A method for cultivating high-lysine, high-quality protein corn

By introducing RNAi to interfere with the expression of α-glucosinolate and express the γ-glucosinolate fusion gene into the maize genome, the problem of maize kernels being fragile and easily perishable was solved, and maize with high lysine content and good quality was cultivated.

CN116083477BActive Publication Date: 2025-11-14ZHEJIANG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310039247.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-13
Publication Date
2025-11-14
Estimated Expiration
2043-01-13

AI Technical Summary

Technical Problem

Existing technologies, in the process of inhibiting the expression of α-glucosinolate in corn kernels to increase lysine content, often result in the corn kernels failing to form a normal cuticle, leading to brittle and easily perishable kernels and affecting corn quality.

Method used

By introducing an RNAi interference expression cassette into the maize genome to suppress α-glucosinolate expression while expressing a γ-glucosinolate fusion gene rich in lysine residues, maize cuticle formation is promoted, resulting in high-lysine and high-quality maize.

Benefits of technology

It significantly increased the lysine content in corn kernels (up to 0.41%) while maintaining the integrity and corrosion resistance of the corn kernels, thus reducing feed production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004050480270000081
    Figure BDA0004050480270000081
  • Figure HDA0004050480280000011
    Figure HDA0004050480280000011
  • Figure HDA0004050480280000012
    Figure HDA0004050480280000012
Patent Text Reader

Abstract

This invention discloses a method for cultivating high-lysine, high-quality protein maize. The method involves transferring an RNAi interference expression cassette that inhibits α-glucosinolate expression and a high-lysine fusion gene expression cassette into the maize genome to cultivate high-lysine, high-quality protein maize. The high-lysine fusion gene expression cassette includes a lysine-rich γ-glucosinolate fusion gene, the nucleotide sequence of which is shown in SEQ ID NO. 7. This invention, while inhibiting α-glucosinolate expression in maize, also specifically expresses a lysine-rich γ-glucosinolate fusion gene. The increased expression of γ-glucosinolate promotes the formation of the maize cuticle, resulting in high-quality, flint maize.
Need to check novelty before this filing date? Find Prior Art

Description

(I) Technical Field

[0001] This invention belongs to the field of plant molecular biology, particularly the field of transgenic crop breeding. This invention relates to a method for breeding high-lysine, high-quality protein corn using biotechnology. (II) Background Technology

[0002] Corn (Zea mays) is one of the most widely cultivated and highest-yielding crops in the world, serving as a major food source and feed ingredient in many regions. Corn seeds contain approximately 10% total protein, primarily in the form of storage proteins. These storage proteins are classified into four main categories: water-soluble albumins, globulins soluble in saline solutions, prolamins soluble in certain concentrations of ethanol, and gluten soluble in dilute alkaline solutions. Prolamins account for about 70% of the total storage protein, with α-prolamins being the most abundant, comprising over 60% of the total. Lysine is often referred to as the "first limiting amino acid," and corn prolamins lack both lysine and tryptophan, resulting in poor protein nutritional value. Using corn as the sole protein source can often lead to pellagra due to lysine deficiency. Therefore, when corn is used as feed, soybean meal or lysine is generally added to supplement protein and improve protein absorption and utilization efficiency. Typically, 150-300 kg of soybean meal and 500-3000 g of lysine are needed per ton of feed. Different feeds have varying requirements for protein and lysine addition; corn with high lysine content can reduce the amount of soybean meal and lysine added. Soybean meal is derived from the residue after soybean oil extraction and is mainly imported. Its price has been rising in recent years, making the reduction and substitution of soybean meal one of the main research areas in feed. Lysine is generally produced through microbial fermentation, which has a relatively high production cost. Studies show that improving the composition ratio of corn storage protein and reducing the content of corn gliadin can effectively increase lysine content, thereby reducing soybean meal usage, effectively improving the absorption and utilization efficiency of corn storage protein, and reducing feed production costs.

[0003] Current research shows that the maize transcription factor Opaque2 plays a crucial role in regulating the expression of maize gliadin. Opaque2-deficient maize exhibits reduced gliadin expression and significantly increased lysine and tryptophan expression, resulting in better nutritional value. Therefore, Opaque2-deficient maize is being used as a germplasm resource for breeding high-quality protein maize varieties. Inhibiting the expression of α-gliadin in maize kernels through RNAi or gene editing can also effectively increase lysine content in kernels to obtain high-quality protein maize. However, gliadin plays a key role in the formation of maize protein bodies and cuticles. Maize with low α-gliadin expression often results in kernels becoming mealy, making the kernels susceptible to kernel rot during cultivation, affecting maize quality, and causing kernel breakage during machine harvesting and threshing. While simply inhibiting the expression of maize kernel gliadin can yield high-lysine, high-quality protein maize, it affects the normal formation of the cuticle in maize kernels. This issue limits the application of Opaque2-deficient maize and RNAi-inhibited gliadin maize. (III) Summary of the Invention

[0004] The purpose of this invention is to provide a method for cultivating high-lysine, high-quality protein corn. This method utilizes biotechnology to inhibit the expression of α-glucosinolate in corn kernels while simultaneously expressing a γ-glucosinolate fusion gene that incorporates high-lysine residues. This results in high-lysine, high-quality protein durum corn that can form the corn cuticle. When used as feed, this method can reduce the amount of protein and lysine added, thereby lowering feed costs.

[0005] The technical solution adopted in this invention is:

[0006] This invention provides a method for cultivating high-lysine, high-quality protein maize. The method involves transferring an RNAi interference expression cassette that inhibits α-glucosinolate expression and a high-lysine fusion gene expression cassette into the maize genome to cultivate high-quality protein maize. The RNAi interference expression cassette includes an RNAi interference sequence targeting the α-glucosinolate encoding gene shown in SEQ ID NO.1 or SEQ ID NO.2. The high-lysine fusion gene expression cassette includes a lysine-rich γ-glucosinolate fusion gene, the nucleotide sequence of which is shown in SEQ ID NO.7.

[0007] Preferably, the RNAi interference expression cassette includes an RNAi interference sequence, a seed-specific promoter, and a terminator; the seed-specific promoter is the maize 22kD α-prolyzin promoter, and its nucleotide sequence is shown in SEQ ID NO.4; the terminator nucleotide sequence is shown in SEQ ID NO.5.

[0008] Preferably, the nucleotide sequence of the RNAi interference sequence is shown in SEQ ID NO.3.

[0009] Preferably, the high-lysine fusion gene expression cassette includes a γ-prolyzin fusion gene rich in lysine residues, a promoter, and a terminator; the promoter nucleotide sequence is SEQ ID NO.9, and the terminator nucleotide sequence is SEQ ID NO.10.

[0010] Preferably, the method further includes transferring a glyphosate-resistant expression cassette into the maize genome for screening positive transformants, wherein the nucleotide sequence of the glyphosate-resistant expression cassette is shown in SEQ ID NO.8.

[0011] Compared with existing methods, the beneficial effects of this invention are mainly reflected in the following: Existing methods for cultivating high-lysine, high-quality protein corn primarily utilize Opaque2-deficient corn or RNA interference to suppress α-glucosinolate expression. α-glucosinolate plays a crucial role in the formation of corn bryosomes and cuticle. Simply reducing α-glucosinolate expression can increase lysine and tryptophan content, but the resulting corn often becomes powdery because the kernels cannot form a normal cuticle. Powdery corn is prone to kernel rot during cultivation and easily breaks during threshing, affecting corn quality. This invention, while inhibiting α-glucosinolate expression in corn, also specifically expresses a γ-glucosinolate fusion gene rich in lysine residues. The increased expression of γ-glucosinolate promotes the formation of the corn cuticle, resulting in high-quality, hard-kernel corn with a normal cuticle and a lysine content of 0.41%. (iv) Description of the attached drawings

[0012] Figure 1 CP4-RNAi map of the transformation vector.

[0013] Figure 2 Map of the transformation vector CP4-RNAi-Gam.

[0014] Figure 3 1. Gel electrophoresis images of positive transformants; +: vector control; -: conventional maize; 1-4: four RK transformants; 5-8: four HRK transformants.

[0015] Figure 4 Seed protein and seed comparison (CK: conventional seed protein electrophoresis and seed cross-section, normal seed keratinization; RK7: RK transformant contains only RNAi fragment, seed gliadin electrophoresis and seed cross-section, seed cannot keratinize normally; HRK16: HRK transformant contains γ-gliadin fusion protein, seed gliadin electrophoresis and seed cross-section, seed is normally keratinized). (V) Detailed Implementation

[0016] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0017] Example 1: Obtaining a maize transformation plasmid vector

[0018] The plasmid vector used for maize transformation in this invention uses pCambia1300 (GenBank: AF234296.1) as the plant transformation vector framework. A complete glyphosate resistance expression cassette (SEQ ID NO.8) and an RNAi interference expression cassette are added to its multiple cloning site region to obtain the expression vector CP4-RNAi, which inhibits α-prolysin (vector map shown below). Figure 1 (As shown). Then, the γ-prolactin fusion gene expression cassette was added to the transformation vector CP4-RNAi to obtain the expression vector CP4-RNAi-Gam (vector map shown). Figure 2 As shown in the figure, T-DNA contains a complete glyphosate resistance expression cassette, an RNAi interference expression cassette, and a γ-prolyzin fusion gene expression cassette.

[0019] Glyphosate resistance expression cassette (nucleotide sequence as shown in SEQ ID NO.8): glyphosate resistance gene CP4 EPSPS, CaMV35S promoter, CaMV35S gene terminator; the promoter is the 35S promoter of CaMV, and the terminator is the 35S gene terminator of CaMV.

[0020] RNAi expression cassettes: RNAi interference sequence (nucleotide sequence as shown in SEQ ID NO.3), maize 22kDa α-gliadin promoter (nucleotide sequence as shown in SEQ ID NO.4), and maize PEPC terminator (nucleotide sequence as shown in SEQ ID NO.5). α-gliadins are 22kDa and 19kDa gliadins; by comparing the gene family sequences encoding 22kDa α-gliadin, highly homologous sequences were selected as RNA interference target sequences, nucleotide sequence shown in SEQ ID NO.1; by comparing the gene family sequences encoding 19kDa α-gliadin, highly homologous sequences were selected as RNA interference target sequences, nucleotide sequence shown in SEQ ID NO.2.

[0021] γ-glucosinolate fusion gene expression cassette: rice GT1 promoter (SEQ ID NO.9), γ-glucosinolate fusion gene (SEQ ID NO.7, encoding protein amino acid sequence as shown in SEQ ID NO.6) and its terminator (SEQ ID NO.10).

[0022] The expression vectors CP4-RNAi and CP4-RNAi-Gam were introduced into Agrobacterium LBA4404 by electroporation (2500V) to obtain Agrobacterium containing the transformation vectors.

[0023] SEQ ID NO.1

[0024] Gctacaacaagcgcttgcggcgagcgtcttacaacaaccaattgaccaattgcaacaacaatccttggcacatctaaccatacaaaccatcgcaacgcaacagcaacaacagttcctaccagcactgagccaactagctgtggtgaaccctatcgcctacttgcaatagcagatgcttgcatccaacccacttgctctgg

[0025] SEQ ID NO.2

[0026] Cctactaccatttagccagctagctgcagcaaaccgtgcttccttcttgacacagcaacagttgctgcctttctaccagcagtttgcggctaaccccg caaccctcttacaactacaacaattgttgccctttgtccaacttgctttgacagaccgagcggcctcctaccaacaacacatcattggtggtgccctc

[0027] SEQ ID NO.3

[0028] Ggatccgctacaacaagcgcttgcggcgagcgtcttacaacaaccaattgaccaattgcaacaacaatccttggcacatctaaccatacaaaccatcgcaacgcaacagcaacaacagttcctaccagcactgagccaactagctgtggtgaaccctatcgcctacttgcaatagcagatgcttgcatccaacccacttgctctggcctactaccatttagccagctagctgcagcaaaccgtgcttccttcttgacacagcaacagttgctgcctttctaccagcagtttgcggctaaccccgcaaccctcttacaactacaacaattgttgccctttgtccaacttgctttgacagaccgagcggcctcctaccaacaacacatcattggtggtgccctcgtacctgcgcagcgtcctcgtctcttcccggccgatcgctcaaaaaatactcatcaatcaggcgtgctagaaagcacaagtctggatttaattttgatgctgatacatatatgctgcgtgtctgcgtgcagtctagagagggcaccaccaatgatgtgttgttggtaggaggccgctcggtctgtcaaagcaagttggacaaagggcaacaattgttgtagttgtaagagggttgcggggttagccgcaaactgctggtagaaaggcagcaactgttgctgtgtcaagaaggaagcacggtttgctgcagctagctggctaaatggtagtaggccagagcaagtgggttggatgcaagcatctgctattgcaagtaggcgatagggttcaccacagctagttggctcagtgctggtaggaactgttgttgctgttgcgttgcgatggtttgtatggttagatgtgccaaggattgttgttgcaattggtcaattggttgttgtaagacgctcgccgcaagcgcttgttgtagc

[0029] SEQ ID NO.4

[0030]

[0031] SEQ ID NO.5

[0032] Gagctctagatctgttctgcacaaagtggagtagtcagtcatcgatcaggaaccagacaccagacttttattcatacagtgaagtgaagtgaagtgcagt gcagtgagttgctggtttttgtacaacttagtatgtatttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaaccaaaatccagg

[0033] SEQ ID NO.6

[0034] Mrvllvalallalaasatsthtsggcgcqppppvhlpppvhlpppvhlpppvhlpppvhlpppvhlpppvhvpppvhlppppchyptqpprpqphpqphpcpcqqphpspcqlqgtcgvgstpilgqcveflrhqcsptatpycspqcqslrqqccqqlrqvepqhryqaifglvlqsilqqqpqsgqvagllaaqiaqqltamcglqqptpcpyaaaggvphtktkktktkkktkkkkktkkktkkktktktrstktkktktkkktkkkkktkkktkkktktktrstktkktktkkktkkkkktkkktkkktktktrstktkktktkkktkkkkktkkktkkktktktrs

[0035] SEQ ID NO.7

[0036] Atgagggtgttgctcgttgccctcgctctcctggctctcgctgcgagcgccacctccacgcatacaagcggcggctgcggctgccagccaccgccgc

[0037] cggttcatctaccgccgccggtgcatctgccacctccggttcacctgccacctccggtgcatctcccaccgccggtccacctgccgccgccggtccac

[0038] ctgccaccgccggtccatgtgccgccgccggttcatctgccgccgccaccatgccactacctactcaaccgccccggcctcagcctcatccccagc

[0039] cacacccatgcccgtgccaacagccgcatccaagcccgtgccagctgcagggaacctgcggcgttggcagcaccccgatcctgggccagtgcgtc

[0040] gagttcctgaggcatcagtgcagcccgacggcgacgccctactgctcgcctcagtgccagtcgttgcggcagcagtgttgccagcagctcaggcag

[0041] gtggagccgcagcaccggtaccaggcgatcttcggcttggtcctccagtccatcctgcagcagcagccgcaaagcggccaggtcgcggggctgttg

[0042] gcggcgcagatagcgcagcaactgacggcgatgtgcggcctgcagcagccgactccatgcccctacgctgctgccggcggtgtcccccacagatc

[0043] caccaagactaagagacaagacaagagagagagagagagagagagagagacaagagagagagacaagagagacaagacaagacaagacaagacagacccc

[0044] gctccaccaagaccaagagaccaagagagaacaccaagagagagagagaacagagagagacaagagagacaagagagacaagagacaga

[0045] acccgctccaccaagaccaagagaccaagactaagaagagagaccaagagagagagagaccaagagagacaagagacaagacagacaagaca

[0046] caagacccgctccaccaagaccaagaagaccaagaccaagaagaagaccaagaagaagaagaagaccaagaagaagaccaagaagaagacca

[0047] agaccaagaccagatcttg

[0048] SEQ ID NO.8

[0049] atttagcagcattccagattgggttcaatcaacaaggtacgagccatatcactttattcaaattggtatcgccaaaaccaagaaggaactcccatcctcaa

[0050] aggtttgtaaggaagaattctcagtccaaagcctcaacaaggtcagggtacagagtctccaaaccattagccaaaagctacaggagatcaatgaagaa

[0051] tcttcaatcaaagtaaactactgttccagcacatgcatcatggtcagtaagtttcagaaaaagacatccaccgaagacttaaagttagtgggcatctttgaa

[0052] agtaatcttgtcaacatcgagcagctggcttgtggggaccagacaaaaaaggaatggtgcagaattgttaggcgcacctaccaaaagcatctttgccttt

[0053] attgcaaagataaagcagattcctctagtacaagtggggaacaaaataacgtggaaaagagctgtcctgacagcccactcactaatgcgtatgacgaa

[0054] cgcagtgacgaccacaaaagaattccctctatataagaaggcattcattcccatttgaaggatcatcagatactcaaccaatccttctaggatctaccgtct

[0055] tcggtacgcgctcactccgccctctgcctttgttactgccacgtttctctgaatgctctcttgtgtggtgattgctgagagtggtttagctggatctagaattac

[0056] actctgaaatcgtgttctgcctgtgctgattacttgccgtcctttgtagcagcaaaatatagggacatggtagtacgaaacgaagatagaacctacacagc

[0057] aatacgagaaatgtgtaatttggtgcttagcggtatttatttaagcacatgttggtgttatagggcacttggattcagaagtttgctgttaatttaggcacagg

[0058] cttcataactacatgggtcaatagtatagggattcatattataggcgatactataataatttgttcgtctgcagagcttattatttgccaaaattagatattcctatt

[0059] ctgtttttgtttgtgtgctgttaaattgttaacgcctgaaggaataaatataaatgacgaaattttgatgtttatctctgctcctttattgtgaccataagtcaagat

[0060] cagatgcacttgttttaaatattgttgtctgaagaaataagtactgacagtattttgatgcattgatctgcttgtttgttgtaacaaaatttaaaaataaagagttt

[0061] cctttttgttgctctccttacctcctgatggtatctagtatctaccaactgacactatattgcttctctttacatacgtatcttgctcgatgccttctccctagtgttg

[0062] accagtgttactcacatagtctttgctcatttcattgtaatgcagataccaagcggcctctagaggatcaaggagcaaccatggcggcgaccatggcgtc

[0063] caacgctgcggctgcggctgcggtgtccctggaccaggccgtggctgcgtcggcagcgttctcgtcgcggaagcagctgcggctgcctgccgcag

[0064] cgcgcggagggatgcgggtgcgggtgcgggcgcggggtcggcgggaggcggtggtggtggcgtccgcgtcgtcgtcgtcggtggcagcgccg

[0065] gcggcgaaggctgagatgctacacggtgcaagcagccggccggcaaccgctcgcaaatcttccggcctttcgggaacggtcaggattccgggcgat

[0066] aagtccatatcccaccggtcgttcatgttcggcggtcttgccagcggtgagacgcgcatcacgggcctgcttgaaggtgaggacgtgatcaataccgg

[0067] gaaggccatgcaggctatgggagcgcgtatccgcaaggaaggtgacacatggatcattgacggcgttgggaatggcggtctgctcgcccctgaggc

[0068] ccctctcgacttcggcaatgcggcgacgggctgcaggctcactatgggactggtcggggtgtacgacttcgatagcacgttcatcggagacgcctcgc

[0069] tcacaaagcgcccaatgggccgcgttctgaacccgttgcgcgagatgggcgtacaggtcaaatccgaggatggtgaccgtttgcccgttacgctgcg

[0070] cgggccgaagacgcctaccccgattacctaccgcgtgccaatggcatccgcccaggtcaagtcagccgtgctcctcgccggactgaacactccggg

[0071] catcaccacggtgatcgagcccatcatgaccagggatcataccgaaaagatgcttcaggggtttggcgccaacctgacggtcgagacggacgctgac

[0072] ggcgtcaggaccatccgccttgagggcaggggtaaactgactggccaagtcatcgatgttccgggagacccgtcgtccacggccttcccgttggttgc

[0073] ggcgctgctcgtgccggggagtgacgtgaccatcctgaacgtcctcatgaacccgaccaggaccggcctgatcctcacgcttcaggagatgggagc

[0074] cgacatcgaggtgatcaacccgcgcctggcaggcggtgaagacgttgcggatctgcgcgtgcgctcctctaccctgaagggcgtgacggtcccgga

[0075] agatcgcgcgccgtccatgatagacgagtatcctattctggccgtcgccgctgcgttcgccgaaggggccacggtcatgaacggtcttgaggaactcc

[0076] gcgtgaaggaatcggatcgcctgtcggcggtggccaatggcctgaagctcaacggtgttgactgcgacgagggtgagacctcactcgtggtccgtgg

[0077] ccggcctgatggcaagggcctcggcaacgccagtggagcggccgtcgccacgcacctcgatcatcgcatcgcgatgtccttcttggtgatgggtctc

[0078] gtctcagagaacccggtgaccgtcgatgacgccacgatgatagcgacgagcttcccagagttcatggatctgatggcgggcctcggggccaagatc

[0079] gaactgtctgacacgaaggccgcttgactcgagtttctccataataatgtgtgagtagttcccagataagggaattagggttcctatagggtttcgctcatg

[0080] tgttgagcatataagaaacccttagtatgtatttgtatttgtaaaatacttctatcaataaaaatttctaattcctaaaaccaaaatccagtactaaaatccagatc

[0081] ccccgaattaattcggcgttaattcagtacattaaaSEQ ID NO.9

[0082] aagcttttggaaaggtgccgtgcagttcaaacaattagttagcagtagggtgttggtttttgctcacagcaataagaagttaatcatggtgtaggcaacccaaataaaacaccaaaatatgcacaaggcagtttgttgtattctgtagtacagacaaaactaaaagtaatgaaagaagatgtggtgttagaaaaggaaacaatatcatgagtaatgtgtgagcattatgggaccacgaaataaaaagaacattttgatgagtcgtgtatcctcgatgagcctcaaaagttctctcaccccggataagaaacccttaagcaatgtgcaaagtttgcattctccactgacataatgcaaaataagatatcatcgatgacatagcaactcatgcatcatatcatgcctctctcaacctattcattcctactcatctacataagtatcttcagctaaatgttagaac ataaacccataagtcacgtttgatgagtattaggcgtgacacatgacaaatcacagactcaagcaagataaagcaaaatgatgtgtacataaaactccagagctatatgtcatattgcaaaaagaggagagcttataagacaaggcatgactcacaaaaattcatttgcctttcgtgtcaaaaagaggagggctttacattatccatgtcatattgcaaaagaaagagagaa agaacaacacaatgctgcgtcaattatacatatctgtatgtccatcattattcatccacctttcgtgtaccacacttcatatatcatgagtcacttcatgtctgggacattaacaa actctatcttaacatttagatgcaagagcctttatcccactataaatgcacgatgatttctcattgtttctcacaaaaagcattcagttcattagtcctacaacaactctagaACC

[0083] SEQ ID NO.10

[0084] agaaactatgtgctgtagtatagccgctggctagctagctagttgagtcatttagcggcgatgattgagtaataatgtgtcacgcatcaccatgggt ggcagtgtcagtgtgagcaatgacctgaatgaacaattgaaatgaaaagaagcttg.

[0085] Example 2: Obtaining the transformant

[0086] Maize genetic transformation was performed using Agrobacterium-mediated transformation, specifically following the method and culture medium formulation reported by Frame et al. (Plant Physiol, 2002, 129:13-22). Glyphosate at a final concentration of 2 mM was used as the screening reagent. The steps are as follows:

[0087] Maize ears of the maize inbred line B104, 8-10 days after pollination, were collected, and immature embryos measuring 1.0-1.5 mm were collected. Agrobacterium containing the transformation vector from Example 1 was co-cultured with the immature embryos at 22°C for 3-5 days. The cultured immature embryos were then transferred to callus induction medium containing a final concentration of 200 mg / L termethin antibiotic (GlaxoSmithKline, USA) and cultured in the dark at 28°C for 10-14 days to kill Agrobacterium. The induced callus was then transferred to selection medium containing a final concentration of 2 mM glyphosate and cultured in the dark at 28°C for 2-3 weeks. After induction, all callus was transferred to fresh selection medium containing 2 mM glyphosate and cultured in the dark at 28°C for 2-3 weeks. The surviving embryogenic tissue was transferred to regeneration medium and cultured in the dark at 28°C for 10-14 days, then transferred to fresh regeneration medium and cultured under light at 26°C for 10-14 days. Fully developed plants were selected and placed on rooting medium, cultured at 26°C under light until roots were fully developed. The regenerated seedlings were then transplanted into a greenhouse for propagation. Transgenic maize obtained using CP4-RNAi transformation was labeled RK (glyphosate resistance and low expression of α-glucosinolates), while transgenic maize obtained using the CP4-RNAi-Gam vector was labeled HRK (glyphosate resistance, low expression of α-glucosinolates, and γ-glucosinolate fusion protein).

[0088] Example 3: Molecular detection of transformants

[0089] Genomic DNA from maize in Example 2 was extracted using the CTAB (hexadecyltrimethylammonium bromide) method. One gram of young transgenic maize leaves was ground into powder in liquid nitrogen. 0.8 mL of preheated CTAB buffer (20 g / L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM EDTA, pH 8.0) was added and thoroughly mixed. The mixture was then incubated in a 65°C water bath for 60 min. An equal volume of chloroform was added, the mixture was inverted and mixed, and centrifuged at 12000 rpm for 10 min. The supernatant was transferred to a new centrifuge tube. 0.7 volumes of isopropanol were added, the tube was gently shaken, and centrifuged at 12000 rpm for 1 min to collect DNA at the bottom of the tube. The supernatant was discarded, and 1 mL of 75% ethanol was added to wash the precipitate. The precipitate was washed once more and dried in a clean bench. The DNA precipitate was dissolved in an appropriate amount of TE buffer (10 mM Tris-HCl, 1 mM EDTA, 1 mM EDTA, 1 mM EDTA). In EDTA (pH 8.0), amplification was performed using detection primers CP-F (CCAGTGTTACTCACATAGTCTT) and CP-R (AGACCGCCGAACATGAACGACC). Electrophoresis results of the amplified products (…) Figure 3 The results showed that a band of approximately 420 bp was detected in the transgenic sample, which was consistent with the expected band size, while no specific band was detected in the control sample.

[0090] Example 4: Transformant Grain Analysis

[0091] After transplanting the B104 receptor control (CK) and the T0 transgenic maize from Example 2 into a greenhouse, they were self-pollinated, and the maize kernels were harvested. The transgenic food safety supervision and testing center of China Agricultural University was commissioned to detect and analyze the amino acid content in the transgenic maize seeds according to the method of "National Food Safety Standard for Determination of Amino Acids in Food GB / T 5009.124-2003".

[0092] The transgenic T0 generation RK was screened to obtain the transformant RK7 with the highest lysine content, which is 0.31%. The contents of other amino acids were not significantly different from those of conventional corn kernels.

[0093] The transgenic HRK16 with the highest lysine content was obtained from the T0 generation HRK, with a lysine content of 0.41%. The contents of other amino acids were not significantly different from those of the control corn kernels.

[0094] T0 generation RK7 and HRK16 were planted, self-pollinated, and the kernels were harvested. The amino acid content of the maize kernels was tested. The results showed that the lysine content of T1 generation RK7 and HRK16 was not significantly different from that of T0 generation, but was significantly higher than that of conventional control maize kernels.

[0095] Maize seeds were homogenized using an extraction buffer of 70% ethanol containing 2% mercaptoethanol and extracted overnight at room temperature. The extract was centrifuged, and the supernatant was collected. The supernatant was mixed with SDS sample buffer, boiled in water for 10 minutes to denature, and then used for SDS protein electrophoresis. The protein electrophoresis method and reagent formulation are described in *Molecular Cloning: A Laboratory Manual (4th Edition)*. Electrophoresis results showed that compared with conventional control seeds, the 19 kDa and 22 kDa α-glucosinolate bands in RK7 and HRK16 were significantly lighter.

[0096] The results of dissecting mature corn kernels showed that RK7 kernels had almost no cuticle formation, and the kernels inside the seed coat were mainly white starch. HRK16 kernels were similar to conventional corn kernels, with a tight, transparent cuticle and starch layer inside the seed coat. Figure 4 ).

[0097] Table 1. Analysis of amino acid content in corn kernels (g / 100g)

[0098]

Claims

1. A method for cultivating high-lysine, high-quality protein corn, characterized in that, The method involves transferring an RNAi interference expression cassette that inhibits α-glucosinolate expression and a high-lysine fusion gene expression cassette into the maize genome to cultivate high-quality protein maize. The high-lysine fusion gene expression cassette includes a γ-glucosinolate fusion gene rich in lysine residues, and the nucleotide sequence of the γ-glucosinolate fusion gene rich in lysine residues is shown in SEQ ID NO.

7.

2. The method for cultivating high-lysine, high-quality protein corn as described in claim 1, characterized in that, The RNAi interference expression cassette includes an RNAi interference sequence that targets the α-glucosinolate gene shown in SEQ ID NO.1 or SEQ ID NO.

2.

3. The method for cultivating high-lysine, high-quality protein corn as described in claim 1 or 2, characterized in that, The RNAi interference expression cassette includes an RNAi interference sequence, a seed-specific promoter, and a terminator; the seed-specific promoter is the maize 22kD α-prolysin promoter, and its nucleotide sequence is shown in SEQ ID NO.4; the terminator nucleotide sequence is shown in SEQ ID NO.

5.

4. The method for cultivating high-lysine, high-quality protein corn as described in claim 3, characterized in that, The RNAi interference sequence nucleotide sequence is shown in SEQ ID NO.

3.

5. The method for cultivating high-lysine, high-quality protein corn as described in claim 1, characterized in that, The high-lysine fusion gene expression cassette includes a γ-prolyzin fusion gene rich in lysine residues, a promoter, and a terminator; the promoter nucleotide sequence is SEQ ID NO.9, and the terminator nucleotide sequence is SEQ ID NO.

10.

6. The method for cultivating high-lysine, high-quality protein corn as described in claim 1, characterized in that, The method further includes transferring a glyphosate-resistant expression cassette into the maize genome for screening positive transformants, the nucleotide sequence of which is shown in SEQ ID NO.8.

Citation Information

Patent Citations

  • Constructing method of zein gene RNAi (Ribonucleic Acid Interference) carrier

    CN102533847A

  • Amino acid-enriched plant protein reserves, particularly lysine-enriched maize gamma-zein, and plants expressing such proteins

    US7297847B1