A method for constructing a 3'mRNA sequencing library

The use of a transposase enzyme to fragment and tag mRNA-cDNA hybrids in 3'mRNA sequencing libraries addresses the complexity and time issues of existing methods, achieving rapid and efficient library construction with high enrichment.

CN116103368BActive Publication Date: 2025-07-15NANKE HEZHI BIOTECHNOLOGY (SHENZHEN) CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210914546.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-29
Publication Date
2025-07-15
Estimated Expiration
2042-07-29

AI Technical Summary

Technical Problem

The existing 3’mRNA sequencing library construction methods are cumbersome and time-consuming, including mRNA enrichment, interruption, cDNA synthesis, aptamer ligation and library amplification, and use of reagents and time-consuming.

Method used

Transposase is used to rapidly fragment the hybrid strand and connect the linker, combined with the reverse transcriptase reaction, and omit the traditional RNA breakage, cDNA second-strand synthesis and amplification steps, and improve the library construction efficiency through the ligation of the labeled sequence.

Benefits of technology

The operation process is simplified, the efficiency and enrichment of the library are improved, the operation steps are reduced, and the quality and purity of the library are ensured.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116103368B_ABST
    Figure CN116103368B_ABST
Patent Text Reader

Abstract

The present invention provides a method for constructing a 3'mRNA sequencing library, comprising the following steps: providing target RNA; constructing a reverse transcription system to perform reverse transcription on the target RNA to obtain an mRNA-cDNA hybrid strand; adding a transposase to the reverse transcription system that has undergone the reverse transcription, and after a transposition reaction, obtaining multiple adapter mRNA-cDNA hybrid strand fragments; degrading the RNA in multiple adapter mRNA-cDNA hybrid strands to obtain multiple cDNA strands; and performing amplification on multiple cDNA strands using amplification primers to obtain the 3'mRNA sequencing library. In the present invention, by using a transposase to rapidly fragment and ligate adapters to the hybrid strands for subsequent ligation of labeled sequences, the operation is convenient and fast; at the same time, the transposase is mixed and reacted with the reverse transcription reaction system, and the fragmented hybrid strands are filled in using the reverse transcriptase that has not been inactivated, omitting the traditional filling-in step, thereby further improving the library construction efficiency while ensuring the enrichment degree.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and in particular relates to a method for constructing a 3'mRNA sequencing library. Background Art

[0002] With the rapid development of mRNA sequencing, it has gradually become a standard method for studying transcriptomics. By obtaining information about mRNA in a sample through high-throughput sequencing, scientists can analyze transcriptome expression patterns in samples at different time periods and their changes over time. While the cost and complexity of constructing mRNA sequencing libraries are continuously decreasing with technological advancements, the construction of mRNA libraries still requires a long time, complex steps, and extensive sequencing data processing and analysis. Building on this, the recently developed Quant-seq method constructs and sequences mRNA libraries near the 3' end of the poly(A) tail. This significantly reduces the number of steps and time required for library construction and is suitable for analyzing alternative polyadenylation (APA) in transcripts. This method primarily uses oligo-dT primers that bind to the poly(A) tail at the end of the mRNA to prime reverse transcription, followed by random oligo-primer-guided second-strand synthesis to introduce adapters into the target sample fragments. Subsequent amplification enriches the target library for next-generation sequencing.

[0003] The main drawback of existing 3' mRNA sequencing technologies lies in the cumbersome library construction steps. These steps, including mRNA enrichment, mRNA shearing, single-strand and double-strand cDNA synthesis, adapter ligation, library amplification, and purification, require numerous reagents, are complex, and time-consuming. Summary of the Invention

[0004] The main purpose of the present invention is to provide a method for constructing a 3'mRNA sequencing library, aiming to provide a method for constructing a 3'mRNA sequencing library with rapid library construction and high enrichment.

[0005] To achieve the above object, the present invention provides a method for constructing a 3' mRNA sequencing library, which comprises the following steps:

[0006] Provide target RNA;

[0007] Constructing a reverse transcription system to reverse transcribe the target RNA to obtain an mRNA-cDNA hybrid chain, wherein the reverse transcription system includes a reverse transcriptase and a reverse transcription primer, and the reverse transcription primer includes a linker 1 and a reverse transcription sequence;

[0008] Adding a transposase to the reverse transcription system after the reverse transcription, and obtaining a plurality of linker mRNA-cDNA hybrid chain fragments after the transposition reaction, wherein the transposase has a linker 2;

[0009] degrading RNA in the plurality of linker mRNA-cDNA hybrid chain fragments to obtain a plurality of cDNA chains;

[0010] After amplifying the multiple cDNA chains using amplification primers, the 3'mRNA sequencing library is obtained, wherein the amplification primers include a tag primer 2 and a tag primer 1, the tag primer 1 includes an amplification sequence 1, a tag sequence 1 and a linker 1' connected in sequence, the tag primer 2 includes an amplification sequence 2, a tag sequence 2 and a linker 2' connected in sequence, the linker 1' can form a double strand with the linker 1, the linker 2' can form a double strand with the linker 2, and the tag sequence 1 is different from the tag sequence 2.

[0011] Optionally, the reverse transcription sequence is (dT) n , wherein n is 16 to 30; and / or,

[0012] The transposase is composed of two polymerization units, and each polymerization unit is a T5 transposase connected to a connection sequence, and the connection sequence includes the linker 2.

[0013] Optionally, the reverse transcription system includes a reverse transcription buffer and dNTPs.

[0014] Optionally, before the step of adding transposase to the reverse transcription system after the reverse transcription, and obtaining a plurality of linker mRNA-cDNA hybrid chains after the transposition reaction, the step further comprises:

[0015] The T5 transposase is mixed with the linker sequence, a buffer is added, and a coupling reaction is performed to obtain the transposase, wherein the linker sequence includes a sticky end consistent with the linker 2 sequence.

[0016] Optionally, before the step of mixing the T5 transposase with the linker sequence, adding a buffer, and performing a coupling reaction, the step of obtaining the transposase further comprises:

[0017] After mixing primer 1 and primer 2 and performing annealing reaction, a linker sequence is obtained, wherein the sequence of primer 1 is shown in SEQ.ID.NO: 2, and the 5' end of primer 1 is connected to a labeling group and the 3' end is connected to an amino group, and the sequence of primer 2 is shown in SEQ.ID.NO: 1.

[0018] Optionally, the step of degrading RNA in the plurality of linker mRNA-cDNA hybrid chain fragments to obtain a plurality of cDNA chains comprises:

[0019] A chelating agent is added to the plurality of linker mRNA-cDNA hybrid chains, reacted at 60° C. to 60° C., and cDNA is recovered using a DNA recovery and purification column to obtain the plurality of cDNA chains.

[0020] Optionally, the sequence of the amplified sequence 1 is as shown in SEQ.ID.NO: 3, the marker sequence 1 is any sequence, and the linker 1' is as shown in SEQ.ID.NO: 4; and / or,

[0021] The sequence of the amplified sequence 2 is shown as SEQ.ID.NO: 5, the tag sequence 2 is an arbitrary sequence, and the linker 2' is shown as SEQ.ID.NO: 6;

[0022] Optionally, the amplification primers further include amplification short primer 1 and amplification short primer 2, wherein the sequence of amplification short primer 1 is the same as the amplification sequence 1, and the sequence of amplification short primer 2 is the same as the amplification sequence 2.

[0023] Optionally, the step of obtaining the 3' mRNA sequencing library after amplifying the plurality of cDNA chains using amplification primers comprises:

[0024] The amplification primers are used to amplify the multiple cDNA chains to obtain amplified products;

[0025] The amplified product is purified and recovered using a magnetic bead method to obtain the 3'mRNA sequencing library.

[0026] In the present invention, transposase is used to rapidly fragment the heterozygous chains and connect linkers for subsequent connection to the labeled sequence, making the operation convenient and rapid. At the same time, the transposase is mixed with the reverse transcription reaction system to react, and the fragmented heterozygous chains are filled in using the non-inactivated reverse transcriptase, omitting the traditional filling step, thereby further improving the library construction efficiency while ensuring the enrichment level. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0028] Figure 1 This is a flowchart of an embodiment of the present invention for building a database;

[0029] Figure 2 This is a diagram showing the library size detection results of Example 2 of the present invention;

[0030] Figure 3 This is a diagram showing the library size detection results of Example 3 of the present invention;

[0031] Figure 4 This is a diagram showing the library size detection results of Example 4 of the present invention;

[0032] Figure 5 The results of fluorescence quantitative qPCR detection of the libraries constructed in Example 2 and Comparative Examples 1 to 5 are shown;

[0033] Figure 6 TA cloning sequencing maps were performed for the libraries constructed in Examples 5-6;

[0034] Figure 7 This is the library analysis diagram after library tag removal in Example 2.

[0035] The purpose, features and advantages of the present invention will be further described with reference to the accompanying drawings and in conjunction with the embodiments. DETAILED DESCRIPTION

[0036] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them.

[0037] It should be noted that, in the embodiments, those without specifying specific conditions, are carried out according to conventional conditions or the conditions recommended by the manufacturer. Those for reagents or instruments used that do not specify the manufacturer are conventional products that can be purchased commercially. In addition, the meaning of "and / or" appearing in the full text includes three parallel schemes. Taking "A and / or B" as an example, it includes schemes A, B, or A and B that meet the same time. In addition, the technical solutions between the various embodiments can be combined with each other, but must be based on those of ordinary skill in the art. When the combination of the technical solutions is contradictory or cannot be realized, it should be considered that the combination of such technical solutions does not exist and is not within the scope of protection required by the present invention. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work belong to the scope of protection of the present invention.

[0038] In view of the fact that the existing methods for constructing 3'mRNA sequencing libraries are complex and time-consuming, the present invention provides a method for constructing 3'mRNA sequencing libraries, see Figure 1 The method for constructing the 3'mRNA sequencing library comprises the following steps:

[0039] Step S10: providing target RNA;

[0040] Step S20: constructing a reverse transcription system to reverse transcribe the target RNA to obtain an mRNA-cDNA hybrid chain, wherein the reverse transcription system includes a reverse transcriptase and a reverse transcription primer, and the reverse transcription primer includes a linker 1 and a reverse transcription sequence;

[0041] Step S30: adding a transposase to the reverse transcription system after the reverse transcription, and obtaining a plurality of linker mRNA-cDNA hybrid chain fragments after the transposition reaction, wherein the transposase has a linker 2;

[0042] Step S40: degrading the RNA in the plurality of linker mRNA-cDNA hybrid chain fragments to obtain a plurality of cDNA chains;

[0043] Step S50: After amplifying the multiple cDNA chains using amplification primers, the 3'mRNA sequencing library is obtained, wherein the amplification primers include a label primer 2 and a label primer 1, the label primer 1 includes an amplification sequence 1, a label sequence 1 and a linker 1' connected in sequence, the label primer 2 includes an amplification sequence 2, a label sequence 2 and a linker 2' connected in sequence, the linker 1' can form a double strand with the linker 1, the linker 2' can form a double strand with the linker 2, and the label sequence 1 is different from the label sequence 2.

[0044] Transposases act on RNA / DNA hybrids, eliminating the tedious steps of RNA shearing, cDNA second-strand synthesis, and amplification required in traditional RNA library construction. This also avoids the bias introduced by pre-amplification. However, after transposase fragmentation, a fill-in step is required, making the process time-consuming.

[0045] In the present invention, transposase is used to rapidly fragment the heterozygous chains and connect linkers for subsequent connection to the labeled sequence, making the operation convenient and rapid. At the same time, the transposase is mixed with the reverse transcription reaction system to react, and the fragmented heterozygous chains are filled in using the non-inactivated reverse transcriptase, omitting the traditional filling step, thereby further improving the library construction efficiency while ensuring the enrichment level.

[0046] In some embodiments, the reverse transcriptase sequence is (dT)n, wherein n is 16 to 30.

[0047] Using (dT)n as the reverse transcription sequence can anchor the polyA sequence of eukaryotic cell RNA to perform reverse transcription.

[0048] In some embodiments, the reverse transcription system includes a reverse transcription buffer and dNTPs. Specifically, the dNTPs include dA (deoxyadenosine), dT (deoxythymidine), dC (deoxycytidine) and dG (deoxyguanosine), and the reverse transcription buffer can provide a stable environment for the reaction system.

[0049] It should be noted that the transposase is composed of two polymer units, and each polymer unit is a T5 transposase connected to a linker sequence, and the linker sequence includes the linker 2. As a more commonly used transposase, T5 transposase can quickly cut heterozygous chains. At the same time, the linker connected to each unit is consistent, which is conducive to improving the connection rate between the linker and the marker sequence 2.

[0050] In some embodiments, before step S30, the method further includes:

[0051] The T5 transposase is mixed with the linker sequence, a buffer is added, and a coupling reaction is performed to obtain the transposase, wherein the linker sequence includes a sticky end that is consistent with the sequence of linker 2. In this way, a T5 transposase polymer containing a fixed linker can be obtained.

[0052] The synthesis steps of the linker sequence include:

[0053] Primer 1 and primer 2 are mixed and annealed to obtain a linker sequence, wherein primer 1 includes a complementary sequence to primer 2 and a sticky end sequence. After annealing, the sticky end sequence of primer 1 forms linker 2. Specifically, the sequence of primer 1 is as shown in SEQ.ID.NO: 2, and the 5' end of primer 1 is connected to a labeling group and the 3' end is connected to an amino group. The sequence of primer 2 is as shown in SEQ.ID.NO: 1.

[0054] In some embodiments, step S40 includes adding a chelating agent to the plurality of linker mRNA-cDNA hybrid chains and reacting at 60° C. to 60° C. to obtain the plurality of cDNA chains. This method can eliminate RNA from the hybrid chains, facilitating the amplification of the library.

[0055] It should be noted that, under the premise of being able to degrade RNA, the specific components of the chelating agent are not limited. In some embodiments, the chelating agent includes ethylenediaminetetraacetic acid and NaOH.

[0056] It should be noted that, in step S50, the amplified sequence 1 and the amplified sequence 2 are designed as needed. Specifically, the sequence of the amplified sequence 1 is shown as SEQ.ID.NO: 3, the tag sequence 1 is an arbitrary sequence, and the linker 1' is shown as SEQ.ID.NO: 4;

[0057] The sequence of the amplified sequence 2 is shown as SEQ.ID.NO: 5, the tag sequence 2 is an arbitrary sequence, and the linker 2' is shown as SEQ.ID.NO: 6;

[0058] In some embodiments, the amplification primers further include amplification short primer 1 and amplification short primer 2, wherein the sequence of amplification short primer 1 is the same as the amplification sequence 1, and the sequence of amplification short primer 2 is the same as the amplification sequence 2.

[0059] By using short primers in the amplification system, the generated intermediate products with labels can be amplified to increase the amplification efficiency.

[0060] In some embodiments, step S50 includes:

[0061] The amplification primers are used to amplify the multiple cDNA chains to obtain amplified products;

[0062] The amplified product is purified and recovered using a magnetic bead method to obtain the 3' mRNA sequencing library. Purification and recovery can remove fragments in the library construction process and ensure the purity of the target fragments in the library.

[0063] The technical solutions of the present invention are further described in detail below in conjunction with specific embodiments and drawings. It should be understood that the following embodiments are only used to explain the present invention and are not used to limit the present invention.

[0064] Example 1

[0065] This example provides a method for preparing a Tn5 transposase complex, and the preparation method is as follows:

[0066] Equal volumes of ME (100 μM) and ME-S6 (100 μM) were mixed to 15 μL and annealed to prepare a DNA adaptor with the S6 sequence. The sequences of ME and ME-S6 are:

[0067] ME:5'-phos-CTGTCTCTTATACACATCT-NH2-3'(SEQ.ID.NO:2)

[0068] ME-S7:

[0069] 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3' (SEQ.ID.NO: 1)

[0070] The annealing reaction procedure is:

[0071] 75℃, 15min; 60℃, 10min; 50℃, 10min; 40℃, 10min; 25℃, 30min

[0072] After the reaction, dilute the DNA adaptor fivefold to a concentration of 10 μM. Then, prepare the reaction system according to the table below, package the purified Tn5 dimer, and mix thoroughly by pipetting.

[0073] Tn5 transposase (Feipeng Bio) 30μL DNA adaptor (10 μM) 15 μL Composite buffer (Feipeng Bio) 55μL

[0074] The reaction procedure is: 25°C, 30 min

[0075] After the reaction, the transposase for subsequent use is obtained.

[0076] Example 2

[0077] This example provides a method for constructing a 3' mRNA sequencing library, and the specific steps are as follows:

[0078] 1. Reverse transcription reaction

[0079] Prepare the reverse transcription system according to the table below and mix thoroughly by pipetting. After the reaction, the mRNA-cDNA hybrid chain is obtained.

[0080]

[0081] The reverse transcription reaction program is: 50℃, 30min

[0082] The reaction products are labeled as RT Reaction Products and can be directly used in subsequent transposition reactions.

[0083] The sequence of TruR1-(dT)18-VN Primer is:

[0084] ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTTTTTTTTTTTTTTTVN

[0085] ACACTCTTTCCCTACACGACGCTCTTCCGATC is linker 1, the reverse transcription sequence is TTTTTTTTTTTTTTTTTTT, V is a mixed base of A, C, and G, and N is a mixed base of A, C, G, and T. This design can anchor the Primer to the initial region of the terminal poly (A) region.

[0086] Among them, dNTPs include dA, dT, dC and dG.

[0087] 2. Transposition reaction

[0088] After the reverse transcription reaction is completed, the following reaction system is prepared directly in the same reaction tube, and a transposition reaction is performed to obtain multiple adapter mRNA-cDNA hybrid chain fragments, which are named tagmentation products.

[0089]

[0090] The transposition reaction procedure was: 55°C, 30 min

[0091] 3. Denaturation of hybrid chains to recover single-stranded DNA

[0092] Tagmentation products 50μL EDTA (0.5M) 10 μL NaOH (1N) 10 μL

[0093] The reaction procedure was 65°C for 15 min

[0094] The single-stranded DNA was recovered and purified using DNA recovery and purification columns. The recovered single-stranded DNA was dissolved in 15 μL Nuclease-free H2O to obtain multiple cDNA chains, named Eluted ssDNA. -5(Zymo Research).

[0095] 4. PCR reaction

[0096] Prepare the PCR reaction system according to the table below and mix thoroughly by pipetting.

[0097]

[0098] The sequence of P5-i5-TruR1 is:

[0099] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGAC; each N is independently selected from any one of A, G, T, and C. Wherein, AATGATACGGCGACCACCGAGATCTACAC (SEQ.ID.NO: 3) is amplification sequence 1, NNNNNNNN is marker sequence 1, and CACTCTTTCCCTACACGAC (SEQ.ID.NO: 4) is linker 1';

[0100] The sequence of P7-i7-S7 is:

[0101] CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGG; each N is independently selected from any one of A, G, T, and C. Wherein, CAAGCAGAAGACGGCATACGAGAT (SEQ.ID.NO: 5) is amplification sequence 2, NNNNNNNN is marker sequence 2, and GTCTCGTGGGCTCGG (SEQ.ID.NO: 6) is linker 2';

[0102] The P5 sequence is: AATGATACGGCGACCACCGAGATCTACAC;

[0103] The sequence of P7 is: CAAGCAGAAGACGGCATACGAGAT.

[0104] The PCR reaction procedure is:

[0105]

[0106] 5. Library Purification and Quality Control

[0107] The PCR amplification products were purified and recovered using magnetic beads. DNA CleanBeads (Vazyme), the recovered DNA library was dissolved in 20 μL Nuclease-free H2O.

[0108] Example 3

[0109] This example provides a method for constructing a 3' mRNA sequencing library. The specific operations are generally the same as those in Example 2, except that the target RNA input amount is 100 ng and the number of cycles corresponding to the PCR reaction program is 14-16.

[0110] Example 4

[0111] This example provides a method for constructing a 3' mRNA sequencing library. The specific operations are generally the same as those in Example 2, except that the target RNA input amount is 10 ng and the number of cycles corresponding to the PCR reaction program is 12-14.

[0112] Example 5

[0113] This example provides a method for constructing a 3' mRNA sequencing library. The specific operation is generally consistent with Example 2. The target RNA input amount is 1 μg, the PCR reaction program corresponds to 12 cycles, and the target RNA is derived from the gene SLC25A34, which is annotated as: Ensembl: ENSG00000162461.

[0114] Example 6

[0115] This example provides a method for constructing a 3' mRNA sequencing library. The specific operation is generally consistent with Example 2. The target RNA input amount is 1 μg, the number of cycles corresponding to the PCR reaction program is 12, and the target RNA is derived from the gene MYO1E, which is annotated as: Ensembl: ENSG00000156483.

[0116] Comparative Example 1

[0117] This comparative example provides a comparison with the 3' mRNA sequencing library construction method, showing the loss of transcription and transposition processes. The specific operation is generally consistent with Example 2, with the target RNA input amount being 1 μg and the corresponding PCR reaction cycle number being 12. The difference is that Maxima H minus Reverse Transcriptase (ThermoScientific, 200 U / μL) was not added to the reverse transcription reaction system, and no transposase was added to the transposition reaction system.

[0118] Comparative Example 2

[0119] This comparative example provides a comparison with the 3'mRNA sequencing library construction method to show the loss of the transposition process. The specific operation is basically the same as Example 2, the target RNA input amount is 1μg, and the PCR reaction program corresponds to 12 cycles. The difference is that no transposase is added to the transposition reaction system.

[0120] Comparative Example 3

[0121] This comparative example provides a comparison with the 3' mRNA sequencing library construction method, and the situation of loss of transcription process. The specific operation is basically the same as Example 2, the target RNA input amount is 1 μg, and the corresponding PCR reaction program has 12 cycles. The difference is that Maxima H minus reverse transcriptase (ThermoScientific, 200 U / μL) is not added to the transcription reaction system.

[0122] Comparative Example 4

[0123] This comparative example provides a comparison with the 3' mRNA sequencing library construction method to illustrate the loss of transcription and transposition processes. The specific operations are generally consistent with those in Example 2, except that the target RNA input amount is 1 μg, the number of cycles corresponding to the PCR reaction program is 12, Maxima H minus Reverse Transcriptase (Thermo Scientific, 200 U / μL) is not added to the reverse transcription reaction system, and no transposase is added to the transposition reaction system. After the transposition reaction, the following system is added for extension reaction.

[0124]

[0125] The reaction procedure was 42°C for 30 min.

[0126] The reaction products were subjected to hybridization chain denaturation and single-strand recovery, as well as PCR reaction.

[0127] Comparative Example 5

[0128] This comparative example provides a comparison with the 3' mRNA sequencing library construction method to show the loss of transcription and transposition. The specific operation is generally consistent with Example 2, with the target RNA input amount being 1 μg, the PCR reaction program corresponding to the number of cycles being 12, and the extension reaction shown in Comparative Example 4 being performed after the transposition reaction.

[0129] Test Examples

[0130] 1. The concentrations of the libraries constructed in Examples 2 to 4 were determined using Qubit dsDNA HS Assay (Thermo Scientific). The results are shown in Table 1.

[0131] Table 1 Library concentration test results

[0132] Total RNA input Number of cycles Library concentration (in 20 μL) Example 2 12 23.2 ng / μL Example 3 14 18.9 ng / μL Example 4 16 15.6 ng / μL

[0133] The results showed that when the total amount of target RNA was between 10 ng and 1 μg, the concentration of the constructed library could meet the library construction requirements.

[0134] 2. The library size was analyzed using a 4200 TapeStation System (Agilent). The results of Examples 2 to 5 were as follows: Figures 2-4 The test results show that the library peaks are concentrated between 180 and 600 bp, with the peak between 250 and 285 bp, both of which meet the length requirements of normal second-generation sequencing libraries for sequencing samples.

[0135] 3. The libraries constructed in Example 2 and Comparative Examples 1 to 5 were tested using fluorescent quantitative qPCR. The test results were as follows: Figure 5 As shown, compared with Comparative Examples 1 to 3, Example 2 uses transposase and reverse transcription, and compared with Comparative Examples 4 to 5, it uses transcription and transposition, and does not perform extension and filling. The results show that the library enrichment of Example 2 is significantly higher than that of Comparative Examples 1 to 5. The enrichment will be improved by performing reverse transcription and transposition reactions at the same time. Under the premise of omitting the extension and filling steps and saving operation steps, the enrichment degree is not affected. It should be noted that Comparative Example 1 was operated in two batches in parallel, and the results of different batches are shown in FIG. Figure 5 shown.

[0136] 4. The libraries constructed in Examples 5 and 6 were subjected to TA cloning and Sanger sequencing. Figure 6 As shown in Figure 2 . Sequencing results showed that all library samples had the library structure that met the experimental design, with forward or reverse ligation on the T plasmid. Furthermore, the majority of inserts were enriched in the poly(A) region at the end of the gene transcript, with a small number of inserts enriched in the region near the poly(A) within the gene transcript.

[0137] 5. The quality of the second generation sequencing of Example 2 was analyzed by fastqc after trim-galore (tag removal), and the results were good. Figure 7 As shown, Figure 7 In the figure, A shows the library size test results, and B shows the proportion of the four bases in the library. After removing the adapters at both ends and low-quality sequences, the library size is concentrated in the range of 120–140 bp, with a peak at 132 bp. The proportion of the four bases in the library is primarily thymine in the 0–18 bp range, corresponding to the 18 dTs in the oligo-dT anchor primer. After 19 bp, the four bases are evenly distributed, indicating good anchoring effect of the oligo-dT primer and good library quality.

[0138] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Those skilled in the art will readily appreciate that the present invention is susceptible to various modifications and variations. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention shall be included within the scope of the present invention.

Claims

1. A method for constructing a 3'mRNA sequencing library, characterized in that, The method for constructing the 3'mRNA sequencing library comprises the following steps: Providing target RNA; Constructing a reverse transcription system to perform reverse transcription on the target RNA to obtain an mRNA-cDNA hybrid strand. Among them, the reverse transcription system includes a reverse transcriptase and a reverse transcription primer, and the reverse transcription primer includes adaptor 1 and a reverse transcription sequence; Adding a transposase to the reverse transcription system after the reverse transcription. After a transposition reaction, multiple adaptor mRNA-cDNA hybrid strand fragments are obtained. Among them, the transposase has adaptor 2; Degrading the RNA in multiple adaptor mRNA-cDNA hybrid strand fragments to obtain multiple cDNA strands; After amplifying multiple cDNA strands using amplification primers, the 3'mRNA sequencing library is obtained. Among them, the amplification primers include a labeled primer 2 and a labeled primer 1. The labeled primer 1 includes an amplification sequence 1, a labeled sequence 1, and adaptor 1' connected in sequence. The labeled primer 2 includes an amplification sequence 2, a labeled sequence 2, and adaptor 2' connected in sequence. Adaptor 1' can form a double strand with adaptor 1, adaptor 2' can form a double strand with adaptor 2, and the labeled sequence 1 is different from the labeled sequence 2; the amplification primers also include an amplification short primer 1 and an amplification short primer 2. The sequence of the amplification short primer 1 is the same as that of the amplification sequence 1, and the sequence of the amplification short primer 2 is the same as that of the amplification sequence 2.

2. The construction method of a 3'mRNA sequencing library according to claim 1, wherein, The reverse transcription sequence is (dT) n , where n is from 16 to 30; and / or, The transposase is composed of two polymerization units, and each polymerization unit is a T5 transposase connected with a connection sequence, and the connection sequence includes adaptor 2.

3. The construction method of a 3'mRNA sequencing library according to claim 1, characterized in that, The reverse transcription system further includes a reverse transcription buffer and dNTPs.

4. The construction method of a 3'mRNA sequencing library according to claim 1, characterized in that, Before the step of adding a transposase to the reverse transcription system after the reverse transcription and obtaining multiple adaptor mRNA-cDNA hybrid strand fragments after a transposition reaction, it further includes: Mixing the T5 transposase with an adaptor sequence, adding a buffer, and obtaining the transposase after a coupling reaction. Among them, the adaptor sequence includes a sticky end consistent with the sequence of adaptor 2.

5. The construction method of a 3'mRNA sequencing library according to claim 4, characterized in that, Before the step of mixing the T5 transposase with an adaptor sequence, adding a buffer, and obtaining the transposase after a coupling reaction, it further includes: Mixing primer 1 and primer 2, and obtaining the adaptor sequence after an annealing reaction. Among them, the sequence of primer 1 is as shown in SEQ.ID.NO: 2, and a labeled group is connected to the 5' end of primer 1, and an amino group is connected to the 3' end. The sequence of primer 2 is as shown in SEQ.ID.NO:

1.

6. The construction method of a 3'mRNA sequencing library according to claim 1, wherein, The step of degrading the RNA in multiple adaptor mRNA-cDNA hybrid strands to obtain multiple cDNA strands includes: Adding a chelating agent to multiple adaptor mRNA-cDNA hybrid strand fragments, performing the degradation at 60°C to 70°C, and recovering the cDNA using a DNA recovery and purification column to obtain multiple cDNA strands.

7. The construction method of a 3'mRNA sequencing library according to claim 1, wherein The sequence of the amplification sequence 1 is as shown in SEQ.ID.NO: 3, the labeled sequence 1 is an arbitrary sequence, and adaptor 1' is as shown in SEQ.ID.NO: 4; and / or, The sequence of the amplified sequence 2 is as shown in SEQ.ID.NO:

5. The labeled sequence 2 is an arbitrary sequence, and the adapter 2' is as shown in SEQ.ID.NO:

6.

8. The method for constructing a 3'mRNA sequencing library according to claim 1, wherein The step of obtaining the 3'mRNA sequencing library by amplifying multiple cDNA strands with amplification primers includes: Amplifying multiple cDNA strands with amplification primers to obtain an amplification product; Purifying and recovering the amplification product by the magnetic bead method to obtain the 3'mRNA sequencing library.

Citation Information

Patent Citations

  • Method for rapid construction of RNA 3' terminal gene expression library

    CN110257479A

  • Method and kit for simultaneously constructing sequencing library by DNA and RNA

    CN111139532A