EST-SSR primers developed based on transcriptome sequences of waterlogged Phoebe chinensis and their application

Abstract

The invention discloses EST-SSR primers developed based on a waterlogging transcriptome sequence of phoenix peony and applications thereof, wherein the EST-SSR primers developed based on the waterlogging transcriptome sequence of phoenix peony include 20 pairs of primers P1-P20, the sequences of P1-P20 are respectively shown as SEQ ID No.1 to SEQ ID No.40, and have the advantages of clear amplification bands, high polymorphism, good repeatability, strong versatility, and the like. The invention fills the gap of SSR markers of candidate genes related to the waterlogging trait of phoenix peony, enriches the number of peony EST-SSR primers, and can utilize the EST-SSR primer set developed by the invention to carry out molecular identification, genetic diversity analysis, kinship analysis, molecular marker-assisted selection breeding, and the like of peony varieties in the south of the Yangtze River, especially to provide a favorable technical means for early screening of waterlogging-resistant varieties.

Description

Technical Field

[0001] The invention relates to the technical field of SSR molecular marker development, and in particular to EST-SSR primers developed based on phoenix danshen waterlogging transcriptome sequences and applications thereof. Background Art

[0002] Oil-bearing peony is a new type of woody oil crop with the characteristics of drought resistance, barrenness resistance, severe cold resistance, and shade resistance. The peony seed oil extracted from its seeds contains up to 92% unsaturated fatty acids, among which α-linolenic acid, which is very beneficial to human health, is as high as 43%. There are two main varieties of oil-bearing peonies, Fengdan and Ziban. Among them, Fengdan is the main series suitable for planting in the Jiangnan region. Its root system is fleshy and sensitive to water. It is a type of plant that is not tolerant to waterlogging. Due to the high rainfall in the Jiangnan region, especially when the pod-setting period of Fengdan happens to meet the plum rain season, the yield of Fengdan is greatly affected. In this regard, scientific researchers have tried to successfully alleviate the disasters caused by rain to Fengdan through rain shelter cultivation, root restriction cultivation, and agricultural and light complementary cultivation. However, it is only a partial relief. For Fengdan cultivated in large areas of mountains and intercropped under forests, these methods are difficult to implement. Therefore, in order to fundamentally solve the problem, it is urgently necessary to select some flood-resistant oil-bearing peony varieties to solve the problem of reduced production of oil-bearing peonies due to their flood-resistance from the variety level, and to facilitate faster and larger-scale promotion and application, thereby alleviating the domestic oil shortage situation.

[0003] Fengdan is a woody plant. It takes three years for the seeds to bloom and produce pods. There are disadvantages in field selection, such as long cycle, wide range and high cost. Therefore, it is urgent to develop a molecular marker method that can identify strains with strong waterlogging resistance at an early stage. In addition, most Fengdan varieties are self-pollinated offspring, and their exact parents are unknown, which brings many uncertainties to breeding work, often resulting in confusion of kinship, homonyms or homonyms. Molecular marker-assisted breeding is an important direction of modern genetic breeding research. Among the many molecular markers, SSR markers have the advantages of high polymorphism, good repeatability and simple operation. They have been widely used in variety identification, genetic diversity analysis and molecular marker-assisted selection breeding of plants such as corn, soybeans, cabbage, cotton, chrysanthemum, Sophora japonica, magnolia, and bayberry. There are a few reports on the development of peony SSR markers. For example, Han et al. developed SSR markers for regulating genes related to target traits such as oil synthesis and fatty acid accumulation, seed size and grain weight based on the high-throughput RNA-seq database of purple-spotted peony in "Multi-gene Regulation of High Accumulation of C18-Unsaturated Fatty Acids in Purple-spotted Peony Seeds" based on the high-throughput RNA-seq database of purple-spotted peony; Luo Liuming et al. developed SSR markers for regulating candidate genes related to flower color formation based on the transcriptome information of petals of Central Plains peony in "Development and Universality Analysis of Peony SSR Markers Based on RNA-seq"; Hu Yonghong provided a "Peony EST-SSR Primers Developed Based on Transcriptome Sequencing and Their Development Method" in the patent application with publication number CN107881250A, and developed EST-SSR primers for molecular identification of wild peonies such as purple-spotted peony, yellow peony, Sichuan peony, etc. based on the transcriptome information of petals at different developmental stages of peony.

[0004] However, up to now, there has been no report on the development of SSR markers for waterlogging damage transcriptome sequences in Jiangnan peony Fengdan. Therefore, using the sequence information obtained from Fengdan waterlogging damage transcriptome sequencing to develop EST-SSR primers will provide an important theoretical basis for the screening of important trait genes related to waterlogging, molecular marker-assisted selection breeding, and germplasm identification. Summary of the invention

[0005] In order to solve the above-mentioned technical problems, the purpose of the present invention is to provide an EST-SSR primer developed based on the transcriptome sequence of Fengdan waterlogging and its application. The EST-SSR primer developed by the present invention can amplify clear, stable and highly polymorphic bands, can better identify genes related to the waterlogging traits of Fengdan, screen out Fengdan waterlogging-resistant varieties, and can also be used for molecular identification, genetic diversity analysis, kinship analysis and molecular marker-assisted breeding of Jiangnan peony varieties.

[0006] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions:

[0007] The EST-SSR primers developed based on the transcriptome sequence of Fengdan waterlogging include the following 20 pairs of primers:

[0008] Primer pair P1, the sequences of which are shown in SEQ ID NO.1 and SEQ ID NO.2;

[0009] Primer pair P2, whose sequences are shown in SEQ ID NO.3 and SEQ ID NO.4;

[0010] Primer pair P3, whose sequences are shown in SEQ ID NO.5 and SEQ ID NO.6;

[0011] Primer pair P4, whose sequences are shown in SEQ ID NO.7 and SEQ ID NO.8;

[0012] Primer pair P5, the sequences of which are shown in SEQ ID NO.9 and SEQ ID NO.10;

[0013] Primer pair P6, the sequences of which are shown in SEQ ID NO.11 and SEQ ID NO.12;

[0014] Primer pair P7, the sequences of which are shown in SEQ ID NO.13 and SEQ ID NO.14;

[0015] Primer pair P8, the sequences of which are shown in SEQ ID NO.15 and SEQ ID NO.16;

[0016] Primer pair P9, the sequences of which are shown in SEQ ID NO.17 and SEQ ID NO.18;

[0017] Primer pair P10, the sequences of which are shown in SEQ ID NO.19 and SEQ ID NO.20;

[0018] Primer pair P11, the sequences of which are shown in SEQ ID NO.21 and SEQ ID NO.22;

[0019] Primer pair P12, the sequences of which are shown in SEQ ID NO.23 and SEQ ID NO.24;

[0020] Primer pair P13, the sequences of which are shown in SEQ ID NO.25 and SEQ ID NO.26;

[0021] Primer pair P14, the sequences of which are shown in SEQ ID NO.27 and SEQ ID NO.28;

[0022] Primer pair P15, the sequences of which are shown in SEQ ID NO.29 and SEQ ID NO.30;

[0023] Primer pair P16, the sequences of which are shown in SEQ ID NO.31 and SEQ ID NO.32;

[0024] Primer pair P17, the sequences of which are shown in SEQ ID NO.33 and SEQ ID NO.34;

[0025] Primer pair P18, the sequences of which are shown in SEQ ID NO.35 and SEQ ID NO.36;

[0026] Primer pair P19, the sequences of which are shown in SEQ ID NO.37 and SEQ ID NO.38;

[0027] Primer pair P20, the sequences of which are shown in SEQ ID NO.39 and SEQ ID NO.40;

[0028] The use of the EST-SSR primers developed based on the transcriptome sequence of P. chinensis waterlogging in any of the following (1)-(4):

[0029] (1) Molecular identification of Jiangnan peony varieties;

[0030] (2) Analysis of genetic diversity of Jiangnan peony varieties;

[0031] (3) Analysis of the genetic relationship of Jiangnan peony varieties;

[0032] (4) Molecular marker-assisted breeding of Jiangnan peony;

[0033] The Jiangnan peony variety is any one of the following nine peony varieties: red hibiscus, poinsettia, Yulouchun, Dafugui, Fengdan, Dianjianghong, Xishipin, purple hydrangea and Xiangxipin.

[0034] The method for molecular identification of Jiangnan peony varieties using the EST-SSR primers developed based on the transcriptome sequence of Fengdan waterlogging includes the following steps:

[0035] (1) DNA was extracted from leaves of peony spatholobi using a modified magnetic bead method. 0.4-0.6 g of sample was taken from each sample for DNA extraction.

[0036] (2) using the Jiangnan peony leaf DNA extracted in step (1) as a template, using the P1-P20 pairs of primers in the EST-SSR primers to perform PCR amplification respectively to obtain PCR amplification products;

[0037] (3) The PCR amplification product in step (2) is first subjected to 1.5% agarose gel electrophoresis with a sample volume of 3 μL. If no product is found, a secondary PCR amplification is performed and a secondary agarose gel is detected. If a product is found, 3 μL of the PCR amplification product is mixed with 5 μL of Loading Buffer, centrifuged, denatured at 94°C for 5 min, frozen in an ice box for 1 min, and then subjected to vertical electrophoresis analysis on a 6% denaturing polyacrylamide gel and observed after silver staining;

[0038] (4) According to the silver staining results, the software Quantityone was used to read the band data, count the detection sites, and perform molecular identification of Jiangnan peony varieties based on the detection sites.

[0039] Preferably, in step (2), the reaction system for PCR amplification is 20 μL, including: 14.8 μL ddH2O, 0.4 μL dNTP, 2 μL Buffer, 0.3 μL each of 20 μM upstream and downstream primers, 2 μL DNA template, and 0.2 μL Taq.

[0040] Preferably, in step (2), the reaction procedure of PCR amplification is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 54°C for 35 s, extension at 72°C for 40 s, for a total of 35 cycles; and final extension at 72°C for 3 min.

[0041] Preferably, in step (4), when performing molecular identification of Jiangnan peony varieties, the amplification sites of each pair of primers in the peony sample are assigned corresponding codes, with the presence of a DNA band being recorded as 1 and the absence of a DNA band being recorded as 0, and converted into a 0, 1 data matrix. When the maternal parent of the sample to be tested is known, the paternal parent can be tested and determined based on whether the sample has part or all of the paternal parent fragments.

[0042] Preferably, the Jiangnan peony variety is any one of the following nine peony varieties: Red Hibiscus, Poinsettia, Yulouchun, Dafugui, Fengdan, Dianjianghong, Xishifen, Purple Hydrangea and Xiangxifen.

[0043] The present invention has the following beneficial effects due to the adoption of the above technical solution:

[0044] The present invention develops a set of EST-SSR primers based on the transcriptome sequence of waterlogging in phoenix peony, including 20 pairs of primers P1-P20, which have the advantages of clear amplification bands, high polymorphism, good repeatability and strong versatility, fills the gap of SSR markers of candidate genes related to waterlogging traits in phoenix peony, enriches the number of EST-SSR primers in peony, and can utilize the EST-SSR primer set developed by the present invention to carry out molecular identification, genetic diversity analysis, kinship analysis and molecular marker-assisted selection breeding of Jiangnan peony varieties, especially providing a favorable technical means for early screening of waterlogging-resistant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 The results of agarose electrophoresis of the amplified products of 9 varieties of Jiangnan peony using primer pairs P1-P20 (the order of spotting samples of the 9 varieties of Jiangnan peony from left to right in the figure is: Hong Furong, Yulouchun, Dafugui, Yipinhong, Zixiuqiu, Xiangxifen, Fengdan, Xishifen, Dianjianghong);

[0046] Figure 2 This is the PAGE electrophoresis of 9 Jiangnan peony varieties on EST-SSR primer pairs P1-P20 (the order of spotting samples of the 9 Jiangnan peony varieties from left to right in the figure is: Hong Furong, Yulouchun, Dafugui, Yipinhong, Zixiuqiu, Xiangxifen, Fengdan, Xishifen, Dianjianghong);

[0047] Figure 3 This is a cluster analysis diagram of 9 Jiangnan peony varieties. DETAILED DESCRIPTION

[0048] The present invention is further described in detail below in conjunction with specific embodiments. The examples given are only for illustrating the present invention, but not for limiting the scope of the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0049] Example 1: Development of EST-SSR primers based on the transcriptome sequence of P. chinensis waterlogging

[0050] (1) The Fengdan waterlogging transcriptome database is derived from the inventors' high-throughput sequencing results of Fengdan waterlogging stress;

[0051] (2) Download the software MISA from http: / / pgrc.ipk-gatersleben.de / misa / to search the database in step (1) for SSR loci and screen according to the following criteria: SSR length is more than 12 bp, amplification product is more than 200 bp, dinucleotide repeat number is ≥ 6, trinucleotide repeat number is ≥ 5, tetranucleotide, pentanucleotide, and hexanucleotide repeat number is ≥ 4;

[0052] (3) Primer3 software was used to design primers on both sides of the SSR sequences screened in step (2), and finally 20 pairs of EST-SSR primers were determined as shown in Table 1:

[0053] Table 1: Information of 20 pairs of EST-SSR primers

[0054]

[0055]

[0056] In the present invention, 20 pairs of EST-SSR primers designed based on the transcriptome sequence of Fengdan waterlogging are used, and the amplified bands are clear, highly polymorphic, and have good repeatability and strong versatility. The genes related to the waterlogging traits of Fengdan can be better identified, and the waterlogging-resistant varieties of Fengdan can be screened out, which has certain advantages in the early identification of waterlogging-resistant germplasm.

[0057] Example 2: Genetic diversity analysis of EST-SSR primer sets P1-P20 in Jiangnan peony varieties

[0058] (1) Extracting genomic DNA from leaves of nine southern peony varieties: Hong Furong, Fengdan, Zixiuqiu, Xiangxifen, Yipinhong, Yulouchun, Xishifen, Dianjianghong, and Dafugui;

[0059] (2) Using the peony leaf DNA extracted in step (1) as a template, PCR amplification was performed using 20 primer pairs, P1-P20, in the EST-SSR primer set; the PCR amplification reaction system was 20 μL, including: 14.8 μL ddH2O, 0.4 μL dNTP, 2 μL Buffer, 0.3 μL each of 20 μM upstream and downstream primers, 2 μL DNA template, and 0.2 μL Taq; the PCR amplification reaction program was: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 54°C renaturation for 35 s, 72°C extension for 40 s, for a total of 35 cycles; and finally 72°C extension for 3 min. Generally speaking, the annealing temperature fluctuates around 54°C.

[0060] (3) The PCR amplification products were first detected by 1.5% agarose gel electrophoresis with a sample volume of 3 μL. The agarose gel electrophoresis results of the amplification products of 9 Jiangnan peony varieties using primer pairs P1-P20 are as follows Figure 1 As shown, if there is no product, perform secondary PCR amplification and secondary agarose detection; if there is a product, mix 3μL PCR amplification product with 5μL Loading Buffer. After centrifugation, denature at 94℃ for 5min, freeze in an ice box for 1min, and then perform vertical electrophoresis analysis on 6% denatured polyacrylamide gel. After silver staining, observe the PAGE electrophoresis of 9 Jiangnan peony varieties at P1-P20 on EST-SSR primer pairs P1-P20 as shown below Figure 2 shown.

[0061] (4) According to the silver staining results, the software Quantityone was used to read the band data, and the detection sites were counted. The electrophoresis position of the PCR amplification product at a certain position of the same mobility in the gel was recorded as 1 if there was a DNA band, and 0 if there was no DNA band, and then converted into a 0, 1 data matrix comparison result table as shown in Table 2. Based on the statistical results, genetic diversity analysis was performed using POPGENE32 software, and Nei's genetic identity I (genetic identity) and genetic distance D (genetic distance) were used to measure the genetic differentiation between various populations. Based on the genetic similarity coefficient, the UPGMA method in NTSYSpcVersion2.10e software was used to perform cluster analysis on each sample, and the following was constructed: Figure 3 Cluster analysis diagram of 9 Jiangnan peony varieties shown.

[0062] Table 2: 0,1 data matrix comparison results of the amplification results of 9 Jiangnan peony varieties

[0063]

[0064]

[0065] Results: The results showed that the EST-SSR primer set developed based on the transcriptome sequence of Fengdan waterlogging in the present invention has the advantages of clear amplified bands, high polymorphism, and good repeatability. The 20 pairs of primers amplified bands in the genomic DNA of the above-mentioned 9 Jiangnan peony varieties all had polymorphisms, of which 12 pairs of primers had a polymorphism ratio of 100%, and 4 pairs of primers had a polymorphism ratio of more than 80%. The observed number of alleles (Na) ranged from 1.3333 to 2.0000, with an average of 1.8307; the number of effective alleles (Ne) ranged from 1.0604 to 1.6926, with an average of 1.3884; the Nei's gene diversity ranged from 0.1481 to 0.3972, with an average of 0.2561; the Shannon information index ranged from 0.1096 to 0.5818, with an average of 0.3720. This shows that the 20 pairs of EST-SSR primers developed in the present invention are all effective primers and have universal applicability, and can be used for genetic diversity analysis, kinship identification, etc. of Jiangnan peony varieties, especially for early screening of waterlogging-resistant varieties.

[0066] Example 3: Using the EST-SSR primer set developed based on the transcriptome sequence of the phoenix dan waterlogging to identify whether the male parent of the peony sample to be tested is the Jiangnan peony variety "Red Hibiscus"

[0067] (1) Extracting genomic DNA from leaves of the peony sample to be tested and the Jiangnan peony variety "Hong Furong";

[0068] (2) Using the genomic DNA of peony leaves extracted in step (1) as a template, PCR amplification was performed using 20 primer pairs, P1-P20, in the EST-SSR primer set; the reaction system for PCR amplification was 20 μL, including: 14.8 μL ddH2O, 0.4 μL dNTP, 2 μL Buffer, 0.3 μL each of 20 μM upstream and downstream primers, 2 μL DNA template, and 0.2 μL Taq; the reaction program for PCR amplification was: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 54°C for 35 s, and extension at 72°C for 40 s, for a total of 35 cycles; and final extension at 72°C for 3 min.

[0069] (3) The PCR amplification product was first detected by 1.5% agarose gel electrophoresis with a sample volume of 3 μL. If there was no product, a secondary PCR amplification was performed and a secondary agarose gel detection was performed; if there was a product, 3 μL of PCR amplification product was mixed with 5 μL Loading Buffer. After centrifugation, denatured at 94°C for 5 minutes, frozen in an ice box for 1 minute, and then analyzed by vertical electrophoresis on a 6% denaturing polyacrylamide gel and observed after silver staining.

[0070] (4) According to the silver staining results, the software Quantityone was used to read the band data, count the detection sites, and assign corresponding codes to the amplification sites of each primer pair in the peony sample to be tested and the "Red Hibiscus". The presence of DNA bands was recorded as 1, and the absence of DNA bands was recorded as 0, which was then converted into a 0, 1 data matrix comparison result table as shown in Table 3. According to the fact that the fragments of the offspring come from the father and the mother, that is, the fragments of the offspring simultaneously show part or all of the fragments of the father and the mother. When the mother of the sample to be tested is known, the father can be tested and determined based on whether the fragments of the offspring have part or all of the fragments of the father.

[0071] Table 3: 0,1 data matrix comparison results of amplification results of "Red Hibiscus" and tested peony samples

[0072]

[0073]

[0074] Result analysis: According to the results in Table 2, the amplified bands of the peony sample to be tested and "Red Hibiscus" are highly similar, and it can be determined that the male parent of the peony sample to be tested is "Red Hibiscus". This also shows that the EST-SSR primer set developed based on the transcriptome sequence of Fengdan waterlogging in the present invention can be used for parent identification and testing of Jiangnan peony varieties.

[0075] The above embodiments are all preferred embodiments of the present invention, but are not limited to the above embodiments. Any other modifications, improvements, adjustments, etc. made without departing from the spirit and principles of the present invention should be included in the protection scope of this application.

[0076] Sequence Listing

[0077] SEQ ID NO.1:CTTTCGAGAACCGCATTTTC

[0078] SEQ ID NO.2:ATCGAAACACGACCCACTTC

[0079] SEQ ID NO.3:GAGCCGCGGTGATATATGTT

[0080] SEQ ID NO.4:CCGCGAAATTTCTTCGATAA

[0081] SEQ ID NO.5:TCCACGAACCAAACACTGAA

[0082] SEQ ID NO.6:TCTTTGTGATCTGGTGCTGC

[0083] SEQ ID NO.7:GAGAGAAGCTCCGTTGTTGG

[0084] SEQ ID NO.8:GAATTACAACACCCCATGCC

[0085] SEQ ID NO.9:AGGCCGAGCTCCACATGTAT

[0086] SEQ ID NO.10:TGCGGAGGATGAGTTCTTCT

[0087] SEQ ID NO.11: TACCTGTCTCGAACTCCCCA

[0088] SEQ ID NO.12:CTATGAGGGACCAGAGAGCG

[0089] SEQ ID NO.13:CCAGAGCCACATGCCTTATT

[0090] SEQ ID NO.14:ATGTCATCTGAGGTTTCGGC

[0091] SEQ ID NO.15:ACCTCCTTCTTTAGCGCTCC

[0092] SEQ ID NO.16:CCGCCAATTTCAGAGAGAGA

[0093] SEQ ID NO.17:TCCCACATTCTTGTGCAGAG

[0094] SEQ ID NO.18:GTTTGGGGAAATTGGGAACT

[0095] SEQ ID NO.19:CCGGGACTATTTTCTAGCCC

[0096] SEQ ID NO.20:CAAAACTCCATCAGCAGCAG

[0097] SEQ ID NO.21:TCTTGCCATTTCCTTGAAGC

[0098] SEQ ID NO.22:AAGGTGGCACGAGCATTAAC

[0099] SEQ ID NO.23:ATGGCCGTAGCATAGTGTCC

[0100] SEQ ID NO.24:CACAAGAGGCCAACACGTAA

[0101] SEQ ID NO.25:GCAGAGTCGATCCTGGCTAC

[0102] SEQ ID NO.26:GGGTACGTCTGCAACCTTGT

[0103] SEQ ID NO.27:AAAACGTGTGGCCTCAAAAC

[0104] SEQ ID NO.28:GCGACGAATCAGGAGAGAAC

[0105] SEQ ID NO.29:GAGAGAGATAGAGGGCGCAA

[0106] SEQ ID NO.30:TCACCTCCGATTCGTAAACC

[0107] SEQ ID NO.31:AGCCTTAATCGGTCGAACCT

[0108] SEQ ID NO.32:TTGTGCCAGACACCAAGAAG <h2 style=";text-align:left;direction:ltr">

[0109] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.33:TCCATACGCATTCTTTTTCCC<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0110] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.34:GGAGCCCAAGCGTAACAATA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0111] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.35:AAGGCCGGTAAGAAGCTACC<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0112] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.36:TTCCCTAGAGGTGATGGTGG<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0113] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.37:TCGAGTACCTTGAGGAGCGT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0114] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.38:CAGATGGGCTTCTGCTTGTT<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0115] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.39:GAACAAAAGCCTTGCCTCTG<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0116] <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.40:TACGATAAGGCCACAACCACA

Claims

1. The EST-SSR primers developed based on the transcriptome sequence of P. chinensis waterlogging are characterized by: Includes the following 20 pairs of primers: Primer pair P1, the sequences of which are shown in SEQ ID NO.1 and SEQ ID NO.2; Primer pair P2, whose sequences are shown in SEQ ID NO.3 and SEQ ID NO.4; Primer pair P3, whose sequences are shown in SEQ ID NO.5 and SEQ ID NO.6; Primer pair P4, whose sequences are shown in SEQ ID NO.7 and SEQ ID NO.8; Primer pair P5, the sequences of which are shown in SEQ ID NO.9 and SEQ ID NO.10; Primer pair P6, the sequences of which are shown in SEQ ID NO.11 and SEQ ID NO.12; Primer pair P7, the sequences of which are shown in SEQ ID NO.13 and SEQ ID NO.14; Primer pair P8, the sequences of which are shown in SEQ ID NO.15 and SEQ ID NO.16; Primer pair P9, the sequences of which are shown in SEQ ID NO.17 and SEQ ID NO.18; Primer pair P10, the sequences of which are shown in SEQ ID NO.19 and SEQ ID NO.20; Primer pair P11, the sequences of which are shown in SEQ ID NO.21 and SEQ ID NO.22; Primer pair P12, the sequences of which are shown in SEQ ID NO.23 and SEQ ID NO.24; Primer pair P13, the sequences of which are shown in SEQ ID NO.25 and SEQ ID NO.26; Primer pair P14, the sequences of which are shown in SEQ ID NO.27 and SEQ ID NO.28; Primer pair P15, the sequences of which are shown in SEQ ID NO.29 and SEQ ID NO.30; Primer pair P16, the sequences of which are shown in SEQ ID NO.31 and SEQ ID NO.32; Primer pair P17, the sequences of which are shown in SEQ ID NO.33 and SEQ ID NO.34; Primer pair P18, the sequences of which are shown in SEQ ID NO.35 and SEQ ID NO.36; Primer pair P19, the sequences of which are shown in SEQ ID NO.37 and SEQ ID NO.38; The sequences of primer pair P20 are shown in SEQ ID NO.39 and SEQ ID NO.

40.

2. Use of the EST-SSR primers developed based on the transcriptome sequence of P. chinensis waterlogging as described in claim 1 in any of the following (1)-(3): (1) Molecular identification of Jiangnan peony varieties; (2) Analysis of genetic diversity of Jiangnan peony varieties; (3) Analysis of the genetic relationship of Jiangnan peony varieties; The Jiangnan peony variety is any one of the following nine peony varieties: red hibiscus, poinsettia, Yulouchun, Dafugui, Fengdan, Dianjianghong, Xishipin, purple hydrangea and Xiangxipin.

3. A method for molecular identification of Jiangnan peony varieties using the EST-SSR primers developed based on the transcriptome sequence of Fengdan waterlogging as described in claim 1, characterized in that: The following steps are involved: (1) DNA was extracted from leaves of southern peony using a modified magnetic bead method. 0.4-0.6 g of sample was taken from each sample for DNA extraction. (2) Using the DNA of the leaves of peony semperflorens extracted in step (1) as a template, using the primer pairs P1-P20 in the EST-SSR primers, respectively, to perform PCR amplification to obtain PCR amplification products; (3) The PCR amplification product in step (2) was first detected by 1.5% agarose gel electrophoresis with a sample volume of 3 μL. If no product was found, a secondary PCR amplification was performed and a secondary agarose gel detection was performed. If a product was found, 3 μL of the PCR amplification product was mixed with 5 μL of Loading Buffer, centrifuged, denatured at 94 °C for 5 min, frozen in an ice box for 1 min, and then analyzed by vertical electrophoresis on a 6% denaturing polyacrylamide gel and observed after silver staining. (4) According to the silver staining results, the software Quantityone was used to read the band data, count the detection sites, and perform molecular identification of Jiangnan peony varieties based on the detection sites; The Jiangnan peony variety is any one of the following nine peony varieties: red hibiscus, poinsettia, Yulouchun, Dafugui, Fengdan, Dianjianghong, Xishipin, purple hydrangea and Xiangxipin.

4. The method for molecular identification of Jiangnan peony varieties using EST-SSR primers developed based on the transcriptome sequence of Fengdan waterlogging according to claim 3, characterized in that: In step (2), the PCR amplification reaction system is 20 µL, including: 14.8 µL ddH2O, 0.4 µL dNTP, 2 µL Buffer, 0.3 µL each of 20 µM upstream and downstream primers, 2 µL DNA template, and 0.2 µL Taq.

5. The method for molecular identification of Jiangnan peony varieties using EST-SSR primers developed based on the transcriptome sequence of Fengdan waterlogging according to claim 3, characterized in that: In step (2), the reaction procedure of PCR amplification is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 54°C for 35 s, and extension at 72°C for 40 s, for a total of 35 cycles; and final extension at 72°C for 3 min.

6. The method for molecular identification of Jiangnan peony varieties using EST-SSR primers developed based on the transcriptome sequence of Fengdan waterlogging according to claim 3, characterized in that: In step (4), when performing molecular identification of Jiangnan peony varieties, the amplification sites of each pair of primers in the peony sample are assigned corresponding codes, with the presence of a DNA band being recorded as 1 and the absence of a DNA band being recorded as 0, and converted into a 0, 1 data matrix. When the maternal parent of the sample to be tested is known, the paternal parent can be tested and determined based on whether the fragments of the offspring contain part or all of the fragments of the paternal parent.

Images