Cotton serine / threonine protein phosphatase ghTOPP4, encoding gene and application thereof

Abstract

The application discloses a cotton serine / threonine protein phosphatase GhTOPP4, a coding gene thereof and application of the cotton serine / threonine protein phosphatase GhTOPP4. The GhTOPP4 is a protein as shown in a), b), c) or d) below: a) a protein consisting of an amino acid sequence shown in SEQ ID No. 1; b) a fusion protein obtained by connecting a tag to an N terminal and / or a C terminal of the protein shown in SEQ ID No. 1; c) a protein obtained by substituting, deleting and / or adding one or more amino acid residues to the amino acid sequence shown in SEQ ID No. 1 and having the same function; and d) a protein having more than 80 % homology with the amino acid sequence defined in any one of a) to c) and having the same function. It is found by the application that the cotton GhTOPP4 protein can regulate plant stress resistance, and lays a good molecular foundation for effectively improving plant salt tolerance, drought tolerance and ABA stress resistance.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant genetic engineering, in particular to a cotton serine / threonine protein phosphatase GhTOPP4, a coding gene thereof and application. BACKGROUND

[0002] About 20% of the world's irrigated land (producing one-third of the world's food) is threatened by salt. In China, about 100 million hectares of cultivated land, 6.66 million hectares of saline-alkali land, and nearly 200 million hectares of saline-alkali wasteland, and the area of salinization and secondary salinization will continue to expand. Soil salinization has become one of the main problems of agricultural production. As an important economic crop, cotton has gradually moved to the northwest inland area with higher soil salinization due to the demand for light and heat, cotton competition and the increase of labor cost, but excessive salt in the soil will seriously affect the yield and quality of cotton. With the continuous development of biotechnology, cultivating salt-tolerant and drought-resistant cotton varieties through gene expression or editing has become an important means of stress cultivation. Limited by genetic transformation efficiency, compared with food crops such as rice, corn and wheat, the cloning of cotton stress-resistant genes and the study of stress-resistant mechanisms are still relatively slow.

[0003] The main form of post-translational modification of eukaryotic proteins is reversible phosphorylation and dephosphorylation, which affects protein activity, stability, localization and interaction, and cell activities such as stress response. Protein phosphatases are mainly classified into three categories: serine / threonine protein phosphatases (PPP), tyrosine protein phosphatases and dual-specificity protein phosphatases. In eukaryotes, more than 90% of protein dephosphorylation reactions are catalyzed by members of the PPP protein phosphatase family. The PPP protein phosphatase family is further divided into PP1, PP2A, PP4-7, Rhizobium / Rhodobacter / Sinorhizobium / Rhodobacter / Gloeobacteraceae phosphatases, and Kelch domain protein phosphatases. The number of this family of protein phosphatases is not large and the catalytic subunit is relatively conservative, but the number of regulatory subunits is large, so it can regulate the dephosphorylation process of thousands of substrate proteins, thereby participating in the regulation of many biological processes. SUMMARY

[0004] The technical problem to be solved by the present application is how to regulate the stress tolerance of plants.

[0005] In order to solve the above technical problem, the present application first provides a protein, which is named serine / threonine protein phosphatase GhTOPP4, abbreviated as GhTOPP4 protein, derived from cotton (Gossypium hirsutum), and is a protein as shown in any one of the following:

[0006] a) a protein consisting of the amino acid sequence shown in SEQ ID No. 1 in the sequence listing;

[0007] b) a fusion protein obtained by connecting a tag to the N terminus and / or C terminus of the protein shown in SEQ ID No. 1 in the sequence listing;

[0008] c) a protein having the same function as the amino acid sequence shown in SEQ ID No. 1 in the sequence listing, obtained by substitution and / or deletion and / or addition of one or several amino acid residues;

[0009] d) a protein having the same function as any one of the amino acid sequences defined in a) to c), having 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology.

[0010] SEQ ID No. 1 consists of 316 amino acid residues.

[0011] The above protein can be artificially synthesized, or a gene encoding the same can be synthesized first and then expressed biologically.

[0012] In the above protein, the protein-tag refers to a polypeptide or protein fused and expressed with the target protein by DNA in vitro recombination technology, so as to facilitate the expression, detection, tracing or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0013] In the above protein, the substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0014] In the above protein, the homology refers to the homology of the amino acid sequence. The homology of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST webpage of the NCBI homepage. For example, the homology of a pair of amino acid sequences can be calculated by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching in the advanced BLAST 2.1, and then the value of the homology (%) can be obtained.

[0015] In the above protein, the homology of 90% or more can be at least 91%, 92%, 95%, 96%, 98%, 99% or 100% homology.

[0016] The biological material related to the above-mentioned GhTOPP4 protein also belongs to the protection scope of the present application.

[0017] The biological material is any one of C1) to C10) as follows:

[0018] C1) a nucleic acid molecule encoding the above-mentioned GhTOPP4 protein;

[0019] C2) an expression cassette containing the nucleic acid molecule of C1);

[0020] C3) a recombinant vector containing the nucleic acid molecule of C1), or a recombinant vector containing the expression cassette of C2);

[0021] C4) a recombinant microorganism containing the nucleic acid molecule of C1), or a recombinant microorganism containing the expression cassette of C2), or a recombinant microorganism containing the recombinant vector of C3);

[0022] C5) a transgenic plant cell line containing the nucleic acid molecule of C1), or a transgenic plant cell line containing the expression cassette of C2), or a transgenic plant cell line containing the recombinant vector of C3);

[0023] C6) a transgenic plant tissue containing the nucleic acid molecule of C1), or a transgenic plant tissue containing the expression cassette of C2), or a transgenic plant tissue containing the recombinant vector of C3);

[0024] C7) a transgenic plant organ containing the nucleic acid molecule of C1), or a transgenic plant organ containing the expression cassette of C2), or a transgenic plant organ containing the recombinant vector of C3);

[0025] C8) a transgenic plant containing the nucleic acid molecule of C1), or a transgenic plant containing the expression cassette of C2), or a transgenic plant containing the recombinant vector of C3);

[0026] C9) a tissue culture produced from the regenerative cells of the transgenic plant of C8);

[0027] C10) a protoplast produced from the tissue culture of C9).

[0028] In the above-mentioned biological material, the nucleic acid molecule of C1) can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA, etc. The nucleic acid molecule is specifically any one of 1) to 3) as follows:

[0029] 1) the coding sequence thereof is a DNA molecule shown in SEQ ID No. 2;

[0030] 2) a DNA molecule having 75% or more identity with the nucleotide sequence defined in 1), and encoding the above-mentioned GhTOPP4 protein;

[0031] 3) a DNA molecule hybridizing under stringent conditions to the nucleotide sequence defined in 1) or 2), and encoding the above-mentioned GhTOPP4 protein.

[0032] wherein SEQ ID No. 2 consists of 951 nucleotides, and encodes the protein shown in SEQ ID No. 1.

[0033] The identity refers to the sequence similarity with the natural nucleic acid sequence. The "identity" includes a nucleotide sequence having 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence encoding the protein consisting of the amino acid sequence shown in SEQ ID No. 1 of the present application. The identity can be evaluated by naked eyes or computer software. Using computer software, the identity between two or more sequences can be expressed in percentage (%), which can be used to evaluate the identity between the relevant sequences.

[0034] The stringent conditions are hybridization in a solution of 2xSSC, 0.1% SDS at 68°C, and washing the membrane twice for 5 min, and then hybridization in a solution of 0.5xSSC, 0.1% SDS at 68°C, and washing the membrane twice for 15 min.

[0035] In the aforementioned biological materials, the expression cassette described in C2) refers to DNA capable of expressing GhTOPP4 in host cells. This DNA may include not only a promoter to initiate GhTOPP4 gene transcription but also a terminator to terminate GhTOPP4 transcription. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in this invention include, but are not limited to: promoters of the GhTOPP4 gene itself, constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: constitutive promoter 35S of cauliflower mosaic virus; wound-inducible promoters from tomatoes, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiol 120:979-992); chemically induced promoters from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both induced by jasmonic acid methyl ester); heat shock promoters (US Patent 5,187,267); tetracycline-inducible promoters (US Patent 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 2007 1)). 0099169.7)), seed storage protein-specific promoters (e.g., promoters of beta-conglycin, napin, oleosin, and soybean beta-conglycin (Beachy et al. (1985) EMBO J.4:3047-3053). They can be used alone or in combination with other plant promoters. All references cited herein are cited in full. Suitable transcription terminators include, but are not limited to: terminators of the GhTOPP4 gene itself, Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminators (see, e.g., Odell et al. (I 985Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).

[0036] Among the above-mentioned biological materials, the recombinant vector of C3) can contain a DNA molecule for encoding the GhTOPP4 protein shown in SEQ ID No. 2.

[0037] The recombinant vector containing the gene of the GhTOPP4 protein or the gene expression cassette of the GhTOPP4 protein can be constructed using an existing plant expression vector. The plant expression vector can be a Gateway system vector or a binary expression vector, etc., such as pMDC32, super1300, pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb. When constructing the recombinant vector using the GhTOPP4, any one of the enhanced, constitutive, tissue-specific, or inducible promoters can be added before the transcription initiation nucleotide, such as the Cauliflower Mosaic Virus (CAMV) 35S promoter, the Ubiquitin promoter (pUbi), etc., which can be used alone or in combination with other plant promoters; in addition, when constructing the plant expression vector using the gene of the present application, enhancers, including translation enhancers or transcription enhancers, can also be used, and these enhancer regions can be the ATG initiation codon or the adjacent region initiation codon, etc., but must be the same reading frame as the coding sequence to ensure the correct translation of the entire sequence. The source of the translation control signal and the initiation codon is broad, and can be natural or synthetic. The translation initiation region can be from the transcription initiation region or the structural gene.

[0038] In order to facilitate the identification and screening of the transgenic plant cells or plants, the plant expression vector used can be processed, such as adding a gene (GUS gene, luciferase gene, etc.) encoding an enzyme or a luminescent compound capable of producing a color change, a resistant antibiotic marker (gentamicin marker, kanamycin marker, etc.), or an anti-chemical reagent marker gene (such as an anti-herbicide gene), etc.

[0039] In the above-mentioned biological material, the recombinant microorganism can be yeast, bacteria, algae and fungi; and the bacteria can be Agrobacterium GV3101.

[0040] In the above-mentioned biological material, the transgenic plant organ can be the root, stem, leaf, flower, fruit and seed of the transgenic plant.

[0041] In the above-mentioned biological material, the tissue culture can be derived from the root, stem, leaf, flower, fruit, seed, pollen, embryo and anther.

[0042] In the above-mentioned biological material, the transgenic plant cell line, transgenic plant tissue and transgenic plant organ do not include propagation materials.

[0043] In order to solve the above technical problems, the application further provides a new use of GhTOPP4 or a biological material related thereto.

[0044] The application provides an application of GhTOPP4 protein or a biological material related thereto in regulating the stress resistance of plants or cultivating transgenic plants with reduced stress resistance or plant breeding. Further, the regulation can be reduction, which is embodied as follows: when the content of GhTOPP4 protein in a plant is increased or the expression amount of the GhTOPP4 protein coding gene is increased, the seed germination rate of the plant under salt stress is reduced, the cotyledon greening rate under ABA stress is increased, and the root length is increased.

[0045] In order to solve the above technical problems, the application further provides a new use of a substance as indicated in b1 or b2.

[0046] b1, a substance for inhibiting or reducing the activity and / or content of GhTOPP4 protein in a plant;

[0047] b2, a substance for inhibiting or reducing the expression of GhTOPP4 protein coding gene in a plant or a substance for knocking out the GhTOPP4 protein coding gene in a plant.

[0048] The application provides application of the substance shown in b1 or b2 above in improving plant stress resistance or breeding transgenic plants with improved stress resistance or plant breeding. Further, the breeding aims to breed plant varieties with improved stress resistance, and specifically, plants containing GhTOPP4 protein or biological materials (for example, a gene encoding GhTOPP4 protein) associated with the GhTOPP4 protein can be crossed with other plants for plant breeding.

[0049] Further, the substance for inhibiting or reducing expression of the GhTOPP4 protein coding gene in plants can be a vector and a helper vector for inhibiting expression of the GhTOPP4 gene in plants. The vector for inhibiting expression of the GhTOPP4 gene in plants can be specifically a pYL156 vector containing the DNA molecule shown in SEQ ID No. 2, 1-367; and the helper vector can be specifically a pTRV-RNA1 vector.

[0050] To solve the above technical problems, the application further provides a method for breeding transgenic plants with improved stress resistance.

[0051] The method for breeding transgenic plants with improved stress resistance provided by the application comprises the steps of reducing activity and / or content of GhTOPP4 protein in a receptor plant to obtain a transgenic plant; and the transgenic plant has higher stress resistance than the receptor plant.

[0052] Further, the transgenic plant has higher stress resistance than the receptor plant, which is embodied as at least one of the following M1)-M3):

[0053] M1) under salt stress, the transgenic plant has more leaf numbers than the receptor plant;

[0054] M2) under drought stress, the transgenic plant has less wilting degree than the receptor plant;

[0055] M3) under drought stress, the transgenic plant has lower water loss rate than the receptor plant.

[0056] The method for reducing activity and / or content of GhTOPP4 protein in the receptor plant is achieved by knocking out, inhibiting or silencing the coding gene of GhTOPP4 protein in the receptor plant. The method for inhibiting expression of the GhTOPP4 protein coding gene in the receptor plant can be introducing a substance for inhibiting expression of the GhTOPP4 protein coding gene into the receptor plant.

[0057] Further, the substance for inhibiting expression of the GhTOPP4 protein coding gene is a vector and a helper vector for inhibiting expression of the GhTOPP4 gene.

[0058] In specific embodiments of the present application, the vector for inhibiting expression of GhTOPP4 gene in plants is a pYL156 vector containing a DNA molecule shown in SEQ ID No. 2, 1-367; and the helper vector is a pTRV-RNA1 vector.

[0059] To solve the above technical problems, the present application finally provides a method for cultivating a transgenic plant with reduced stress tolerance.

[0060] The method for cultivating a transgenic plant with reduced stress tolerance provided by the present application comprises the steps of increasing the content and / or activity of GhTOPP4 protein in a recipient plant to obtain a transgenic plant, wherein the stress tolerance of the transgenic plant is lower than that of the recipient plant.

[0061] Further, the stress tolerance of the transgenic plant is lower than that of the recipient plant, which is embodied as at least one of the following N1)-N3):

[0062] N1) Under salt stress, the cotyledon greening rate of the transgenic plant is lower than that of the recipient plant;

[0063] N2) Under ABA stress, the cotyledon greening rate of the transgenic plant is higher than that of the recipient plant;

[0064] N3) Under ABA stress, the root length of the transgenic plant is longer than that of the recipient plant.

[0065] The method for increasing the content and / or activity of GhTOPP4 protein in a recipient plant is overexpression of GhTOPP4 protein in the recipient plant.

[0066] Further, the method for overexpression is introduction of a coding gene of GhTOPP4 protein into a recipient plant.

[0067] In specific embodiments of the present application, the nucleotide sequence of the coding gene of GhTOPP4 protein is shown in SEQ ID No. 2. The coding gene of GhTOPP4 protein is introduced into a recipient plant through a 35S::GhTOPP4-HA recombinant vector. The 35S::GhTOPP4-HA recombinant vector is obtained by replacing the DNA fragment between the BamHI and StuI enzyme cutting sites of a pMDC32 vector with a DNA molecule shown in SEQ ID No. 2, while keeping other sequences of the pMDC32 vector unchanged.

[0068] In any of the above-mentioned applications or methods, the stress tolerance is salt tolerance and / or drought tolerance and / or ABA stress resistance (ABA sensitivity).

[0069] In any of the above-mentioned applications or methods, the plant is a monocotyledon or a dicotyledon; the dicotyledon can be Arabidopsis thaliana or cotton.

[0070] The substance shown in b1 or b2 above also belongs to the protection scope of the present application.

[0071] The present application provides a cotton GhTOPP4 gene, and constructs a transgenic Arabidopsis thaliana with overexpression of GhTOPP4 by using transgenic technology, and constructs a GhTOPP4 silenced plant by using VIGS technology, and verifies the function of GhTOPP4, and it is clear that the expression of the gene GhTOPP4 in plants can improve the stress resistance of plants, especially the drought resistance, salt tolerance and ABA stress resistance of plants, which is conducive to the more in-depth study of the response mechanism of plants to salt, drought and other abiotic stress signals, and lays a good molecular foundation for effectively improving the salt and drought resistance of plants, and has great value for exploring the signal regulation network of plants under stress. BRIEF DESCRIPTION OF DRAWINGS

[0072] Figure 1 It is an agarose gel electrophoresis map of the amplification product of the GhTOPP4 gene.

[0073] Figure 2 It is a structural schematic diagram of 35S::GhTOPP4-GFP recombinant vector and a subcellular localization map of GhTOPP4.

[0074] Among them, A is a structural schematic diagram of 35S::GhTOPP4-GFP recombinant vector; B is a subcellular localization map of GhTOPP4.

[0075] Figure 3 It is a structural schematic diagram of GST-GhTOPP4 recombinant vector, a Coomassie brilliant blue staining gel map of GST-GhTOPP4 recombinant protein and a GhTOPP4 phosphatase activity detection. Among them, A is a structural schematic diagram of GST-GhTOPP4 recombinant vector; B is a Coomassie brilliant blue staining gel map of GST-GhTOPP4 recombinant protein; C is a GhTOPP4 phosphatase activity detection.

[0076] Figure 4 It is the construction of VIGS-GhTOPP4 silenced plant and its stress resistance analysis. Among them, A is an agarose gel electrophoresis map of the amplification product of the VIGS silenced fragment (1-367 nucleotides) of the GhTOPP4 gene; B is the identification of the silencing efficiency of the cotton GhTOPP4 gene; C is the salt stress phenotype of the VIGS-GhTOPP4 silenced plant; D is the drought stress phenotype of the VIGS-GhTOPP4 silenced plant; E is the water loss rate of the detached plant of the VIGS-GhTOPP4 silenced plant.

[0077] Figure 5 To express the amount of cotton GhTOPP4 gene under abiotic stress conditions.

[0078] Figure 6 To construct and analyze the resistance of GhTOPP4 overexpression transgenic Arabidopsis lines. A is the schematic diagram of 35S:GhTOPP4-HA recombinant vector structure; B is the Western Blot identification of GhTOPP4 overexpression transgenic Arabidopsis lines; C is the germination of GhTOPP4 overexpression transgenic Arabidopsis homozygous lines OE1, OE2 and OE3 under different stress conditions; D is the statistical results of cotyledon greening rate of GhTOPP4 overexpression transgenic Arabidopsis homozygous lines OE1, OE2 and OE3 under different stress conditions; E is the root length growth of GhTOPP4 overexpression transgenic Arabidopsis homozygous lines OE1, OE2 and OE3 under ABA stress conditions; F is the statistical results of root length of GhTOPP4 overexpression transgenic Arabidopsis homozygous lines OE1, OE2 and OE3 under ABA stress conditions. DETAILED DESCRIPTION

[0079] The application will be further described in details in combination with specific embodiments. The examples given are only for illustrating the application, but not for limiting the scope of the application. The examples provided below can be used as a guide for further improvement by those skilled in the art, and do not constitute any limitation on the application.

[0080] In the following examples, the experimental methods are conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels, unless otherwise specified.

[0081] Example 1, discovery and cloning of GhTOPP4 protein and its encoding gene

[0082] I. Discovery of GhTOPP4 protein and its encoding gene

[0083] The application obtains a new protein from a cotton variety "Guoxin No.3" (the variety is recorded in the document "Guoxin No.3 insect-resistant cotton cultivation technology, Feng Sulin, Hebei Agriculture, 2011, 06") through screening of a VIGS cDNA library salt-related gene (research on cotton stress-resistant gene function by using VIGS technology, Li Fangjun, China Agricultural University, 2014) and database retrieval, and names the protein as GhTOPP4 protein, the amino acid sequence of the GhTOPP4 protein is shown as sequence 1, and the GhTOPP4 protein is composed of 316 amino acid residues; the gene encoding the GhTOPP4 protein is named as GhTOPP4 gene, and the open reading frame of the GhTOPP4 gene is shown as SEQ ID No.2, and the GhTOPP4 gene is composed of 951 nucleotides.

[0084] II. Cloning of the GhTOPP4 gene

[0085] 1. RNA extraction

[0086] The cotton (Guoxin No.3) leaf and root RNA is extracted by using an Aidley kit (the kit is purchased from Beijing Jiukangyuan Biotechnology Co., Ltd.), and the extraction method is operated according to the kit instruction.

[0087] 2. cDNA acquisition

[0088] The first strand cDNA is synthesized by using an M-MLV reverse transcription kit (purchased from Promega Company), and the obtained first strand cDNA is used as a template for amplifying the full-length of the GhTOPP4 gene.

[0089] 3. PCR amplification

[0090] According to the sequence of the GhTOPP4 gene, two specific primers (an upstream primer F1: ATGGCGGCTGCGACGGCGC and a downstream primer R1: TTACATTTTAGTGGGCATGA) are designed for PCR amplification, and a PCR product is obtained.

[0091] The PCR reaction system (20 μL) is as follows: template 10x Buffer 2 μL, 10 mmol / L dNTPs 2 μL, MgSO4 1.4 μL, cDNA 1.2 μL, KOD-Plus enzyme 0.4 μL, upstream primer (10 μM) 0.3 μL, downstream primer (10 μM) 0.3 μL, and ddH2O 12.4 μL.

[0092] The PCR amplification program is as follows: 94℃, 2min; 30 cycles of 94℃, 15s; 56℃, 30s; 68℃, 3min; and finally 68℃, 10min.

[0093] 4. Sequencing of the PCR product

[0094] 1) PCR product was electrophoresed on 1% agarose gel. Figure 1 ) After electrophoresis, the target band was cut off under UV light, recovered, purified, and the purified fragment was obtained.

[0095] 2) The purified fragment was end-A, and the A-added fragment was obtained. The 10 μL reaction system was as follows: 1 μL of 10x Buffer, 1 μL of dATP, 0.5 μL of Taq enzyme, 7.5 μL of purified fragment, and 72°C reaction for half an hour.

[0096] 3) The A-added fragment was connected with PMD18-T vector (purchased from TaKaRa company), and the connection method was operated according to the instruction manual, and the connection product was obtained. The 10 μL reaction system was as follows: 4.5 μL of A-added fragment, 0.5 μL of PMD18-T, 5 μL of Solution I, and 16°C connection overnight.

[0097] 4) 5 μL of the connection product was taken, and the heat shock method (referring to J. Sambrook, et al., Huang Peitang et al., Molecular Cloning Experiment Guide (third edition), Science Press, 2002 edition) was used to transform E. coli DH5α, and the positive clones were screened on the LB solid plate containing 50 mg / L ampicillin, and 5 clones were picked for sequencing and sent to Shanghai Invitrogen Company for sequencing, and the full-length cDNA of the required gene was obtained, that is, the GhTOPP4 gene was obtained. The sequencing result shows that the full-length cDNA sequence of the gene is 951 bp, the nucleotide sequence is as shown in SEQ ID No. 2, and the SEQ ID No. 1 shown GhTOPP4 protein composed of 316 amino acid residues is encoded.

[0098] Example 2, GhTOPP4 protein property analysis

[0099] I. GhTOPP4 subcellular localization

[0100] The present application uses protoplast to study the subcellular localization of GhTOPP4 protein. The specific steps are as follows:

[0101] 1. Construction of 35S::GhTOPP4-GFP recombinant vector

[0102] The forward primer and the reverse primer for amplifying the entire coding region of the GhTOPP4 gene were designed according to the multiple cloning site of the expression vector pHBT-GFP (the vector was obtained from the laboratory of Libo Shan of Texas A&M University, and is described in the literature “The Cotton Wall-Associated Kinase GhWAK7A Mediates Responses to Fungal Wilt Pathogens by Complexing with the Chitin Sensory Receptors. Ping Wang et. al., The Plant Cell, 2020”) and the coding region sequence of the GhTOPP4 gene, and a 35S::GhTOPP4-GFP recombinant vector was obtained. The specific steps are as follows:

[0103] 1) The GhTOPP4 gene obtained in Example 1 was used as a template, and the upstream primer F2 and the downstream primer R2 were used for PCR amplification to obtain a product containing the GhTOPP4 gene. The primer sequences are as follows:

[0104] Upstream primer F2: 5'-CG GGATCC ATGGCGGCTGCGACGGCGC-3' (the underlined part is the enzyme cutting site of BamHI);

[0105] Downstream primer R3: 5'-A AGGCCT CATTTTAGTGGGCATGAACT-3' (the underlined part is the enzyme cutting site of StuI).

[0106] 2) The product containing the GhTOPP4 gene and the expression vector pHBT-GFP were respectively digested by BamHI and StuI to obtain the enzyme cutting product and the vector framework, respectively.

[0107] 3) The enzyme cutting product and the vector framework were connected to obtain a 35S::GhTOPP4-GFP recombinant vector (the structure is shown in Figure 2 A).

[0108] The 35S::GhTOPP4-GFP recombinant vector is a recombinant vector obtained by replacing the DNA fragment between the BamHI and StuI enzyme cutting sites of the expression vector pHBT-GFP with the GhTOPP4 gene of sequence 2, and keeping other sequences of pHBT-GFP unchanged.

[0109] 2. Arabidopsis protoplast isolation and transformation

[0110] 1) The following solution was prepared:

[0111] Enzyme solution (10 mL): 1% Cellulase R10, 0.2% Macerozyme R10, 0.4 M mannitol, 20 mM KCl, 20 mM MES (pH 5.7), 10 mM CaCl2.

[0112] WI solution: 20 mM KCl, 0.5 M mannitol, 4 mM MES (pH 5.7).

[0113] W5 solution: 125 mM CaCl2, 154 mM NaCl, 5 mM KCl, 2 mM MES (pH 5.7).

[0114] MMg solution: 0.4 M mannitol, 15 mM MgCl2, 4 mM MES (pH 5.7).

[0115] 40% (w / v) PEG transformation solution: 0.2 M mannitol, 100 mM CaCl2, 4 g PEG 4000.

[0116] Cellulase R10 and Macerozyme R10 involved in the above solutions were purchased from Onozuka, and other reagents were purchased from Sigma-Aldrich.

[0117] 2) The four-week-old Arabidopsis thaliana tender rosette leaves were cut into strips with a width of about 1 mm and a length of about 1 cm with a blade, and the cut strips were quickly transferred and immersed in the enzyme solution. The enzyme solution was vacuumed for 30 min in the dark and enzymolyzed for 2-3 h in the dark. Then an equal volume of W5 solution was added, and the enzyme solution was filtered with a 200-mesh nylon membrane to remove the un-enzymolyzed residues. The filtrate was the Arabidopsis protoplasts. The protoplasts were centrifuged at 90 g for 2 min, and the supernatant was discarded. The protoplasts were resuspended with W5 solution and centrifuged at 90 g for 2 min, and the supernatant was discarded. The protoplasts were resuspended with W5 solution and placed on ice for 30 min. The W5 solution was aspirated and the protoplasts were resuspended with MMg solution, and the final concentration of the protoplasts was adjusted to 2 x 10 5 cells / mL for transformation.

[0118] 3) Take 100 μL of protoplasts in a 2 mL round-bottom centrifuge tube, and add 5 μL of 35S::GhTOPP4-GFP recombinant plasmid and 5 μL of NLS-RFP marker plasmid with red fluorescent protein RFP (the plasmid is obtained from the laboratory of Libo Shan of Texas A&M University, and is recorded in the literature "Noncanonical mono(ADP-ribosyl)ation of zinc finger SZF proteins counteracts ubiquitination for protein homeostasis in plant immunity. Liang Kong et al., Molecular Cell, 2021"), and mix by flicking. Then add 110 μL of 40% PEG solution to the centrifuge tube, quickly flick the centrifuge tube to mix, and stand at room temperature for 5 min. Add 800 μL of W5 solution to the centrifuge tube to terminate the reaction. 90g centrifugation for 2 min, discard the supernatant, resuspend the protoplasts with WI solution. Finally, transfer the protoplasts to the culture plate, culture at room temperature under weak light for 10-12 h, then 90g centrifugation for 2 min, aspirate the WI solution, and add 110 μL of WI solution, mix by flicking.

[0119] 4) A small amount of protoplasts is taken with a gun head with the tip cut off and added dropwise on a glass slide, and the expression of GFP and RFP is observed under a laser confocal microscope.

[0120] The results show that the GFP green fluorescent signal is observed in the cytoplasm of the protoplast, the GFP green fluorescent signal is observed in the nucleus of the protoplast, and the GFP green fluorescent signal overlaps with the RFP red fluorescent signal observed in the nucleus, and GhTOPP4 is located in the cytoplasm and the nucleus (as shown in B). Figure 2

[0121] II. Induced expression and purification of GhTOPP4 protein

[0122] 1. Construction of recombinant expression vector

[0123] ​The GhTOPP4 gene obtained in Example 1 was used as a template, and PCR amplification was performed using the upstream primer F2 and the downstream primer R2 to obtain a product containing the GhTOPP4 gene. The product containing the GhTOPP4 gene and the vector pGEX4T-1 (obtained from the laboratory of Libo Shan at Texas A&M University and described in the literature "The Cotton Wall-Associated Kinase GhWAK7A Mediates Responses to Fungal Wilt Pathogens by Complexing with the Chitin Sensory Receptors. Ping Wang et. al., The Plant Cell, 2020") were digested with BamH I and Stu I, respectively, and the digested products were recovered to obtain a gene fragment and a linear vector. The gene fragment and the linear vector were ligated to obtain a GST-GhTOPP4 recombinant plasmid (the structure of the GST-GhTOPP4 recombinant plasmid is shown in FIG. 1). Figure 3 A.

[0124] The GST-GhTOPP4 recombinant plasmid is a plasmid obtained by replacing the DNA fragment between the BamH I and Stu I enzyme digestion sites of the vector pGEX4T-1 with the GhTOPP4 gene of SEQ ID No. 2, while keeping the other sequences of the vector pGEX4T-1 unchanged. The GST-GhTOPP4 recombinant plasmid expresses a GST-GhTOPP4 recombinant protein.

[0125] 2. Induced expression of GhTOPP4 protein

[0126] The GST-GhTOPP4 recombinant plasmid was transformed into Escherichia coli BL21 (purchased from Beijing Zixingjin Biotechnology Co., Ltd.) by heat shock transformation, and after overnight culture at 37°C, a positive single colony was picked and inoculated into 5 mL of LB liquid medium containing antibiotics, and incubated overnight at 37°C at 180 rpm. Then, the bacterial solution was inoculated into 500 mL of LB liquid medium containing antibiotics, and incubated at 37°C at 180 rpm for about 3 h until the OD600 value was between 0.6 and 1.0. Then, the bacterial solution was transferred to a 16°C shaking bed, and after about 15 min of cooling, IPTG was added to a final concentration of 0.25 mM, and the bacterial solution was induced overnight at 16°C at 160 rpm. 600nm

[0127] 3. Purification of GhTOPP4 protein

[0128] ​1) Collect bacteria liquid at 4℃, 4000rpm centrifugal 20min, discard supernatant, collect bacteria, add protein lysis buffer (10mM NaH2PO4, 1.8mM K2HPO4, 2.7mM KCl, 140mM NaCl) 30mL, resuspend bacteria, add lysozyme with final concentration of 300μg / mL, mix and ice bath for 15min, get lysed bacteria liquid.

[0129] 2) Transfer lysed bacteria liquid to glass beaker, place beaker in ice box for easy heat conduction during ultrasonic crushing, set ultrasonic crushing instrument program: 300W, 10min, interval 3s ultrasonic 3s (adjust ultrasonic crushing time according to whether the lysed bacteria liquid becomes clear), get ultrasonic crushed bacteria liquid.

[0130] 3) Transfer ultrasonic crushed bacteria liquid to 50mL centrifugal tube, 4℃, 12000rpm centrifugal 20min, collect supernatant and transfer supernatant to clean 50mL BD tube, first add 100μL GST-beads equilibrated with protein lysis buffer, then add Triton X-100 with final concentration of 0.5%, mix and place in 4℃ rotary incubator for 2-3h.

[0131] 4) After incubation, 500g centrifugal 5min, discard supernatant, wash beads with PBS buffer for 3 times. Centrifugal collect beads and transfer to clean 1.5mL EP tube, add appropriate amount of elution buffer (50mM Tris-HCl pH8.0, 150mM NaCl, 10mM reduced glutathione), centrifugal after room temperature 10-15min or 4℃ elution for 2-3h, collect supernatant, get purified protein solution, and transfer to clean 1.5mL EP tube. Take 2μL supernatant for protein electrophoresis and Coomassie brilliant blue staining (GST-GhTOPP4 protein Coomassie brilliant blue staining diagram is shown in FIG. B), the rest of the purified protein is mixed with glycerol with final concentration of 10%, then aliquot to centrifugal tube and store at -80℃. Figure 3 B).

[0132] III. GhTOPP4 protein phosphatase activity identification

[0133] GhTOPP4 protein phosphatase activity was determined by using p-nitrophenyl phosphate (pNPP) as substrate. Proteins with phosphatase activity can rapidly hydrolyze pNPP to p-nitrophenol, which is a chromogenic product with absorbance at 405nm. The specific steps are as follows:

[0134] Prepare pNPP reaction buffer (50 mM Tris-HCl pH 7.0, 2 mM DTT, 1 mM pNPP), add 5 μg of GST-GhTOPP4 recombinant protein (GST-TOPP4 group) or GST empty protein control (GST group) to the reaction buffer, the reaction system is 100 μL, mix well and incubate at room temperature, add NaOH to terminate the reaction according to the time point, measure and record the absorbance value of the reaction solution at 405 nm by ultraviolet-visible spectrophotometer.

[0135] The results show that in the reaction system added with GST-GhTOPP4 recombinant protein, the absorbance value increases with the increase of reaction time, and the hydrolysis of pNPP increases in proportion, while in the reaction system added with GST empty protein, the absorbance value does not increase with the increase of reaction time. It is proved that GhTOPP4 protein has protein phosphatase activity. Figure 3 C).

[0136] Example 3, construction of VIGS-GhTOPP4 silenced plants and analysis of their stress tolerance

[0137] I. Construction of VIGS-GhTOPP4 silencing vector

[0138] 1. Extract total RNA from the leaves of cotton variety "Guoxin No. 3" and reverse transcribe it into cDNA.

[0139] 2. Use the cDNA obtained in step 1 as a template, and use the primer pair composed of upstream primer F3 and downstream primer R3 to perform PCR amplification, to obtain a PCR amplification product Figure 4 A). This PCR amplification product is the VIGS silencing fragment of GhTOPP4 gene, which is the 1-367th nucleotide of GhTOPP4 gene.

[0140] Upstream primer F3: 5'-G GAATTC ATGGCGGCTGCGACGGCGC-3' (underlined is the EcoRI enzyme cutting site);

[0141] Downstream primer R3: 5'-GG GGTACC AGTTCTCTGGGTACTTAAT-3' (underlined is the Kpnl enzyme cutting site).

[0142] 3. Double enzyme cut the PCR amplification product obtained in step 2 with restriction endonuclease EcoRI and Kpnl, and recover the enzyme cutting product.

[0143] 4, recover the vector backbone by double digestion of the vector pYL156 (pTRV2: RNA2) (the vector is described in the literature "Gao X, 2013, Functional genomic analysis of cotton genes with agrobacterium-mediated virus-induced gene silencing.") with restriction enzymes EcoRI and Kpnl.

[0144] 5, ligate the digestion product obtained in step 3 and the vector backbone obtained in step 4 to obtain the recombinant plasmid pYL156-GhTOPP4.

[0145] Sequencing verification was performed on the recombinant plasmid pYL156-GhTOPP4, and the results showed that the recombinant plasmid pYL156-GhTOPP4 was a vector obtained by replacing the DNA fragment between the EcoRI and Kpnl enzyme digestion sites of the vector pYL156 with the partial GhTOPP4 gene fragment shown in sequence 2 from position 1 to position 367, and keeping other sequences of the vector pYL156 unchanged.

[0146] II. Obtaining of VIGS-GhTOPP4 silenced plants

[0147] 1, the recombinant plasmids pYL156-GhTOPP4, pYL156-GFP, pTRV-RNA1 and pYL156-GhCLA1 (pYL156-GFP, pTRV1 (pTRV-RNA1) and pYL156-GhCLA1 are all described in the literature "Gao X, 2013, Functional genomic analysis of cotton genes with agrobacterium-mediated virus-induced gene silencing.") constructed in step one were respectively electroporated into Agrobacterium GV3101 (purchased from Beijing Zison Biotechnology Co., Ltd.) to obtain recombinant bacteria pYL156-GhTOPP4 / GV3101, recombinant bacteria pYL156-GFP / GV3101, recombinant bacteria pTRV1 / GV3101 and recombinant bacteria pYL156-GhCLA1 / GV3101, respectively. Cultured at 28°C in LB liquid medium (containing 50 μg / mL kanamycin, 25 μg / mL gentamicin, 10 mM MES pH 5.6-5.7, 20 μM acetosyringone), and the bacterial bodies were collected after 12-14 h of culture, respectively.

[0148] 2. Resuspend the bacterial cells with VIGS solution (10 mM MES pH 5.6, 10 mM MgCl2, 200 μM acetosyringone, solvent is water) and adjust the concentration of the bacterial solution to OD 600nm = 1.5, then the recombinant bacteria pYL156-GhTOPP4 / GV3101 bacterial solution, pYL156-GFP / GV3101 bacterial solution and pYL156-GhCLA1 / GV3101 bacterial solution were mixed with the recombinant bacteria pTRV1 / GV3101 bacterial solution in a ratio of 1:1 to obtain mixed solution 1, mixed solution 2 and mixed solution 3.

[0149] 3. Fill the lower surface of different cotton "Guoxin 3" cotyledons with mixed solution 1 using a 1 mL needleless syringe to obtain VIGS-GhTOPP4 silenced plants (VIGS-TOPP4).

[0150] Fill the lower surface of different cotton "Guoxin 3" cotyledons with mixed solution 2 using a 1 mL needleless syringe to obtain VIGS-GFP control plants (VIGS-Ctrl).

[0151] Fill the lower surface of different cotton "Guoxin 3" cotyledons with mixed solution 3 using a 1 mL needleless syringe to obtain VIGS-GhCLA1 indicator plants.

[0152] 4. Approximately two weeks after the plants injected with mixture 3 exhibited the albino phenotype, RNA was extracted from the leaves of plants injected with mixture 1 and mixture 2 (using the Adley kit to extract cotton RNA, following the kit instructions). cDNA was then obtained through reverse transcription (using the M-MLV reverse transcription kit, purchased from Promega, following the kit instructions). Using the obtained cDNA as a template, gene silencing efficiency was analyzed by real-time quantitative PCR (analysis method referred to the literature "Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCT Method. Kenneth J. Livak et al., Methods, 2001"). The primer pairs used for real-time quantitative PCR were 5'-TGTGGAGGATGGTTACGAA-3' and 5'-CTCTGCTGGCTTGAGAATC-3'. The PCR program was as follows: 94℃ denaturation for 30s; 94℃ denaturation for 5s, 60℃ annealing for 35s, 40 cycles. Using the cotton GhActin 9 gene as a control (the primer pairs used to identify the cotton GhActin 9 gene were: 5'-GCCTTGGACTATGAGCAGGA-3' and 5'-AAGAGATGGCTGGAAGAGGA-3'), the relative expression level was measured using a 2-1 ratio. -ΔΔCt Method calculation.

[0153] The results showed that the GhTOPP4 gene expression level in plants injected with mixture 1 (containing pYL156-GhTOPP4 / GV3101 and pTRV1 / GV3101 bacterial suspensions) was significantly lower than that in plants injected with mixture 2 (containing pYL156-GFP / GV3101 and pTRV1 / GV3101 bacterial suspensions). Figure 4 B). Using the above method, VIGS-GhTOPP4 gene-silenced plants (plants injected with mixture 1) and VIGS-GFP control plants (plants injected with mixture 2) were obtained. The GhTOPP4 gene silencing efficiency in the VIGS-GhTOPP4 silenced plants was 75%.

[0154] III. Salt tolerance phenotypes in VIGS-GhTOPP4 silent plants

[0155] The VIGS-GhTOPP4 silenced plants (TOPP4), VIGS-GFP control plants (Ctrl) and wild type plants ("Guoxin No. 3") obtained in step two were subjected to NaCl stress treatment. The specific steps are as follows: under hydroponics conditions, when growing to the two-leaf stage, 200 mM NaCl was added to the modified Hoagland nutrient solution (macroelement components: 20 μM H3BO3, 1 μM ZnSO4·7H2O, 0.1 μM CuSO4·5H2O, 1 μM MnSO4·H2O, 5 nM (NH4)6Mo7O 24 24H2O, 0.5 mM NH4H2PO4, 1 mM MgSO4·7H2O, 2.5 mM KNO3) to a final concentration of 200 mM and fully dissolved, and the plant phenotypes were observed after 10 days of treatment, with no NaCl treatment as a control group.

[0156] The results show that, in the experimental group subjected to 200 mM NaCl stress treatment, compared with the VIGS-GFP control plants, the VIGS-GhTOPP4 silenced plants have smaller growth inhibition, more leaf numbers, and milder salt damage characteristics such as wilting and curling at the leaf edge, and are more resistant to salt stress. In the control group without NaCl treatment, there is no difference in growth characteristics between the VIGS-GhTOPP4 silenced plants and the VIGS-GFP control plants Figure 4 C) The phenotype of the wild type plants ("Guoxin No. 3") has no significant difference from that of the VIGS-GFP control plants.

[0157] Four, drought-resistant phenotype of VIGS-GhTOPP4 silenced plants

[0158] 1. The VIGS-GhTOPP4 silenced plants (GhTOPP4), VIGS-GFP control plants (Ctrl) and wild type plants ("Guoxin No. 3") obtained in step two were subjected to drought stress treatment. The specific steps are as follows: under soil culture conditions, when growing to the two-leaf stage, watering was stopped, and the plant phenotypes were observed and the water loss rate was calculated. Normal watering culture was used as a control group.

[0159] The results show that, after one week of drought treatment, the cotton plants showed phenotypes such as growth inhibition and leaf wilting. Among them, compared with the VIGS-GhTOPP4 silenced plants, the VIGS-GFP control plants showed leaf wilting phenotype earlier and the wilting degree was more obvious Figure 4 D) The phenotype of the wild type plants ("Guoxin No. 3") has no significant difference from that of the VIGS-GFP control plants.

[0160] 2. The VIGS-GhTOPP4 silenced plants (GhTOPP4), VIGS-GFP control plants (Ctrl) and wild type plants ("Guoxin No. 3") obtained in step 2 were subjected to in vitro drought treatment. The specific steps are as follows: the aboveground parts of the plants were taken and placed under the temperature and light conditions under which the cotton plants normally grow, and the fresh weight of the plants was weighed at different time points to detect the change in water loss rate.

[0161] The results show that the water loss rate of the VIGS-GhTOPP4 silenced plants is slower than that of the VIGS-GFP control plants Figure 4 E). The water loss rate of the wild type plants ("Guoxin No. 3") is not significantly different from that of the VIGS-GFP control plants.

[0162] V. Changes in the expression level of GhTOPP4 gene under abiotic stress conditions

[0163] Cotton plants ("Guoxin No. 3") grown under normal growth conditions to the three-leaf stage were divided into three groups, each group of 10 plants, and treated with 150 mM NaCl and 5% PEG, respectively. The RNA of the leaf parts at different time points (0 h, 6 h, 12 h, 24 h, 48 h) was extracted and reverse transcribed into cDNA, and the expression level of GhTOPP4 gene was detected by fluorescent real-time quantitative PCR. The primer pair used for fluorescent real-time quantitative PCR was 5'-TGTGGAGGATGGTTACGAA-3' and 5'-CTCTGCTGGCTTGAGAATC-3', and the PCR program was as follows: denaturation at 94°C for 30 s; denaturation at 94°C for 5 s, annealing at 60°C for 35 s, 40 cycles. The cotton Actin9 gene was used as a control (the primer pair used to identify the cotton Actin9 gene was: 5'-GCCTTGGACTATGAGCAGGA-3' and 5'-AAGAGATGGCTGGAAGAGGA-3'), and the relative expression level was calculated by 2 -ΔΔCt Method.

[0164] The results show that each stress condition (150 mM NaCl, 5% PEG treatment) can induce the up-regulation of the expression of GhTOPP4 Figure 5

[0165] ​Based on the above test results, the expression of GhTOPP4 gene in cotton was significantly reduced by using VIGS gene silencing technology, and VIGS-GhTOPP4 silenced plants were obtained, with a GhTOPP4 gene silencing efficiency of 75%. In the salt stress treatment test, compared with the VIGS-GFP control plants, the growth of the VIGS-GhTOPP4 silenced plants was less inhibited, and the salt injury characteristics such as wilting and salt spots were lighter, and they were more resistant to salt stress; in the drought stress treatment test, compared with the VIGS-GFP control plants, the VIGS-GhTOPP4 silenced plants were more resistant, and the in vitro plant water loss rate was slower than the control; and the expression of GhTOPP4 could be induced by NaCl or PEG stress treatment, indicating that GhTOPP4 gene played a negative regulatory role in cotton under abiotic stress such as salt stress and drought stress.

[0166] Example 4, Construction of GhTOPP4 Overexpression Plants and Analysis of Their Stress Tolerance

[0167] I. Construction of GhTOPP4 Overexpression Plants

[0168] 1. The 35S::GhTOPP4-GFP recombinant vector obtained in step four of Example 1 and the pMDC32-HA vector (the vector is obtained from the laboratory of Libo Shan, Texas A&M University, and is described in the literature "A trimeric CrRLK1L-LLG1 complex genetically modulates SUMM2-mediated autoimmunity. Yanyan Huang et al., Nature Communication, 2020") were subjected to enzyme digestion, respectively, using BamHI and StuI as the restriction enzymes, and the enzyme digestion products were recovered to obtain the GhTOPP4 fragment and the linearized pMDC32-HA vector. Then, T4 ligase was used for ligation to obtain the 35S::GhTOPP4-HA recombinant vector (the structure of the recombinant vector is shown in Figure 6 A). The 35S::GhTOPP4-HA recombinant vector was introduced into the Agrobacterium strain GV3101 to obtain the recombinant Agrobacterium 35S::GhTOPP4-HA / GV3101.

[0169] 2. The recombinant Agrobacterium 35S::GhTOPP4-HA / GV3101 obtained in step 1 was cultured at 28°C in LB liquid medium containing 50 μg / mL kanamycin and 25 μg / mL gentamicin for 24 h, and then centrifuged at 4000 rpm for 10 min to collect the recombinant Agrobacterium bacteria. Resuspend with resuspension solution (resuspension solution: 50 mM MES pH 5.6, 5% sucrose) and adjust the concentration of the resuspended bacteria to OD600=0.2. Then, the recombinant Agrobacterium 35S::GhTOPP4-HA / GV3101 was used to infect cotton seedlings, and the cotton seedlings were cultured in the dark for 3 days. 600nm= 0.8, then add silwet L-77 to make its final concentration 500 μl / L. Then dip the Arabidopsis Col-0 unopened inflorescence in the bacterial suspension, and wrap the Arabidopsis with black plastic bag to keep humidity, place horizontally, and cultivate in dark at 20°C for 24 hours. Then remove the plastic bag, restore light, cultivate the plants according to the normal method to seed setting, and harvest the mature T0 generation seeds.

[0170] 3. Use 1 / 2MS medium containing 50 mg / L hygromycin to cultivate the T0 generation seeds and select the positive plants (the positive plants are characterized by that the true leaves are healthy and dark green, and the roots grow into the medium).

[0171] 4. Self-cross the positive plants obtained in step 3 to obtain T1 generation seeds.

[0172] 5. Use 1 / 2MS medium containing 25 mg / L hygromycin to cultivate the T1 generation seeds and select the positive plants (the selection standard is that the ratio of the positive plants is greater than 3:1).

[0173] 6. Self-cross the positive plants obtained in step 5 to obtain T2 generation seeds.

[0174] 7. Use 1 / 2MS medium containing 25 mg / L hygromycin to cultivate the T2 generation seeds and select the positive plants (the selection standard is that all the plants in the strain are positive plants).

[0175] 8. Self-cross the positive plants obtained in step 7 to obtain T3 generation seeds. Cultivate the T3 generation seeds to obtain T3 generation Arabidopsis plants overexpressing GhTOPP4.

[0176] 9. Extract total protein from the T3 generation Arabidopsis plants overexpressing GhTOPP4, and perform molecular identification by Western Blot (B) to obtain GhTOPP4 overexpression transgenic homozygous strain. The specific steps are as follows: Figure 6 B), obtain GhTOPP4 overexpression transgenic homozygous strain. The specific steps are as follows:

[0177] 1) Take leaf samples with a puncher when the plants grow to the fourth week, grind the leaf tissue in liquid nitrogen, add SDS plant total protein extraction solution (250 mM Tris-HCl pH 6.8, 4% SDS, 40% glycerol, 0.1% bromophenol blue, 4% β-mercaptoethanol), mix well, denature at 95°C for 10 minutes, centrifuge to obtain the supernatant as the denatured total protein for SDS-PAGE detection.

[0178] 2) Use 10% SDS-PAGE gel electrophoresis device, pour the electrophoresis solution, add protein samples and pre-stained marker, and set the voltage to 90-120 V for constant voltage electrophoresis separation (SDS-PAGE gel is purchased from BIO-RAD, and the instrument is from Bio-Rad Mini-PROTEAN RTetra System, precast marker purchased from Thermo Fisher, 10x Tris-Glycine running buffer: 30.3 g / L Tris base, 144 g / L glycine, 10 g / L SDS, dilute to 1x with distilled water before use), stop electrophoresis when the dye front is 1-2 cm from the bottom of the gel.

[0179] 3) Remove SDS-PAGE gel and soak in transfer buffer (2.9 g / L glycine, 5.8 g / L Tris base, 0.37 g / L SDS, 20% methanol) for 10 min, cut the PVDF membrane to the appropriate size, wet in methanol for 10-15 s, then equilibrate in transfer buffer for 20-30 min, wet the filter paper in transfer buffer as well, place the filter paper, PVDF membrane, SDS-PAGE gel, and filter paper in the order of anode to cathode on the transfer instrument (BIO-RAD TRANS-BLOT SD SEMI-DRY TRANSFER CELL) for 1 h at a constant current of 60 mA.

[0180] 4) After the transfer is complete, place the PVDF membrane in a 2% (m / v) BSA or 3-5% skim milk powder solution in TBST (10x TBS solution: 80 g / L NaCl, 30 g / L Tris-base, 2 g / L KCL, adjust pH to 7.5, dilute to 1x with distilled water before use, and add Tween 20 at a ratio of 1:500-1:1000, which is the TBST solution) for 1-2 h.

[0181] 5) Add the antibody anti-HA (purchased from Sigma-Aldrich) to the blocking solution at a ratio of 1:1500, incubate overnight at 4°C, wash the membrane with TBST solution 3 times for 10 min each time, wash the membrane with TBS solution once, and then develop (developing solution BIO-RAD Clarity TM Western ECL Substrate, imaging system BIO-RAD ChemiDoc TM XRS+).

[0182] 6) After development, immerse the PVDF membrane in the ponceau staining solution (ponceau solution: 0.2% (w / v) ponceau, 3% (v / v) acetic acid), shake for 2-5 min or longer, remove, and rinse with distilled water 2-3 times, and record the results when clear bands appear.

[0183] Finally, select the GhTOPP4 overexpression transgenic homozygous lines OE1, OE2, and OE3 for stress tolerance analysis.

[0184] II. Stress tolerance analysis of different GhTOPP4 overexpression transgenic lines

[0185] 1. The homozygous Arabidopsis thaliana GhTOPP4 overexpressing transgenic lines obtained in step one were subjected to abiotic stress treatment, and germination rate was analyzed 10 days after the stress treatment. The specific steps are as follows: Seeds of three independent homozygous GhTOPP4 overexpressing transgenic lines OE1, OE2, and OE3, and wild-type Arabidopsis thaliana (Col-0) were sown in normal 1 / 2 MS medium, 1 / 2 MS medium containing 100 mM NaCl, and 1 / 2 MS medium containing 0.5 μM ABA, respectively. After vernalization at 4℃ for 72 hours, they were moved to a 20℃ greenhouse and subjected to a light-dark cycle of 16 h light / 8 h dark with a light intensity of 60 μmol / m². 2 After culturing for 10 days at a humidity of 60%–70%, the germination rate was observed and the cotyledon greening rate was recorded.

[0186] The results showed that under 100 mM NaCl stress, the seed germination of the GhTOPP4 overexpressing homozygous transgenic lines OE1, OE2, and OE3 was worse than that of wild-type Arabidopsis thaliana Col-0, and the cotyledon greening rate of the transgenic lines was significantly lower than that of Col-0 Arabidopsis thaliana. Figure 6 C). This indicates that overexpression of GhTOPP4 protein in Arabidopsis weakens the plant's tolerance to NaCl stress and inhibits seed germination under salt stress. ABA promotes seed dormancy and inhibits germination. Under 0.5 μM ABA stress, the cotyledon greening rate of the GhTOPP4 overexpressing homozygous transgenic lines OE1, OE2, and OE3 was significantly higher than that of Col-0 Arabidopsis. Figure 6 D). This indicates that overexpression of GhTOPP4 protein in Arabidopsis thaliana makes the plant insensitive to ABA and increases the greening rate of cotyledons.

[0187] 2. The homozygous Arabidopsis thaliana GhTOPP4 overexpressing transgenic lines obtained in step one were subjected to ABA stress treatment, and root length growth was analyzed after ABA stress treatment. The specific steps are as follows: Seeds from three independent homozygous GhTOPP4 overexpressing transgenic lines OE1, OE2, and OE3, and wild-type Arabidopsis thaliana (Col-0), were vernalized at 4℃ for 72 hours and then vertically cultured on normal 1 / 2 MS medium under the following conditions: temperature 20℃, photoperiod 16h light / 8h dark, light intensity 60 μmol / m². 2 / s, humidity 60%~70%. On the 5th day of culture, the plants with uniform root length were transferred to 1 / 2MS medium containing 10 μM ABA for vertical culture, and the plants with uniform root length were transferred to 1 / 2MS medium for vertical culture as a control. On the 10th day of culture, the root length of the plants was counted.

[0188] The results show that there is no significant difference in root length between the GhTOPP4 overexpression transgenic homozygous lines and Col-0 Arabidopsis in 1 / 2MS medium, while in the medium containing ABA, the root length of the GhTOPP4 overexpression lines is better than that of Col-0 Arabidopsis ( Figure 6 E and Figure 6 F). The inhibition of ABA on the root growth of Arabidopsis is alleviated in the GhTOPP4 overexpression plants, and GhTOPP4 may be involved in the ABA signal pathway, thereby regulating the salt and drought stress of plants.

[0189] The above has been described in detail. For those skilled in the art, the present application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the purpose and scope of the present application, and without unnecessary experiments. Although the present application gives a special example, it should be understood that the present application can be further improved. In general, according to the principle of the present application, the present application is intended to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which deviates from the scope disclosed in the present application. Some basic features can be applied within the scope of the following attached claims.

Claims

1. Use of a protein or a biological material related to the protein in improving stress tolerance of a plant; the protein is a protein as shown in a) or b) below: a) a protein consisting of the amino acid sequence shown in SEQ ID No. 1 in the sequence listing; b) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 1 in the sequence listing; the biological material is any one of C1) to C10) below: C1) a nucleic acid molecule encoding the protein of a) or b); C2) an expression cassette containing the nucleic acid molecule of C1); C3) a recombinant vector containing the nucleic acid molecule of C1), or a recombinant vector containing the expression cassette of C2); C4) a recombinant microorganism containing the nucleic acid molecule of C1), or a recombinant microorganism containing the expression cassette of C2), or a recombinant microorganism containing the recombinant vector of C3); C5) a transgenic plant cell line containing the nucleic acid molecule of C1), or a transgenic plant cell line containing the expression cassette of C2), or a transgenic plant cell line containing the recombinant vector of C3); C6) a transgenic plant tissue containing the nucleic acid molecule of C1), or a transgenic plant tissue containing the expression cassette of C2), or a transgenic plant tissue containing the recombinant vector of C3); C7) a transgenic plant organ containing the nucleic acid molecule of C1), or a transgenic plant organ containing the expression cassette of C2), or a transgenic plant organ containing the recombinant vector of C3); C8) a transgenic plant containing the nucleic acid molecule of C1), or a transgenic plant containing the expression cassette of C2), or a transgenic plant containing the recombinant vector of C3); C9) a tissue culture produced from regenerable cells of the transgenic plant of C8); C10) a protoplast produced from the tissue culture of C9); the stress tolerance is ABA stress resistance; the plant is Arabidopsis thaliana.

2. Use according to claim 1, characterized in that: the nucleic acid molecule of C1) is a DNA molecule whose coding sequence is shown in SEQ ID No.

2.

3. Use of a vector comprising a VIGS silencing fragment of GhTOPP4 gene and pTRV-RNA1 in improving stress tolerance of a plant or breeding a transgenic plant with improved stress tolerance, characterized in that: the amino acid sequence of the protein encoded by the GhTOPP4 gene is shown in SEQ ID No. 1 in the sequence listing; the stress tolerance is salt tolerance and / or drought tolerance; the plant is cotton.

4. A method for breeding a transgenic plant with improved stress tolerance, comprising the step of reducing the activity and / or content of the protein as claimed in claim 1 in a recipient plant to obtain a transgenic plant; the transgenic plant has higher stress tolerance than the recipient plant; the stress tolerance is salt tolerance and / or drought tolerance; and the plant is cotton.

5. The method of claim 4, wherein: The method for reducing the activity and / or content of the protein as claimed in claim 1 in a recipient plant is achieved by knocking out or inhibiting or silencing the gene encoding the protein as claimed in claim 1 in the recipient plant.

Images