically characterized by the process of PCD (Wan et al., 2021). The consequence of the activation of the immune system is to improve the plant’s resistance to exogenous pathogens. Bomblies et al. (2007) found that hybrid necrosis in Arabidopsis thaliana was similar to a hypersensitive response, with many defense-related genes being transcriptionally induced, and the lethal plants exhibited stronger resistance to downy mildew. Chen et al. (2014) found that rice plants with a heterotic disadvantage phenotype exhibited enhanced resistance to bacterial blight. Therefore, it is speculated that there may be functional correlation between hybrid lethal-related genes and disease resistance traits (xiao et al., 2021).
[0005] LRR-RLK receives extracellular signal through N-terminal extracellular domain and transmits information to C-terminal intracellular kinase domain through transmembrane region, causing phosphorylation or dephosphorylation of the C-terminal intracellular kinase domain, and turning on or off downstream target proteins (Lehti-shiu et al., 2012). The extracellular domain of LRR-RLK is characterized by containing tandemly arranged LRR domains, which are composed of 20-30 repeated amino acids. The tertiary structure of LRR forms a new alpha helix / beta fold, which is involved in protein-protein interaction, and this mechanism is the basis of cell molecular recognition. The diversity of extracellular LRR enables LRR-RLK to specifically recognize different ligand molecules, thereby correctly transmitting different extracellular signals. LRR-RLK members play a very important role in regulating plant disease resistance (Wang et al., 2018). LRR-RLK responds to various pathogen-derived molecules found in the extracellular space, and the plant's own immune system usually initiates a defense response through pattern-triggered immunity (PTI) to achieve basic resistance to pathogens. Due to the complexity of plant signal transduction pathways and the complementary functions between different proteins, there are few reports on the ligand molecules and complex signaling pathways of LRR-RLK interaction. Arabidopsis BAK1 (BRI1 associated receptor kinase 1) is a typical LRR-type receptor-like kinase. BAK1 recognizes the pattern recognition receptor on the cell membrane and triggers PTI through MAPK cascade in a phosphorylated manner (Wu et al., 2020). SUMMARY
[0006] The present application aims to provide an abnormal cotton leucine-rich repeat receptor-like kinase gene (GoanoHBD1) which can cause lethal phenotype of Gossypium hirsutum plants and confer resistance to Verticillium wilt and Fusarium wilt in cotton.
[0007] To achieve the above-mentioned purpose, the present application adopts the following technical solutions:
[0008] An abnormal cotton leucine-rich repeat receptor-like kinase gene (GoanoHBD1), the nucleotide sequence of the gene is shown as SEQ ID NO. 1. The abnormal cotton leucine-rich repeat receptor-like kinase gene (GoanoHBD1) is from Gossypium wild species abnormal cotton.
[0009] The protein encoded by the abnormal cotton leucine-rich repeat receptor-like kinase gene (GoanoHBD1) has an amino acid sequence shown as SEQ ID No. 2.
[0010] In the sequence, SEQ ID NO. 1 consists of 3885 bases, the 1st base from the 5' end is the transcription start site, and the 3885th base is the transcription termination site, the complete coding frame is 3885 bases, encoding 1294 amino acids, with a molecular weight of 323.48 KD and an isoelectric point of 4.58.
[0011] The method for obtaining the above abnormal cotton leucine-rich repeat receptor-like kinase gene (GoanoHBD1) sequence is as follows: extracting leaf tissue RNA of Gossypium wild species abnormal cotton, reverse transcribing to obtain cDNA as a template, using primers F: TCCGTTTATCAATCTGTTCC and R: ACATTACCACCAATCAAGCA, and amplifying to obtain the abnormal cotton leucine-rich repeat receptor-like kinase gene (GoanoHBD1) sequence.
[0012] The leucine-rich repeat receptor-like kinase gene (GoanoHBD1) involved in the present application is expressed under temperature induction. When the environmental temperature is greater than 26℃, the expression amount of GoanoHBD1 is significantly increased. The up-regulated expression of the gene can cause the single fragment introgression line CSSL11-9 of abnormal cotton to appear a lethal phenotype. The single fragment introgression line CSSL11-9 plant can survive normally after silencing the leucine-rich repeat receptor-like kinase gene (GoanoHBD1), and the CSSL11-9 plant with silenced GoanoHBD1 has a significantly reduced resistance to cotton Verticillium wilt and Fusarium wilt.
[0013] By using the characteristics of the above leucine-rich repeat receptor-like kinase gene, the lethal phenotype of the single fragment introgression line CSSL11-9 of abnormal cotton can be inhibited by silencing the abnormal cotton leucine-rich repeat receptor-like kinase gene GoanoHBD1.
[0014] The cotton plant sensitive to Verticillium wilt and Fusarium wilt is obtained by silencing the abnormal cotton leucine-rich repeat receptor-like kinase gene GoanoHBD1, and by means of reverse proof, it can be used to prove that the abnormal cotton leucine-rich repeat receptor-like kinase gene can improve the resistance of cotton to Verticillium wilt and Fusarium wilt. Therefore, the present application also protects the application of the abnormal cotton leucine-rich repeat receptor-like kinase gene GoanoHBD1 in imparting Verticillium wilt and Fusarium wilt resistance to cotton, which can be specifically operated by a transgenic method. More specifically, the recombinant expression vector can be introduced into the target plant. In the method, the recombinant expression vector can be transformed into plant cells or tissues by using a Ti plasmid, a Ri plasmid, a plant virus vector, direct DNA transformation, microinjection, electroporation, Agrobacterium-mediated transformation, and other conventional biological methods, and the transformed plant tissue is cultivated into a plant.
[0015] Therefore, the present application also protects a plant breeding method, which is as follows (1) or (2):
[0016] (1) By increasing the activity of GoanoHBD1 protein in the plant of interest, a plant with stronger resistance to Verticillium wilt and Fusarium wilt than the plant of interest is obtained;
[0017] (2) By promoting the expression of GoanoHBD1 gene in the plant of interest, a plant with stronger resistance to Verticillium wilt and Fusarium wilt than the plant of interest is obtained;
[0018] The nucleotide sequence of the gene is shown in SEQ ID NO. 1, and the amino acid sequence of the protein is shown in SEQ ID NO. 2; preferably, the plant of interest is cotton.
[0019] Wherein, the implementation mode of "promoting the expression of SlBBX31 gene in the plant of interest" can be (1) or (2) or (3) as follows:
[0020] (1) introducing SlBBX31 gene into the plant of interest;
[0021] (2) introducing a strong promoter and / or enhancer;
[0022] (3) other common methods in the art.
[0023] The polypeptide comprising the amino acid sequence or at least part of the sequence provided by the present application can still have biological activity or even new biological activity after removing or replacing some amino acids.
[0024] The protein encoded by the nucleotide sequence provided by the present application and the nucleotide sequence and protein that can be synthesized and functionally the same or similar to the leucine-rich repeat class receptor-like kinase gene (GoanoHBD1) are included.
[0025] The gene comprising the nucleotide sequence or at least part of the nucleotide sequence provided by the present application can be constructed into a recombinant plasmid by genetic recombination to obtain a new biosynthetic pathway, or by insertion, substitution, deletion or inactivation to obtain a new biosynthetic pathway.
[0026] The non-ribosomal peptide synthetase comprising the non-ribosomal peptide synthetase provided by the present application can produce new poly peptide compounds by deleting, inserting or inactivating one or more non-ribosomal peptide synthetase domains, modules or genes from the same or different non-ribosomal peptide synthetase system.
[0027] The fragment or gene comprising the nucleotide sequence or at least part of the nucleotide sequence provided by the present application can be used to construct a non-ribosomal peptide synthetase library or a non-ribosomal peptide synthetase derivative library or a combinatorial library.
[0028] The gene can also be used in genetic engineering, protein expression, enzyme catalysis, etc., and can be used to find and discover compounds or genes for medicine, industry or agriculture to expand the source range of the leucine-rich repeat receptor-like kinase gene (GoanoHBD1), which has a high application prospect.
[0029] In the present application, the plant suitable for the present application is not particularly limited, as long as it is suitable for gene transformation operation, such as various crops, ornamental plants, or forestry plants, etc. The plant can be, but is not limited to, dicotyledon, monocotyledon or gymnosperm.
[0030] As a preferred mode, the "plant" includes, but is not limited to, cotton, and any plant having the gene or a gene homologous thereto is suitable.
[0031] The "plant" in the present application includes whole plants, parent and progeny plants, and different parts of the plant, including seeds, fruits, buds, stems, leaves, roots (including tubers), flowers, tissues and organs, and the gene or nucleic acid of interest is present in these different parts. The "plant" mentioned herein also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen and microspores, and each of the foregoing objects also contains the gene / nucleic acid of interest.
[0032] The present application includes any plant cell, or any plant obtained or obtainable by the methods therein, and all plant parts and propagules thereof. The patent also includes transfected cells, tissues, organs or whole plants obtained by any of the foregoing methods. The only requirement is that the progeny exhibit the same genotypic or phenotypic characteristics, and the progeny characteristics obtained using the methods in the present patent are the same.
[0033] The present application also extends to harvestable parts of the plants as described above, but is not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. It further relates to other derivatives of the plant after harvesting, such as dried granules or powders, oils, fats and fatty acids, starches or proteins. The present application also relates to food or food additives obtained from the relevant plants.
[0034] The present application has the following advantages:
[0035] (1) The leucine-rich repeat receptor-like kinase gene (GoanoHBD1) obtained by the present application can cause the appearance of lethal phenotype in Gossypium hirsutum.
[0036] (2) The leucine-rich repeat receptor-like kinase gene (GoanoHBD1) obtained by the application is a brand-new gene capable of endowing plants with resistance to Verticillium wilt and Fusarium wilt, and the function of the gene in plants has not been reported. The leucine-rich repeat receptor-like kinase gene (GoanoHBD1) obtained by the application can further analyze the molecular mechanism of cotton resistance to Verticillium wilt and Fusarium wilt. Whether the leucine-rich repeat receptor-like kinase gene (GoanoHBD1) is involved in the signal pathway related to disease resistance, what are the upstream and downstream genes thereof, and what are the proteins interacting therewith, so that by further researching the gene, the understanding of the mechanism of cotton resistance to Verticillium wilt and Fusarium wilt can be theoretically extended.
[0037] (3) The plant resistant to Verticillium wilt and Fusarium wilt can be obtained by a transgenic method, specifically, the GoanoHBD1 gene can be introduced into a target plant to obtain a transgenic plant, and the plant has higher resistance to Verticillium wilt and Fusarium wilt than the target plant, thereby providing a new way for plant breeding against Verticillium wilt and Fusarium wilt. BRIEF DESCRIPTION OF DRAWINGS
[0038] Figure 1 It is shown that the leucine-rich repeat receptor-like kinase gene (GoanoHBD1) in the single segment introgression line CSSL11-9 of Gossypium anomalum is silenced by a virus-induced gene silencing (VIGS) method, and the single segment introgression line CSSL11-9 plant with the silenced leucine-rich repeat receptor-like kinase gene (GoanoHBD1) can survive normally. a: qRT-PCR detection of GoanoHBD1 gene expression in the VIGS silenced plant; b: phenotype of the GoanoHBD1 gene VIGS silenced plant.
[0039] Figure 2 It is shown that the expression of the leucine-rich repeat receptor-like kinase gene (GoanoHBD1) under induction of different temperatures.
[0040] Figure 3 It is shown that the leucine-rich repeat receptor-like kinase gene (GoanoHBD1) in the single segment introgression line CSSL11-9 of Gossypium anomalum is silenced by a virus-induced gene silencing (VIGS) method, and the single segment introgression line CSSL11-9 with the silenced leucine-rich repeat receptor-like kinase gene (GoanoHBD1) shows a significantly reduced resistance to Verticillium wilt. a: resistance analysis of positive control pTRV2∷GhCLA1, injection of empty vector negative control pTRV2∷00, injection of pTRV2∷GoanoHBD1, single segment introgression line and Su8289 seedlings to Verticillium dahliae; b: qRT-PCR detection of GoanoHBD1 gene expression in the VIGS silenced plant; c: disease index statistics of cotton seedlings inoculated with Verticillium dahliae for 28 days; standard deviation is calculated for 3 times of repetition, and **: P<0.01.
[0041] Figure 4 Figure 8 shows that silencing of the leucine-rich repeat receptor-like kinase gene (GoanoHBD1) in the single segment introgression line CSSL11-9 by VIGS significantly reduced the resistance of the single segment introgression line CSSL11-9 to Fusarium wilt. a: analysis of the resistance of the single segment introgression line CSSL11-9, the variety 8289, the negative control pTRV2::00 injected seedlings and the pTRV2::GoanoHBD1 injected seedlings to Fusarium oxysporum; b: qRT-PCR detection of the expression of the GoanoHBD1 gene in the VIGS silenced plants; c: statistical analysis of the disease index of the cotton seedlings after inoculation with Fusarium oxysporum; the standard deviation was calculated based on 3 repetitions, and **: P<0.01. DETAILED DESCRIPTION
[0042] The present application will be described in detail below with specific examples. These examples are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.
[0043] As mentioned throughout the specification and claims, "comprising" or "including" is an open term, and should be interpreted to cover a non-exclusive inclusion. The description that follows is intended to be a description of the preferred embodiments of the present application, and is not intended to limit the scope of the present application. The scope of the present application is defined by the appended claims.
[0044] 1. Test materials
[0045] The upland cotton variety 8289 and the Gossypium anomalum used in the experiment were introduced by the Jiangsu Academy of Agricultural Sciences. The single segment introgression line CSSL11-9 of Gossypium anomalum described in the present application is disclosed in the invention patent with the publication number CN 111763757 A and the title "Chromosomal segment of Gossypium anomalum causing death of Gossypium hirsutum and molecular markers and applications thereof".
[0046] 2. Test method
[0047] 2.1 Obtaining of the leucine-rich repeat receptor-like kinase gene (GoanoHBD1)
[0048] The 230 pairs of SSR primers evenly covering the abnormal cotton genome developed by the research group were used for detection, and the whole genome foreground and background of the single segment introgression line CSSL11-9 were identified. Among them, the amplification products of only 6 pairs of SSR molecular marker primers were different between the single segment introgression line CSSL11-9 and the recurrent parent Su 8289. The polymorphic markers NAU5192, A11_175, JAAS3191, A11_243, JAAS3310, A11_193 (the primer is disclosed in the invention patent with the publication number CN 111763757A and the invention name "Abnormal cotton chromosome fragment capable of causing death of gossypium hirsutum and molecular markers and application thereof") were screened. Nanjing Qikexue Biotechnology Co., Ltd. completed the synthesis of all primers.
[0049] An F2 population containing 2337 single plants was constructed with Su 8289 as the female parent and CSSL11-9 as the male parent, and the abnormal cotton-derived SSR primers (Zhai et al., 2015) were further selected to encrypt the A11-9 interval of the abnormal cotton chromosome fragment, and finally the key gene derived from the abnormal cotton lethal trait was fine-mapped between JAAS3191-JAAS3050, covering 63.87 kb of the gossypium hirsutum genome, and there were 8 functional coding genes (Table 1).
[0050] Table 1 8 functional coding genes in the candidate interval and annotations
[0051]
[0052] To determine the key gene from the abnormal cotton lethal trait, we used the method of virus-induced gene silencing (VIGS) to silence the eight candidate genes in the candidate interval, respectively. The vectors used in VIGS were pTRV1 and pTRV2, and the cotton whitening gene (GhCLA1) was used as a control. The primers for designing VIGS vectors for the eight candidate genes were designed, and the amplified fragments were cloned and sequenced to verify the correctness before being connected to the TRV2 gene silencing vector in the TRV system. Single colonies of pTRV1, pTRV2 (negative control), and pTRV2∷GhCLA1 (positive control) and pTRV2 plasmid containing candidate genes were picked from Agrobacterium GV3101, and cultured to an OD600 of about 0.5. The bacterial cells were collected by centrifugation at 4,000 rpm for 10 minutes at room temperature, resuspended in an appropriate volume of resuspension solution (10 mM MgCl2, 10 mM MES, and 200 μM acetosyringone) to a final concentration of 2.0, and the resuspension solution was placed at room temperature for 3 h. The recovery solutions of TRV1 and TRV2 were mixed in a volume ratio of 1:1. After the two cotyledons of the cotton seedlings were fully expanded, the Agrobacterium inoculation experiment was performed. The leaf needle cylinder immersion method was used to inject Agrobacterium containing pTRV1 and pTRV2∷Goano_ORF (1:1) into normal growing Su8289 and CSSL11-9 plants at the one-leaf stage. The inoculated cotton seedlings were cultured at an environmental temperature of 23°C under a 16h / 8h light / dark cycle. pTRV2∷00 and pTRV2∷GhCLA1 silencing treatments were used as negative and positive controls, respectively. Two weeks later, the newly grown leaves of the pTRV2∷GhCLA1 injected plants were completely white. RNA was extracted from the leaves of the plants inoculated with the target gene, and qRT-PCR was used to detect whether the target gene was still expressed Figure 1 a). The expression levels of all gene-silenced plants were significantly lower than those of the empty vector control, indicating that the gene was effectively silenced by VIGS. The culture temperature was changed to 27°C, and the light cycle remained unchanged. After one week, it was found that CSSL11-9, pTRV2∷00 silenced treatment, pTRV2∷Goano_ORF1, pTRV2∷Goano_ORF2, pTRV2∷Goano_ORF4, pTRV2∷Goano_ORF5, pTRV2∷Goano_ORF6, pTRV2∷Goano_ORF7, and pTRV2∷Goano_ORF8 silenced CSSL11-9 plants all began to show lethal phenotypes, while only the plants in which Goano_ORF3 was silenced in CSSL11-9 plants survived normally Figure 1b), and preliminarily determined that Goano_ORF3 is a key gene derived from the abnormal cotton lethal trait. We named the Goano_ORF3 gene as GoanoHBD1 (Hybrid breakdown).
[0053] 2.2 Expression analysis of leucine-rich repeat receptor-like kinase gene (GoanoHBD1)
[0054] We planted single segment introgression line CSSL11-9 plants in a 23℃ constant temperature incubator, and when the plants grew to the two-leaf stage, they were transferred to 30℃, 26℃ and 23℃ constant temperature incubators, respectively. The sampling time was 0h, 24h, 72h and 120h, and the top leaves of the plants CSSL11-9 were taken. We analyzed the expression of GoanoHBD1 under the induction of different temperatures. 1 μg of total RNA was taken, and the operation was carried out according to the TAKARA reverse transcription kit instructions. First-strand cDNA was synthesized. After diluting the reverse transcription product 10 times, 1 μL was taken for qRT-PCR. The cotton actin gene (GenBank: AY305723.1) was used as an internal reference, and its primer sequence was F: ATCCTCCGTCTTGACCTTG, R: TGTCCGTCAGGCAACTCAT. Real-time fluorescence quantitative PCR was operated using ABI QuantStudio5 type fluorescence quantitative PCR instrument (ABI, USA), and the method was TB Green I dye method. The reaction system was 20 μl, cDNA, 1 μl; Primer F (10 μM), 1 μl; Primer R (10 μM), 1 μl; TB green Imix, 10 μl, and water to 20 μl. The program was: 95℃, 10min; 95℃, 10s, annealing: 58℃, 20s; 72℃, 30s; 40 cycles; 72℃, 10min, and finally running the dissolution program. The relative expression amount of the target gene = 2- ΔΔΔCT 目的基因 内参基因 指定时间的处理 目的基因 内参基因 0h V.D 目的基因 内参基因 指定时间的处理 目的基因 内参基因 0h CK The primers used for detecting the expression of GoanoHBD1 gene were F: GTACGATCTTGAGATTGATT, R: TATGGCGGTAAATGTTTC.
[0055] The results showed that in the single-fragment infiltration line CSSL11-9, GoanoHBD1 expression was induced by temperature, and the expression level of GoanoHBD1 increased significantly when the ambient temperature was greater than or equal to 26℃. The expression level gradually increased with the extension of induction time, reaching its highest level when the lethal phenotype began to appear in the terminal leaves. Figure 2 ).
[0056] 2.3 Sequence analysis of the leucine-rich repeat receptor kinase gene (GoanoHBD1)
[0057] Based on the genomic sequence of the GoanoHBD1 gene, specific primers were designed to extract RNA from abnormal cotton leaves. Using cDNA obtained through reverse transcription as a template, the open reading frame (ORF) of the GoanoHBD1 gene in the abnormal cotton was amplified. The results showed that the ORF of the GoanoHBD1 gene was 3885 bp (SEQ ID NO.1), encoding 1294 amino acids (SEQ ID NO.2), with a molecular weight of 323.48 kDa and an isoelectric point of 4.58.
[0058] 2.4 Analysis of Verticillium Wilt Resistance Based on Leucine-Rich Repeat Receptor Kinase Gene (GoanoHBD1)
[0059] The Verticillium dauricum pathogen used in this invention is V991, which can be introduced from research institutions and cultured using the following method: At 25°C, Verticillium dauricum V991 is spread onto the surface of a solid potato culture medium (200g potato, 17g agar, 20g sucrose, 1000ml distilled water). After two weeks, it is transferred to a liquid potato culture medium (200g potato, 20g sucrose, 1000ml distilled water) and cultured at room temperature with shaking for 5 days. The cultured pathogen solution is filtered, and the spore concentration is measured using a hemocytometer. The concentration is then diluted to 5 × 10⁻⁶. 7 1 spore / ml. The inoculation method is as follows: After delinting the test seeds with concentrated sulfuric acid and drying them, sow 3 seeds per 460ml paper cup. After emergence, thin out the seedlings, leaving 1 plant per cup. When the cotton plant has grown to two leaves and a central bud, tear off the bottom of the paper cup to damage the roots. Inoculate each material separately with a suspension of conidia of Verticillium wilt at a concentration of 5 × 10⁻⁶. 7 1 spore / ml, 30ml per nutrient pot.
[0060] The disease severity level survey of Verticillium wilt in this invention was conducted according to the following standards: Level 0: Healthy plants with no diseased leaves and normal growth; Level 1: Less than one-quarter of the plant's leaves are diseased, turning yellow and wilting; Level 2: More than one-quarter but less than one-half of the plant's leaves are diseased, turning yellow and wilting; Level 3: More than one-half but less than three-quarters of the plant's leaves are diseased, turning yellow and wilting; Level 4: More than three-quarters of the plant's leaves are diseased, or the plant dies. The disease severity index (DI) for each strain was calculated based on the survey results. DI = [∑(Ni×i) / (N×4)]×100; i = 0~4, Ni = number of plants at each level.
[0061] In this invention, we used the following method to analyze the resistance of the GoanoHBD1 gene to cotton Verticillium wilt.
[0062] Using a virus-mediated gene silencing method, we verified the resistance of cotton to Verticillium wilt after GoanoHBD1 gene silencing. Figure 3 a). The method for virus-mediated gene silencing is the same as in 2.1. When cotton seedlings injected with TRV2::GhCLA1 showed an albino phenotype, the expression of the silenced GoanoHBD1 gene in the cotton plants was detected. Figure 3 (b) The cotton actin gene (GenBank: AY305723.1) was used as an internal control. Simultaneously, the cotton seedlings were inoculated with Verticillium wilt, and then cultured at 25℃ under a 12h / 12h light / dark cycle. The disease resistance of the silenced cotton seedlings was investigated.
[0063] The results showed that 28 days after inoculation with Verticillium wilt, the disease index of CSSL11-9 plants with silenced GoanoHBD1 gene was 65.35%, significantly higher than that of uninoculated CSSL11-9 plants (CK, 28.13%) and the control group of CSSL11-9 plants injected with empty vector (pTRV2:00, 29.03%). Figure 3 c) It is evident that the GoanoHBD1 gene plays an important role in regulating cotton Verticillium wilt resistance.
[0064] 2.5 Analysis of Fusarium Wilt Resistance by the Leucine-Rich Repeat Receptor Kinase Gene (GoanoHBD1)
[0065] The Fusarium wilt strain used in this invention is strain No. 7. Fusarium wilt strain No. 7 was aspirated onto the surface of a solid potato culture medium (200g potato, 17g agar, 20g sucrose, 1000ml distilled water), resulting in a bacterial patch of approximately 0.5cm. The culture was then dried, sealed, and placed in a light-protected incubator at 25℃. After 5 days, the Fusarium wilt bacterial block was transferred to a liquid potato culture medium (200g potato, 20g sucrose, 1000ml distilled water) and cultured for 7 days. The bacterial suspension was filtered through gauze, and the spore concentration of the Fusarium wilt strain was counted under a microscope using a hemocytometer. The concentration was then diluted to 5 × 10⁻⁶.7 The inoculation method is as follows: the cotton wilt fungus is cultured in liquid potato medium, and after 7 days, the fungus liquid is filtered with gauze; the Tophine substrate is knocked and crushed to reach the standard that the substrate is not in a lump and the particle size is uniform; the cotton wilt fungus liquid with a concentration of 5x10 7 The inoculated substrate is loaded into a 50-hole tray, and multiple loaded substrates are stacked together to form a sowing hole in each hole of the tray. After the seed is treated with concentrated sulfuric acid and dried, 3 seeds are sown in each hole, covered with soil, watered, and covered with film. The environment temperature is 25℃, and the light / dark cycle is 12h / 12h. After germination, the film is removed in time, and the seedlings are thinned to retain one plant in each hole.
[0066] The cotton wilt disease progression investigation in the present application is performed according to the following standards: 0 level, healthy cotton plants with normal growth and no diseased leaves; 1 level, less than one fourth of the leaves of the cotton plants showing disease symptoms; 2 level, more than one fourth and less than one half of the leaves of the cotton plants showing disease symptoms; 3 level, more than one half of the leaves of the cotton plants showing disease symptoms without death; and 4 level, death of the cotton plants. According to the disease level of a single plant, the disease resistance index and mortality of different varieties are calculated to evaluate the resistance level of the cotton to the wilt disease. Disease resistance index (DI) = [∑(Ni×i) / (N×4)]x100; i=0-4, Ni=number of plants at each level. Mortality = (number of dead plants) x 100% / (total number of plants surveyed).
[0067] In the present application, the following method is used to analyze the resistance of GoanoHBD1 gene to cotton wilt disease.
[0068] The virus-mediated gene silencing method is used to verify the resistance of cotton to the wilt disease after the GoanoHBD1 gene is silenced Figure 4 a) The virus-mediated gene silencing method is the same as that in 2.1. When the cotton seedlings injected with TRV2∷GhCLA1 show a white phenotype, the expression of the GoanoHBD1 gene in the cotton is detected Figure 4 b) with the cotton actin gene (GenBank: AY305723.1) as the internal reference.
[0069] The results show that the disease index of the CSSL11-9 plants after the GoanoHBD1 gene is silenced is 51.67%, which is significantly higher than that of the plants without injection (CK, 18.58%) and the plants injected with the empty vector (pTRV2∷00, 18.83%) Figure 4 c) The GoanoHBD1 gene plays an important function in regulating the resistance of cotton to the wilt disease.
[0070] Although the present application has been described in detail with general description and specific embodiments above, it is obvious to those skilled in the art that some modifications or improvements can be made on the basis of the present application. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of protection claimed by the present application.
Claims
1. Silencing of the aberrant cotton leucine-rich repeat receptor-like kinase gene Goano HBD1 Use in inhibiting the appearance of a lethal phenotype in the aberrant cotton single segment introgression line CSSL11-9, characterized in that, The nucleotide sequence of the gene Goano HBD1 is shown in SEQ ID NO. 1.
Citation Information
Patent Citations
Abnormal cotton chromosome segment capable of causing lethality of upland cotton and molecular marker and application thereof
CN111763757A
Verticillium wilt resistance-related receptor-like protein kinase GhPR5K, and encoding gene and application thereof
CN108103042A
Island cotton cytochrome P450 gene and encoding protein and application thereof
CN108588041A