Application of Tea Tree EXO Gene

Abstract

The present invention belongs to the field of biotechnology; specifically, it relates to the application of tea tree EXO gene in regulating tea leaf morphology, leaf angle and leaf droop. The present invention discloses a use of EXO gene: regulating the angle and leaf droop of plant leaves, and the nucleotide sequence of EXO gene is as described in SEQ ID NO: 1. The leaf angle of tea leaves obtained by silencing EXO gene becomes smaller, and the degree of leaf droop becomes lower. The present invention also provides an antisense inhibition treatment liquid for EXO gene.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and specifically relates to the application of tea tree EXO genes in regulating tea tree leaf morphology, namely leaf angle and leaf droop. Background Art

[0002] Tea is one of the three most important non-alcoholic beverages in the world. my country has rich tea germplasm resources, and the tea industry has a high output value and a large scale. In the past, tea harvesting basically relied on manual picking. Now, due to the reduction of labor force caused by the aging population, mechanical harvesting (machine harvesting) has gradually become a focus of the development of the tea industry. Tea trees with suitable machine harvesting traits have become the focus of the development of the tea industry. Leaf angle and leaf droop are the main factors affecting the completeness rate of machine-picked buds and leaves. Therefore, how to regulate the leaf angle and leaf droop of tea leaves has become the focus of machine-picked tea tree breeding.

[0003] Plant hormones are natural and harmless. Using plant hormone response genes to regulate the leaf angle and leaf droop of machine-picked tea leaves provides a possible technical route to improve the suitability of machine picking.

[0004] The EXO gene is one of the genes that respond to the plant hormone brassinosteroids (BR). Previous studies have only focused on the function of EXO in regulating cell proliferation in Arabidopsis, and the function of its tea tree homologous gene EXO (CSS0040385) has not been reported.

[0005] Currently known genes involved in simultaneously regulating the angle of plant leaves and leaf droop include the sage LRR receptor-like kinase gene DPY1. This gene belongs to a completely different gene family from the EXO gene and comes from completely different species. The nucleotide and amino acid sequences of the two are also completely different, so the two are not related. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide an application of EXO gene in regulating the leaf angle and leaf droop degree of tea leaves.

[0007] In order to solve the above technical problems, the present invention provides the use of EXO gene: regulating (positively regulating) tea leaf angle and leaf droop, and the nucleotide sequence of EXO gene is as described in SEQ ID NO:1.

[0008] The amino acid sequence of the protein encoded by the EXO gene is shown in SEQ ID NO:2.

[0009] As an improvement on the use of the EXO gene of the present invention: the leaves are tea plant leaves.

[0010] The EXO gene is used for antisense inhibition of tea leaves, and the development and drooping of tea leaves are inhibited by antisense inhibition.

[0011] That is, the leaf angle of the tea leaves obtained by EXO gene silencing becomes smaller and the degree of leaf drooping becomes lower. The antisense primers used for EXO gene silencing are as follows:

[0012] EXO antisense primer-1: 5'CCCGATCACCGGAGTTATGA3'

[0013] EXO antisense primer-2: 5'GGTACTTCATGTGGACGAAC3'

[0014] EXO antisense primer-3: 5'GGTCTGGTCAGTGTAGAGCT3'

[0015] EXO antisense primer-4: 5'TTGGCGTTGATAGGGAGAGG3'

[0016] EXO antisense primer-5: 5'ATCTGGTACGGCGAAGGGGT3'.

[0017] The present invention also provides an antisense inhibition treatment solution for the EXO gene, which is prepared by mixing equal amounts of the EXO antisense primer-1, EXO antisense primer-2, EXO antisense primer-3, EXO antisense primer-4, and EXO antisense primer-5 described above, and then adding distilled water for dilution. The concentration of each primer in the antisense inhibition treatment solution is 20±2uM.

[0018] The present invention constructs tea tree EXO gene antisense inhibitory gene silencing plants for the first time and conducts functional studies. By measuring the leaf angle and leaf curvature, it is found that the tea tree EXO gene plays a positive role in promoting the expansion and drooping of leaves. That is, the tea tree leaf angle tends to increase, and the leaves tend to be more curved and drooping. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to make the objectives, technical solutions and advantages of the present invention more clear, specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0020] Figure 1 is the expression level of EXO gene in tea leaves with antisense suppression of gene silencing;

[0021] Figure 2 The leaf angle and leaf droop curvature of the tea leaves after the EXO gene antisense inhibition gene silencing;

[0022] The left picture shows the leaf angle of tea leaves in different treatment groups, and the right picture shows the curvature of tea leaves in different treatment groups.

[0023] In the above figure:

[0024] Blank is the blank control group, 28nBL is the induced group, AS+28nBL is the antisense inhibition treatment group, and S+28nBL is the negative control group. Different letters represent significant differences among different groups (p<0.05). DETAILED DESCRIPTION

[0025] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0026] 1. Obtaining the full-length sequence of the tea tree EXO gene:

[0027] Primer Premier 6.0 was used to design whole gene amplification primers, and cDNA of one bud and one leaf of tea variety Longjing 43 planted in the Tea Research Institute of the Chinese Academy of Agricultural Sciences was used as a template (cDNA was extracted using conventional techniques, for example, see CN104561025A), specific primers EXO-F and EXO-R were designed, and KOD-plus-NEO high-fidelity enzyme PCR was used to amplify the EXO fragment.

[0028] Primer sequence: EXO-F: 5'-AATACTCTCCACCACCGAAACT-3'

[0029] EXO-R: 5'-TTACTGATCAAGGGCATTAGGG-3'

[0030] PCR amplification reaction system: 10xPCR Buffer 5ul, 2mM dNTP 5ul, 25mM MgSO4 3ul, KOD-plus-NEO1ul, ddH2O 32ul, cDNA1ul, upstream and downstream primers 1.5ul each, a total of 50ul. The PCR reaction program is: 94℃ pre-denaturation for 2 minutes; 98℃ denaturation for 10 seconds, 53℃ annealing for 30 seconds, 68℃ extension for 2 minutes, 35 cycles; finally 68℃ final extension for 5 minutes, the obtained PCR product was identified by 1% agarose gel electrophoresis, and then the amplified band was recovered and purified using the Axygen DNA gel kit, and the recovered product was constructed into the Peasy-Blunt-Zero vector, and the above recombinant plasmid was sent to Youkang Company for sequencing confirmation.

[0031] The nucleotide sequence of the obtained gene EXO is shown in SEQ ID No: 1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID No: 2.

[0032] 2. Design and synthesis of EXO gene antisense inhibitory primers and negative control sense primers

[0033] Soligo online design software was used to submit the obtained nucleotide sequence of SEQ ID No: 1. According to the calculation results, the length of the five regions in the nucleotide sequence of SEQ ID No: 1 was 20 bp oligonucleotides. The five regions (starting from the start codon) were 47-66 bp, 147-166 bp, 323-342 bp, 472-491 bp and 656-675 bp, respectively. In the five regions, an oligonucleotide chain with a lower oligonucleotide binding energy was selected. According to the oligonucleotide chain, a deoxynucleotide chain "EXO antisense primer-1 to 5" was designed as an antisense inhibitory primer. The base complementary chain of the antisense inhibitory primer was used as a negative control sense primer. The corresponding primer with an OD value of 200 was synthesized at Youkang Company. The specific primer sequences are shown in Table 1 (primers are all in the 5' to 3' direction).

[0034] Table 1. Nucleotide sequences of EXO gene antisense inhibitory primers and negative control sense primers

[0035]

[0036] 3. Construction and detection of EXO gene antisense inhibition materials:

[0037] The five EXO antisense primers described in Table 1 were mixed in equal amounts, and distilled water was added to dilute and prepare an antisense inhibition treatment solution containing 20uM of each primer concentration; the five EXO sense primers were mixed in equal amounts, and distilled water was added to dilute and prepare a negative control treatment solution containing 20uM of each sense primer concentration. The antisense inhibition treatment group and the negative control treatment group also need to add a working concentration of 5uM of brassinolide, a brassinolide analog, to ensure that the tea leaves are promoted to unfold and droop within a certain period of time (i.e., the time when the antisense inhibition takes effect). In this way, the antisense inhibition treatment group contains 20uM of antisense inhibition treatment solution and 5uM of 28-homobrassinolide, while the negative control group contains 20uM of negative control treatment solution and 5uM of 28-homobrassinolide. At the same time, a blank control group containing no hormones and primers but only distilled water, and an induction group containing 5uM of 28-homobrassinolide were set.

[0038] Pick one bud and one leaf of the tea variety Jianghua Kucha located in the National Germplasm Hangzhou Tea Nursery Base in the Tea Research Institute of the Chinese Academy of Agricultural Sciences to ensure that the picked one bud and one leaf are healthy buds and leaves grown from the new shoots of the year, and the size and growth state are consistent. The picked one bud and one leaf are randomly divided into the above-mentioned blank control group (Blank), induced group (28nBL), antisense inhibition treatment group (AS+28nBL) and negative control group (S+28nBL), with at least ten biological replicates in each group. Place in a light incubator, the culture conditions are about 25℃, 16h / 8h light / dark cycle. Replenish the treatment liquid of each group every day to avoid bud and leaf drought.

[0039] 4. Study on the antisense inhibition of the leaf angle and curvature of tea leaves by EXO gene

[0040] On the 5th day of treatment,

[0041] The buds and leaves were frozen in liquid nitrogen, ground in a ball mill, and RNA was extracted according to the Tiangen Polysaccharide Polyphenol RNA Kit method, and cDNA was extracted by reverse transcription. The expression of EXO genes in each group was determined using a fluorescent quantitative method. The results are shown in Figure 1 According to Figure 1 , it can be seen that antisense inhibition treatment will reduce the expression of EXO genes. The treatment of the negative control group has no effect on the expression of EXO genes.

[0042] The buds and leaves were photographed and the leaf angle and leaf curvature were counted using ImageJ. The leaf angle refers to the angle between the stem and the leaf, and the leaf curvature refers to the ratio of the distance between the proximal and distal ends of the leaf and the length of the midrib.

[0043] The results are as follows Figure 2 According to Figure 2 , it can be learned that: in the process of 28nBL inducing tea leaf expansion and leaf droop, antisense inhibition of silencing EXO gene expression will reduce the leaf angle of tea leaves, while there is no significant difference in leaf angle between the negative control group (S+28nBL) and the induced group (28nBL), indicating that EXO gene positively promotes the increase of tea leaf angle. Similarly, EXO gene positively promotes the aggravation of leaf droop.

[0044] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. The use of EXO gene is characterized by: Regulating the angle of plant leaves and leaf droop, the nucleotide sequence of the EXO gene is as described in SEQ ID NO:

1.

2. The use of the EXO gene according to claim 1, characterized in that: The leaves are tea plant leaves.

3. The use of the EXO gene according to claim 1 or 2, characterized in that: The tea leaves obtained by silencing the EXO gene have a smaller leaf angle and a lower leaf droop degree.

4. The use of the EXO gene according to claim 1 or 2, characterized in that The antisense primers used for EXO gene silencing are as follows: EXO antisense primer-1: 5'CCCGATCACCGGAGTTATGA3' EXO antisense primer-2: 5'GGTACTTCATGTGGACGAAC3' EXO antisense primer-3: 5'GGTCTGGTCAGTGTAGAGCT3' EXO antisense primer-4: 5'TTGGCGTTGATAGGGAGAGG3' EXO antisense primer-5: 5'ATCTGGTACGGCGAAGGGGT3'.

5. An antisense inhibition treatment solution for EXO gene, characterized by: The antisense primer is prepared by mixing equal amounts of the EXO antisense primer-1, EXO antisense primer-2, EXO antisense primer-3, EXO antisense primer-4 and EXO antisense primer-5 as described in claim 4, and then adding distilled water to dilute the mixture. The concentration of each primer in the antisense inhibition treatment solution is 20±2uM.

Images