circRNA markers and diagnostic kits for gastric cancer diagnosis
By using hsa_circ_0001380 and hsa_circ_0000045circRNA molecules and standardized detection procedures, the problems of low sensitivity and specificity of non-invasive markers for early diagnosis of gastric cancer were solved, and efficient and economical gastric cancer screening was achieved.
Patent Information
- Application Number
- CN202211079304.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-05
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2042-09-05
AI Technical Summary
In the existing technology, there is a lack of effective non-invasive markers for the early diagnosis of gastric cancer. The liquid biopsy method has low sensitivity and specificity, and the detection method is not standardized and expensive, which makes it difficult to meet the early screening needs of gastric cancer.
Two circRNA molecules, hsa_circ_0001380 and hsa_circ_0000045, were used as markers, combined with specific primers and a standardized detection process, including serum RNA extraction, reverse transcription, and quantitative PCR, to improve the sensitivity and specificity of the detection.
It achieves high sensitivity and high specificity in the diagnosis of gastric cancer, provides an economical and standardized detection method, and improves the screening efficiency of gastric cancer.
Smart Images

Figure CN116103395B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to circRNAs markers and a diagnostic kit for gastric cancer diagnosis. Background Art
[0002] Gastric cancer is a common malignancy in my country. Due to its insidious onset and lack of early diagnostic biomarkers, nearly 80% of patients are initially diagnosed at an advanced stage, resulting in a low five-year survival rate. Therefore, early diagnosis and intervention are crucial. Tumor tissue biopsy remains the gold standard for gastric cancer diagnosis, but it has limitations due to invasiveness, hysteresis, and tumor heterogeneity. Liquid biopsy, as an emerging molecular testing technology, is non-invasive, rapid, cost-effective, and reproducible. It offers superior sensitivity and specificity compared to traditional serum tumor markers, enabling earlier diagnosis than pathological biopsy, bringing hope for early detection and risk assessment of gastric cancer. With continued research, the scope of liquid biopsy is expanding. To date, liquid biopsy markers include circulating tumor cells (CTCs), ctDNA, extracellular vesicles, and ctRNA. RNA-based liquid biopsies have gained increasing attention due to their dynamic expression and close correlation with diverse disease states.
[0003] circRNAs are a class of RNA molecules with a closed, circular structure. With the advancement of sequencing technology, the role of these previously overlooked RNA molecules in the body has received increasing attention. In recent years, researchers have identified numerous circRNAs in tumor tissues from gastric cancer patients. Abnormally expressed circRNAs participate in numerous biological processes in tumor cells by acting as miRNA sponges or binding to proteins, affecting tumor progression and outcome. CircRNAs play a crucial role in the development and progression of gastric cancer. Their high stability, specificity, and widespread expression make them a promising biomarker for human disease. While some studies on serum circRNAs in gastric cancer have been reported, they still suffer from low sensitivity and specificity, and detection methods are not standardized and expensive. To overcome the shortcomings and deficiencies of the existing technology, the present invention aims to provide a highly effective marker molecule and diagnostic kit for gastric cancer diagnosis, hsa_circ_0001380, with the goal of improving the diagnostic efficacy of gastric cancer screening. This approach also addresses the technical difficulties of standardizing the extraction and detection of serum circRNAs, a key challenge in the clinical application of serum circRNAs, thereby facilitating the advancement of serum circRNA markers into clinical practice. Summary of the Invention
[0004] To solve the above problems, the present invention discloses a group of circRNA molecular markers and a kit with high gastric cancer diagnostic efficacy.
[0005] To achieve the above object, the technical solution of the present invention is as follows:
[0006] The present invention provides a circRNAs marker for gastric cancer diagnosis, including hsa_circ_0001380 and hsa_circ_0000045, the sequence of hsa_circ_0001380 is shown as SEQ ID NO.1, and the sequence of hsa_circ_0000045 is shown as SEQ ID NO.2.
[0007] SEQ ID NO.1:
[0008] AGAAGAAGTTCGTGCCCCAATTCCTCAAAAGCAGGAAATACTGGTGGAACCAGAACCATTATTTGTGCTCCTAAAAGACGACGGCCTGCACGTTCAATTTTTGATGGTTTCCGGGATTTTCAGACTGAAACTATTCGGCAAGAACAAGAATTAAGAAATGGAGGAGCTATCGATAAGAAATTAACTACCCTTGCAGATCTATTCCGGCCACCCATTGATTTGATGCATAAAGGCAGCTTTGAAACA
[0009] SEQ ID NO.2:
[0010] GTGTTGGTGGAATGAGCGTTGCATGTGTCTTGAAGAGAAAAGCAGTGCTTTGGCAGGACTCTTTCAGCCCCCACCTGAAACATCACCCTCAAGAACCAGCTAATCCCAACATGCCTGTTGTTTTGACATCTGGAACAGGGTCGCAAGCGCAGCCACAACCAGCTGCAAATCAGGCTCTTGCAGCTGG GACTCACTCCAGCCCTGTCCCAGGATCTATAGGAGTTGCAGGCCGTTCCCAGGACGACGCTATGGTGGACTACTTCTTTCAGAGGCAGCATGGTGAGCAGCTTGGGGGAGGAGGAAGTGGAGGAGGCGGCTATAATAATAGCAAACATCGATGGCCTACTGGGGATAACATTCATGCAGAACATCAG
[0011] The above-mentioned circRNAs markers have high sensitivity and specificity for gastric cancer and can be used as new biomarkers for the diagnosis of gastric cancer.
[0012] The present invention provides use of hsa_circ_0001380 and / or hsa_circ_0000045 as markers in the preparation of a product for diagnosing or screening gastric cancer; the product for diagnosing or screening gastric cancer comprises a drug or reagent for detecting the expression level of hsa_circ_0001380 and / or hsa_circ_0000045 in patient serum, serum exosomes or tissues, the sequence of hsa_circ_0001380 being shown as SEQ ID NO. 1, and the sequence of hsa_circ_0000045 being shown as SEQ ID NO. 2.
[0013] The product for diagnosing or screening gastric cancer includes specific primers for hsa_circ_0001380 and specific primers for hsa_circ_0000045; the specific primers for hsa_circ_0001380 include a forward primer with a sequence as shown in SEQ ID NO.3 and a reverse primer with a sequence as shown in SEQ ID NO.4; the hsa_circ_0000045-specific reverse primer includes a forward primer with a sequence as shown in SEQ ID NO.5 and a reverse primer with a sequence as shown in SEQ ID NO.6.
[0014] The present invention also provides a kit for diagnosing or screening gastric cancer, comprising a circRNAs marker for diagnosing or screening gastric cancer, wherein the marker comprises hsa_circ_0001380 as shown in SEQ ID NO.1 and / or hsa_circ_0000045 as shown in SEQ ID NO.2.
[0015] The kit for diagnosing or screening gastric cancer also includes a specific primer for hsa_circ_0001380 and a specific primer for hsa_circ_0000045; the specific primer for hsa_circ_0001380 includes a forward primer with a sequence as shown in SEQ ID NO.3 and a reverse primer with a sequence as shown in SEQ ID NO.4; the specific primer for hsa_circ_0000045 includes a forward primer with a sequence as shown in SEQ ID NO.5 and a reverse primer with a sequence as shown in SEQ ID NO.6.
[0016] The above-mentioned kit for diagnosing or screening gastric cancer also includes RNA extraction, reverse transcription reagents and qPRC detection reagents of hsa_circ_0001380 and hsa_circ_0000045, which are used to detect the expression levels of hsa_circ_0001380 and hsa_circ_0000045.
[0017] The present invention also provides a standardized detection process for detecting the above-mentioned circRNAs markers, which can efficiently and quickly detect circRNAs, comprising the following steps:
[0018] 1) Serum RNA extraction (especially suitable for enriching circRNAs, with higher yield);
[0019] 2) RNA reverse transcription (using random primers to efficiently reverse-transcribe circRNAs with good stability);
[0020] 3) Quantitative PCR reaction (can efficiently amplify circRNAs and improve detection sensitivity).
[0021] The beneficial effects of the present invention are:
[0022] The present invention discloses hsa_circ_0001380 and hsa_circ_0000045, which have good diagnostic efficacy for gastric cancer. The invention provides specific primers for hsa_circ_0001380 and hsa_circ_0000045. This patent also provides a standardized detection process for detecting the aforementioned circRNA markers, enabling efficient and rapid detection of circRNAs. The process includes three steps: serum RNA extraction, RNA reverse transcription, and quantitative PCR detection of circRNAs. The BIOG Free RNA Extraction Kit (51028) used in the serum RNA extraction step can enrich circRNAs to a greater extent and achieve higher purity than manual methods, and is more economical and rapid than other RNA extraction kits on the market. The RNA reverse transcription process utilizes random primers to effectively reverse-transcribe circRNAs, resulting in rapid and stable reverse transcription. The patent also mentions the circRNA quantitative PCR reagent, AceQ Universal SYBR qPCR Master Mix (Q511-02 / 03), which amplifies circRNAs more efficiently than other quantitative reagents on the market, improving detection sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 The expression levels of hsa_circ_0001380 and hsa_circ_0000045 in the serum of healthy subjects and gastric cancer patients, A, hsa_circ_0001380, B, hsa_circ_0000045;
[0024] Figure 2 Diagnostic efficacy analysis of hsa_circ_0001380 and hsa_circ_0000045 for gastric cancer, A, hsa_circ_0001380, B, hsa_circ_0000045. DETAILED DESCRIPTION
[0025] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. It should be understood that the following specific embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.
[0026] Example 1
[0027] 1. Clinical samples
[0028] Serum was collected from patients who underwent gastrectomy and were pathologically diagnosed with gastric cancer at the Department of General Surgery, Nanjing Drum Tower Hospital, between June and December 2021, and from matched healthy controls. Inclusion criteria for gastric cancer patients included: surgically resected tissue sections confirmed as primary gastric cancer by the pathology department; patients had not received medication, radiation, chemotherapy, or adjuvant therapy before surgery; and patients had no other serious underlying diseases, such as diabetes, heart disease, kidney disease, liver disease, or other tumors. Informed consent was obtained from patients and their families before sample collection, and the samples were reviewed and approved by the Ethics Committee of Nanjing Drum Tower Hospital.
[0029] Example 2
[0030] 1. Primers
[0031] The present invention provides a set of circRNAs primers including has_circ_0001380 and has_circ_0000045 primers, with GAPDH as the internal reference gene. The primer sequences are shown in Table 1:
[0032] Table 1. Primer sequences
[0033] name Primer number Primer sequence (5'-3') has_circ_0001380-F SEQ ID NO.3 TTCCGGCCACCCATTGATTT has_circ_0001380-R SEQ ID NO.4 GGCCGTCGTCTTTTAGGAGC has_circ_0000045-F SEQ ID NO.5 GTTCCCAGGACGACGCTATG has_circ_0000045-R SEQ ID NO.6 GCTCATTCCACCAACACCTGA GAPDH-F SEQ ID NO.7 GGAGCGAGATCCCTCCAAAAT GAPDH-R SEQ ID NO.8 GGCTGTTGTCATACTTCTCATGG
[0034] 2. CircRNAs Detection Methods
[0035] A diagnostic kit for gastric cancer serum hsa_circ_0001380 and hsa_circ_0000045 is provided. The kit comprises a 1.5 mL EP tube containing reverse primers for detecting hsa_circ_0001380 and hsa_circ_0000045. The kit also includes reagents for RNA extraction, reverse transcription, and quantitative PCR detection, including an RNA adsorption column, an RNA collection tube, reverse transcriptase, quantitative PCR reaction buffer, and deionized water. The kit can be used directly in clinical practice.
[0036] (1) The steps for extracting and detecting circRNAs in gastric cancer serum are as follows:
[0037] 1) BD blood collection tubes with yellow caps for coagulant separation and storage at 4°C;
[0038] 2) Centrifuge the blood collection tube before use and collect 200 μL of separated serum;
[0039] 3) Extract free RNA from serum according to the instructions of BIOG serum and plasma free RNA extraction kit (51028);
[0040] 4) The extracted serum free RNA was reverse transcribed into cDNA using the Novozymes reverse transcription reagent (R111-01). Note that only random primers were used in the system. The reaction conditions were 25°C for 5 min, 50°C for 15 min, and 85°C for 2 min.
[0041] (2) The reverse transcription reaction system is shown in Table 2:
[0042] Table 2. Reverse transcription reaction system
[0043] HiScript Enzyme Mix 2μL 2×RT Mix 10 μL Random hexamers (50ng / μL) 1 μL RNA 7μL
[0044] (3) The above cDNA was mixed with Hsa_circ_0001380 forward and backward primers and 2×AceQ Universal SYBR qPCR Master Mix (Q121-02), and qPCR detection was performed on a Bio-Rad CFX96 instrument. The reaction system is shown below.
[0045] The qPCR reaction system is shown in Table 3:
[0046] Table 3. qPCR reaction system
[0047] 2×AceQ Universal SYBR qPCR Master Mix 10 μL Hsa_circ_0001380-F 0.5μL Hsa_circ_0001380-R 0.5μL cDNA 1 μL <![CDATA[ddH2O]]> 8μL
[0048] Example 3
[0049] Detection of the expression of hsa_circ_0001380 and hsa_circ_0000045 in the serum of healthy controls and gastric cancer patients
[0050] As mentioned above, we first extracted serum RNA from gastric cancer patients and healthy controls and performed reverse transcription of serum RNA. Then, we used quantitative PCR to detect the expression levels of serum circRNAs in gastric cancer patients and healthy controls. SPSS 20.0 was used for data analysis, and data that met the normal distribution were analyzed using The t-test was performed to compare whether there was a statistical difference between the two groups, and P < 0.05 was considered statistically significant.
[0051] The results showed that the expression level of has_circ_0001380 in the serum of gastric cancer patients was significantly downregulated compared with that in normal controls, with a P value of <0.0001. Figure 1 Figure A); Compared with normal controls, the expression level of has_circ_0000045 in the serum of gastric cancer patients was significantly downregulated, P value < 0.0001, see ( Figure 1 (Figure B).
[0052] Example 4
[0053] Evaluation of the diagnostic value of hsa_circ_0001380 and hsa_circ_0000045 for gastric cancer
[0054] The receiver operating characteristic curve (ROC) can be used to evaluate the effectiveness of one or more indicators in classifying and diagnosing two types of subjects (e.g., patients and healthy controls). We then used the ROC curve to evaluate the effectiveness of circRNAs indicators in classifying or diagnosing gastric cancer patients and healthy controls, and plotted the results using GraphPadPrism 7 software.
[0055] The results of ROC curve analysis showed that the area under the curve of hsa_circ_0001380 for distinguishing gastric cancer was 0.86, with a sensitivity of 88.14% and a specificity of 70.0% ( Figure 2 Middle A); the area under the curve of has_circ_0000045 for distinguishing gastric cancer was 0.82, with a sensitivity of 79.7% and a specificity of 70.0% ( Figure 2 (Figure B)
[0056] It should be noted that the above content merely illustrates the technical idea of the present invention and cannot be used to limit the scope of protection of the present invention. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications all fall within the scope of protection of the claims of the present invention.
Claims
1. Use of reagents for detecting hsa_circ_0001380 and / or hsa_circ_0000045 markers in the preparation of diagnostic products for gastric cancer; The gastric cancer diagnostic product includes a reagent for detecting the expression level of hsa_circ_0001380 and / or hsa_circ_0000045 in patient serum, serum exosomes or tissues, wherein the sequence of hsa_circ_0001380 is shown as SEQ ID NO.1, and the sequence of hsa_circ_0000045 is shown as SEQ ID NO.
2.
2. The use according to claim 1, characterized in that The product for gastric cancer diagnosis includes specific primers for hsa_circ_0001380 and specific primers for hsa_circ_0000045; the specific primers for hsa_circ_0001380 include a forward primer with a sequence as shown in SEQ ID NO.3 and a reverse primer with a sequence as shown in SEQ ID NO.4; the hsa_circ_0000045 specific reverse primer includes a forward primer with a sequence as shown in SEQ ID NO.5 and a reverse primer with a sequence as shown in SEQ ID NO.
6.
3. The use according to claim 1, characterized in that Also included are RNA extraction, reverse transcription reagents, and qPRC detection reagents for hsa_circ_0001380 and hsa_circ_0000045.