Method for detecting lead ions based on the CRISPR-Cas system

Abstract

The present invention relates to colorimetric analysis and detection technology, and discloses a method for detecting lead ions based on the CIRSPR-Cas system. The method comprises the following steps: mixing a specific enzyme containing a target DNA fragment with a sample to be tested that may contain lead ions to form a first mixture to be tested; mixing the first mixture to be tested with a CRISPR-Cas12a system solution to carry out a mixing reaction to obtain a second mixture to be tested; mixing the second mixture to be tested with a biosensor containing single-stranded DNA to carry out a mixing reaction to obtain a reaction solution to be tested, mixing the precipitate obtained by solid-liquid separation of the reaction solution to be tested with a color-developing agent to carry out a color-developing reaction to obtain a color-developing reaction solution, and carrying out colorimetric analysis or absorbance value detection analysis on the color-developing reaction solution; wherein, the target DNA can activate the Cas12a protein in the CRISPR-Cas12a system. The method has high detection sensitivity for heavy metals, can effectively shorten the detection time, and has strong practicability.

Description

Technical Field

[0001] The present invention relates to colorimetric analysis detection technology, and specifically, to a method for detecting lead ions based on the CIRSPR-Cas system. Background Art

[0002] In recent years, with the continuous advancement of China's industrialization process, the ecological environment has been continuously damaged, and food safety problems have occurred frequently. Food safety has become a hot topic in today's society. However, even though people are constantly developing new technologies, there are still many difficult-to-solve influencing factors, resulting in great damage to human food and posing a threat to the physical health of consumers, especially heavy metal pollution in food.

[0003] Heavy metal pollution refers to the pollution caused by heavy metals and their compounds, which is mainly caused by factors such as waste gas emissions, sewage irrigation, and the use of heavy metal products. Among them, lead, mercury, chromium, arsenic, and cadmium are the five most toxic to the human body. In the agricultural system, heavy metals absorbed by crops from the air or soil will enter the human body through the food chain and accumulate in the human body for a long time. Heavy metal pollution has become an important factor threatening food safety. As a relatively common toxic heavy metal, lead is widely used in metallurgy, chemical industry, machinery, printing, etc. Once it is ingested by the human body, it will exist and accumulate in various tissues and organs of the human body for a long time. Excessive lead content will cause damage to the human nervous system, immune system, hematopoietic system, skeletal system, immune system, and digestive system. Especially for infants with immature minds, the harm of lead will be greater, such as growth retardation and mental retardation, causing irreparable impacts on the children's bodies and spirits.

[0004] As a relatively simple heavy metal detection method in the food field, colorimetry mainly uses heavy metal ions to react with corresponding color reagents to generate different colored molecular groups, and judges according to the changes of test papers or detects with a photometer. Compared with other detection methods, the experimental operation difficulty is greatly reduced, and a large amount of detection costs can be saved. However, colorimetry has always been limited by low detection sensitivity and is difficult to accurately detect lead ions in food.

[0005] In recent years, the clustered regularly interspaced short palindromic repeats (CRISPR) and its associated enzyme (Cas) system have received extensive attention. This system has gradually formed through the long-term evolution of bacteria and is also known as an adaptive immune system. The system mainly includes CRISPR RNA (crRNA), Cas protein, deoxyribonucleotide inhibitor, target DNA, buffer, and ultrapure water. The crRNA is designed based on the target DNA, and the target DNA can be single-stranded DNA (ssDNA) or double-stranded DNA (dsDNA). When the target DNA pairs with the crRNA, the associated enzyme (Cas) will produce non-specific trans-cleavage activity and randomly cleave the nearby single-stranded DNA. This system is often used in nucleic acid detection. However, the CRISPR system is rarely applied to heavy metal detection, and how to rapidly and sensitively detect heavy metals in food is one of the urgent problems to be solved in food development. Summary of the Invention

[0006] The object of the present invention is to overcome the problem of low sensitivity in the colorimetric detection of heavy metals in the prior art, and to provide a method for detecting lead ions based on the CIRSPR-Cas system. This method has high sensitivity for the detection of heavy metals, can effectively shorten the detection time, and has strong practicability.

[0007] To achieve the above object, the present invention provides a method for detecting lead ions based on the CIRSPR-Cas system, comprising the following steps:

[0008] (1) Mix a specific enzyme containing the target DNA with a test sample that may contain lead ions to form a test mixture I, and mix the test mixture I with a CRISPR-Cas12a system solution to carry out a mixing reaction I to obtain a test mixture II;

[0009] (2) Mix the test mixture II with a biosensor containing single-stranded DNA to carry out a mixing reaction II to obtain a test reaction solution, mix the precipitate obtained by solid-liquid separation of the test reaction solution with a color reagent to carry out a color reaction to obtain a color reaction solution, and perform colorimetric analysis or absorbance value detection analysis on the color reaction solution to determine whether the test sample contains lead ions;

[0010] Wherein, the target DNA can activate the Cas12a protein in the CRISPR-Cas12a system.

[0011] Preferably, in step (1), the specific enzyme is GR-5 DNA enzyme, the nucleotide sequence of the GR-5 DNA enzyme is as shown in SEQ ID No.1, and the nucleotide sequence of the target DNA is as shown in SEQ ID No.2.

[0012] Preferably, the process of mixing the specific enzyme with the sample to be tested includes: heating the solution containing the specific enzyme in a water bath, annealing, and then mixing and shaking with the sample to be tested.

[0013] Preferably, the conditions for the water bath heating include: temperature 80 - 95°C, time 3 - 8 min; the conditions for the mixing and shaking include: temperature 30 - 45°C, time 60 - 90 min.

[0014] Preferably, the solvent used in the solution containing the specific enzyme is Tris-HCl buffer.

[0015] Preferably, the concentration of the specific enzyme in the solution containing the specific enzyme is 3 - 8 μM, and the concentration of lead ions in the sample to be tested is 0.8 - 2500 nM.

[0016] Preferably, the molar ratio of the specific enzyme to lead ions in the sample to be tested is 2 - 6250:1.

[0017] Preferably, the mixture II to be tested in step (1) further contains a masking agent.

[0018] Preferably, the masking agent is selected from at least one of ethylenediaminetetraacetic acid, dimercaptoacetone, and mercaptoacetic acid; more preferably ethylenediaminetetraacetic acid.

[0019] Preferably, the sample to be tested is food.

[0020] Preferably, the CRISPR-Cas12a system solution in step (1) contains crRNA, Cas12a protein, ribonuclease inhibitor, and buffer; wherein, the nucleotide sequence of the crRNA is as shown in SEQ ID No.4.

[0021] Preferably, the conditions for the mixing reaction I include: temperature 30 - 45°C, time 20 - 35 min.

[0022] Preferably, in step (2), the biosensor includes magnetic beads with streptavidin surface modification, single-stranded DNA modified with biotin, and amino-functionalized manganese dioxide nanorods. The single-stranded DNA is connected to the streptavidin on the magnetic beads through the biotin, and one end of the single-stranded DNA far from the magnetic beads is connected to the amino-functionalized manganese dioxide nanorods.

[0023] Preferably, the nucleotide sequence of the single-stranded DNA is as shown in SEQ ID No.3.

[0024] Preferably, relative to 1 mg of the magnetic beads with streptavidin surface modification, the dosage of the single-stranded DNA modified with biotin is 1×10 -4 -3×10-4 μmol, and the dosage of the amino-functionalized manganese dioxide nanorods is 0.05 - 0.15 mg.

[0025] Preferably, the preparation method of the biosensor comprises the following steps:

[0026] (1-1) In reaction solvent I, mix the single-stranded DNA modified with biotin and carboxyl with magnetic beads surface-modified with streptavidin for reaction I, so that the single-stranded DNA is connected to the streptavidin on the magnetic beads through the biotin, and then obtain magnetic bead-DNA through magnetic separation I;

[0027] (1-2) In reaction solvent II, incubate the magnetic bead-DNA with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide, and then obtain carboxyl-activated magnetic bead-DNA through magnetic separation II;

[0028] (1-3) In reaction solvent III, mix the carboxyl-activated magnetic bead-DNA with the amino-functionalized manganese dioxide nanorods for reaction II, so that one end of the single-stranded DNA far from the magnetic beads is connected to the amino-functionalized manganese dioxide nanorods, and then obtain the biosensor through magnetic separation III.

[0029] Preferably, the reaction solvent I, the reaction solvent II, and the reaction solvent III are each independently water and / or Tris-HCl buffer solution.

[0030] Preferably, relative to 1 mg of the magnetic beads surface-modified with streptavidin, the dosage of the reaction solvent I is 15 - 25 μL, the dosage of the reaction solvent II is 15 - 25 μL, the dosage of the reaction solvent III is 8 - 12 μL, the dosage of the 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride is 3 - 5 μmol, and the dosage of the N-hydroxysuccinimide is 0.5 - 1.5 μmol.

[0031] Preferably, the conditions of the reaction I in step (1-1) include: temperature is 30 - 45 °C, and time is 6 - 8 h.

[0032] Preferably, step (1-1) further includes: washing the substance obtained by the magnetic separation I to obtain the magnetic bead-DNA.

[0033] Preferably, the conditions of the incubation in step (1-2) include: temperature is 30 - 45 °C, and time is 10 - 15 h.

[0034] Preferably, the conditions of the reaction II in step (1-3) include: temperature is 30 - 45 °C, and time is 5 - 12 h.

[0035] Preferably, step (1-3) further includes: washing the substance obtained by the magnetic separation III to obtain the biosensor.

[0036] Preferably, the CRISPR-Cas12a system solution in step (2) contains crRNA, Cas12a protein, ribonuclease inhibitor and buffer; wherein, the nucleotide sequence of the crRNA is as shown in SEQ ID No. 4.

[0037] Preferably, the conditions of the mixing reaction II in step (2) include: temperature is 30-45°C, rotation speed is 750-1250 rpm, and time is 2-4 h.

[0038] Preferably, the chromogenic agent in step (2) is 3,3',5,5'-tetramethylbenzidine.

[0039] Preferably, the wavelength of the absorbance value is 620-680 nm.

[0040] Preferably, the process of determining whether the test sample contains lead ions in step (2) includes: mixing the biosensor with an initial equal amount in the test reaction solution with the chromogenic agent for a chromogenic reaction and detecting the absorbance value as the control absorbance value, detecting the absorbance value of the chromogenic reaction solution as the sample absorbance value, and comparing or quantitatively calculating the sample absorbance value with the control absorbance value.

[0041] Through the above technical solutions, the beneficial effects of the present invention are as follows:

[0042] The method for detecting lead ions based on the CIRSPR-Cas system provided by the present invention uses a biosensor containing single-stranded DNA as a signal probe, and uses a specific enzyme to cleave to form a target DNA that can activate the Cas12a protein under the action of lead ions. It not only converts the signal of lead ions into a nucleic acid signal of the target DNA, but also can combine with the CRISPR-Cas12a system, and uses the activated Cas12a protein to trans-cleave the non-specific single-stranded DNA in the biosensor, thereby reducing the chromogenic effect of the signal probe on the chromogenic agent and realizing the detection of lead ions. This process can significantly improve the detection sensitivity of lead ions, has high specificity, effectively shortens the detection time, has high practicability, provides a basis for establishing a rapid and specific visual detection platform for lead ions, and has great application potential in the food field. Description of the Drawings

[0043] Figure 1 is the schematic diagram of the method for detecting lead ions based on the CIRSPR-Cas system in the present invention;

[0044] Figure 2The ultraviolet absorption spectra after the color reaction of manganese dioxide nanorods (MnO2) in step (3) of Example 1, the biosensor (MBs-DNA-MnO2) obtained in step (3), and the precipitate (MBs-DNA-MnO2+CRISPR) in step (5) with TMB respectively;

[0045] Figure 3 It is a comparison chart of the relative absorbance value △A of the samples measured before and after using EDTA in Example 2 and Example 1;

[0046] Figure 4 It is the relative absorbance value △A of the samples measured by the CRISPR system at different rotation speeds in Example 3;

[0047] Figure 5 It is the relative absorbance value △A of the samples measured by the CRISPR system at different molar ratios of Cas12a protein to crRNA in Example 4;

[0048] Figure 6 It is the relative absorbance value △A of the samples measured by the CRISPR system at different temperatures in Example 5;

[0049] Figure 7 It is the relative absorbance value △A of the samples measured by the CRISPR system at different incubation times in Example 6;

[0050] Figure 8 It is the ultraviolet spectrum (A) measured at different lead ion concentrations in Example 7 and the standard curve graph (B) of the lead ion concentration and the relative absorbance value △A. Detailed implementation manners

[0051] In the ranges disclosed herein, the endpoints and any values are not limited to the exact ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.

[0052] The present invention provides a method for detecting lead ions based on the CIRSPR-Cas system, comprising the following steps:

[0053] (1) Mix a specific enzyme containing the target DNA with a test sample that may contain lead ions to form a test mixture I, and mix the test mixture I with a CRISPR-Cas12a system solution to carry out a mixing reaction I to obtain a test mixture II;

[0054] (2) Mix the mixture II to be measured with a biosensor containing single-stranded DNA to obtain a reaction solution to be measured. Mix the precipitate obtained by solid-liquid separation of the reaction solution to be measured with a color developer for a color reaction to obtain a color reaction solution, and perform colorimetric analysis or absorbance detection analysis on the color reaction solution to determine whether lead ions are contained in the sample to be measured;

[0055] Among them, the target DNA can activate the Cas12a protein in the CRISPR-Cas12a system.

[0056] The method for detecting lead ions provided by the present invention uses a biosensor containing single-stranded DNA as a signal probe, and utilizes a specific enzyme to cleave to form a target DNA that can activate the Cas12a protein under the action of lead ions. It not only converts the signal of lead ions into a nucleic acid signal of the target DNA, but also can be combined with the CRISPR-Cas12a system, and uses the activated Cas12a protein to trans-cleave the non-specific single-stranded DNA in the biosensor, thereby reducing the color development effect of the signal probe on the color developer and realizing the detection of lead ions. This process can significantly improve the detection sensitivity of lead ions, effectively shorten the detection time, and has high practicability, providing a basis for establishing a rapid and specific visual detection platform for lead ions, and having great application potential in the food field.

[0057] When lead ions are present in the sample to be measured, the specific enzyme is cleaved to form a target DNA, which is added to the CRISPR-Cas12a system, and can activate the non-specific single-stranded DNA enzyme activity of the Cas12a protein. The activated Cas12a protein will cleave the single-stranded DNA in the biosensor, and then perform a color reaction and absorbance detection. By observing whether the color of the equal amount of biosensor becomes lighter or the absorbance decreases before and after participating in the CRISPR-Cas12a system, qualitative detection of lead ions can be realized. By recording the change in absorbance (relative absorbance △A) at different concentrations of lead ions, quantitative detection of lead ions can be further realized, making the detection of lead ions have good specificity, high sensitivity and fast speed.

[0058] When lead ions are not present in the sample to be measured, the specific enzyme will not be cleaved to form a target DNA, the trans-cleavage activity of the Cas12a protein is not activated, and the absorbance of the equal amount of colorimetric biosensor before and after participating in the CRISPR-Cas12a detection system will not change.

[0059] During the research process, the inventors successfully constructed a method for rapid detection of lead ions based on CRISPR-Cas12a, introduced the trans-cleavage activity of CRISPR-Cas12a into the colorimetric detection system, and combined the specific recognition of lead ions by circular DNA enzymes and signal amplification technology, enabling the rapid detection of lead ions in test samples such as food, providing a basis for establishing a detection method with low cost, good specificity, and high sensitivity.

[0060] According to the present invention, the test sample can be any sample containing lead ions. Preferably, the test sample is food. Further preferably, after the test sample is pretreated to form a lead ion stock solution, it is then mixed with a specific enzyme containing the target DNA. Exemplarily, when the test sample is an oil sample, the oil sample is extracted with methanol and sodium chloride to obtain an extract, and the extract is filtered through a 0.22 μm microfiltration membrane and used as the lead ion stock solution.

[0061] According to the present invention, the specific enzyme includes a substrate strand and an enzyme strand. In the presence of lead ions, the substrate strand will be cleaved, thereby separating from the enzyme strand, and further realizing the conversion of the lead ion signal into a nucleic acid signal; further, in combination with the outstanding characteristics of the CRISPR system for nucleic acid detection, the detection of lead ions can be completed. Preferably, the specific enzyme in step (1) is the GR-5 DNA enzyme, and the nucleotide sequence of the GR-5 DNA enzyme is shown in SEQ ID No.1, and the nucleotide sequence of the target DNA is shown in SEQ ID No.2. That is, the substrate strand of the GR-5 DNA enzyme is the target DNA, and this target DNA can activate the Cas12a protein in the CRISPR-Cas12a system to trans-cleave the non-specific single-stranded DNA in the biosensor. The inventors found that in this preferred embodiment, the specific enzyme has higher selectivity for lead ions, making the detection of lead ions more accurate, rapid, and efficient.

[0062] GR-5 DNA enzyme (SEQ ID No.1, 5’-3’): ACAGACATCATCTCTGAAGTAGCGCCGCCGTATAGTGAGAAACTCACTATrA GGAAGAGATGATGTCTGTAGTT , which has an rA site, and the underlined part is the target DNA;

[0063] Target DNA (SEQ ID No.2, 5’-3’): GGAAGAGATGATGTCTGTAGTT.

[0064] According to the present invention, preferably, the process of mixing the specific enzyme with the sample to be tested includes: heating the solution containing the specific enzyme in a water bath, annealing it, and then mixing and shaking it with the sample to be tested. The inventors found that under this preferred embodiment, pretreating and activating the specific enzyme before mixing it with the sample to be tested can further improve the selectivity of the specific enzyme for lead ions, thereby improving the sensitivity of lead ion detection.

[0065] According to the present invention, preferably, the conditions for the water bath heating include: the temperature is 80 - 95 °C, specifically it can be 85 °C, 90 °C, 95 °C, and any value within the range formed by any two of these point values; the time is 3 - 8 min, specifically it can be 3 min, 4 min, 5 min, 6 min, 7 min, 8 min, and any value within the range formed by any two of these point values; the conditions for the mixing and shaking include: the temperature is 30 - 45 °C, specifically it can be 30 °C, 33 °C, 36 °C, 39 °C, 42 °C, 45 °C, and any value within the range formed by any two of these point values; the time is 60 - 90 min, specifically it can be 60 min, 70 min, 80 min, 90 min, and any value within the range formed by any two of these point values.

[0066] According to the present invention, preferably, the solvent used for the solution containing the specific enzyme is Tris-HCl buffer. For example, a Tris-HCl buffer with a concentration of 0.05 - 0.15 mol / L (containing 0.1 - 0.3 mol / L of NaCl) can be used as the solvent for the specific enzyme, and the pH of the Tris-HCl buffer is approximately 7.4.

[0067] According to the present invention, preferably, the concentration of the specific enzyme in the solution containing the specific enzyme is 3 - 8 μM, and the concentration of lead ions in the sample to be tested is 0.8 - 2500 nM.

[0068] According to the present invention, in step (1), the molar ratio of the specific enzyme to lead ions in the sample to be tested is 2 - 6150:1. The inventors found that under this preferred embodiment, the detection sensitivity and accuracy of lead ions can be further improved.

[0069] According to the present invention, preferably, the mixture II to be tested in step (1) further contains a masking agent; the masking agent is selected from at least one of ethylenediaminetetraacetic acid, dimercaptoacetone, and mercaptoacetic acid; more preferably ethylenediaminetetraacetic acid (EDTA). The inventors found that under this preferred embodiment, EDTA can act as a masking agent to complex with lead ions in the sample to be tested, reducing the influence of lead ions on the trans-cleavage effect of Cas12a protein and improving the detection accuracy and sensitivity. In the present invention, preferably, the addition amount of the masking agent and the molar amount of lead ions in the sample to be tested are 1:1.

[0070] According to the present invention, preferably, the CRISPR-Cas12a system solution in step (1) can adopt the publicly disclosed system solution. Exemplarily, the CRISPR-Cas12a system solution contains crRNA, Cas12a protein, ribonuclease inhibitor, and buffer; wherein, the nucleotide sequence of the crRNA is as shown in SEQ ID No.4; the Cas12a protein, ribonuclease inhibitor, and buffer can all be commercially available, or can be synthesized by oneself through the methods disclosed in the prior art.

[0071] crRNA (SEQ ID No.4, 5'-3'): UAAUUUCUACUAAGUGUAGAU AACUACAGACAUCAUCUCUUCC , where the underlined part is the part that pairs with the target DNA.

[0072] According to the present invention, the volume ratio of crRNA, Cas12a protein, ribonuclease inhibitor, and buffer can be 0.5-2:0.5-2:0.5-1.5:2, and the addition amount of the test mixture I can be added according to its concentration. Exemplarily, the total volume after mixing the test mixture I and the CRISPR-Cas12a system solution can be 20 μL, and its preparation method includes: mixing 2 μL of 10*Buffer (buffer), 1 μL of ribonuclease inhibitor (Rnase Inhibitors), 1 μL of crRNA, 2 μL of Cas12a protein with 2 μL of the test mixture I, and finally supplementing to 20 μL with ultrapure water, and performing mixing reaction I to assemble and form the CRISPR-Cas12a system as the test mixture II.

[0073] According to the present invention, the conditions of the mixing reaction I include: the temperature is 30-45 °C, specifically it can be 30 °C, 33 °C, 36 °C, 39 °C, 42 °C, 45 °C, and any value within the range formed by any two of these point values; the time is 20-35 min, specifically it can be 20 min, 25 min, 30 min, 35 min, and any value within the range formed by any two of these point values.

[0074] According to the present invention, the biosensor uses a biosensor containing single-stranded DNA, which can cooperate with the CRISPR-Cas12a system to form a change in the color reaction effect, so as to realize the detection of lead ions. Preferably, in step (2), the biosensor includes magnetic beads with streptavidin modified on the surface, single-stranded DNA modified with biotin, and amino-functionalized manganese dioxide nanorods. The single-stranded DNA is connected to the streptavidin on the magnetic beads through the biotin, and one end of the single-stranded DNA far from the magnetic beads is connected to the amino-functionalized manganese dioxide nanorods. The inventors found that under this preferred embodiment, based on the connection structure of magnetic beads, single-stranded DNA, and manganese dioxide nanorods, after the activated Cas12a protein cleaves the single-stranded DNA in the biosensor, the manganese dioxide nanorods fall off, and the presence of lead ions can be better characterized through the difference in the color reaction, further improving the detection sensitivity.

[0075] According to the present invention, preferably, the nucleotide sequence of the single-stranded DNA is as shown in SEQ ID No. 3; in the present invention, biotin is modified at the 3'-end of the single-stranded DNA.

[0076] Single-stranded DNA (SEQ ID No. 3): 5'-TTTTTTATTTATTATATTATTTATATTATTTTTATTTATTTTATTTTATTATTATTTTTT-3'.

[0077] According to the present invention, preferably, relative to 1 mg of the magnetic beads with streptavidin modified on the surface, the dosage of the single-stranded DNA modified with biotin is 1×10 -4 -3×10 -4 μmol, and the dosage of the amino-functionalized manganese dioxide nanorods is 0.05 - 0.15 mg. The inventors found that under this preferred embodiment, it is beneficial to improve the structural stability of the biosensor, thereby improving the accuracy of lead ion detection.

[0078] According to the present invention, preferably, the preparation method of the biosensor includes the following steps:

[0079] (1-1) In reaction solvent I, the single-stranded DNA modified with biotin and carboxyl is mixed with magnetic beads with streptavidin modified on the surface for reaction I, so that the single-stranded DNA is connected to the streptavidin on the magnetic beads through the biotin, and then magnetic separation I is carried out to obtain magnetic bead-DNA;

[0080] (1-2) In reaction solvent II, the magnetic bead-DNA is incubated with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide, and then magnetic separation II is carried out to obtain carboxyl-activated magnetic bead-DNA;

[0081] (1 - 3) In reaction solvent III, the carboxyl-activated magnetic bead-DNA is mixed with the aminated manganese dioxide nanorods for Reaction II, such that the end of the single-stranded DNA far from the magnetic bead is connected to the aminated manganese dioxide nanorods, and then the biosensor is obtained through magnetic separation III.

[0082] In the present invention, the single-stranded DNA modified with biotin and carboxyl is the single-stranded DNA modified with carboxyl at the 5'-end and biotin at the 3'-end, and the specific nucleotide sequence is: 5'-COOH-TTTTTTATTTATTATATTATTTATATTATTTTTATTTATTTTATTTTATTATTATTTTTT-Biotin-3'.

[0083] In the present invention, the aminated manganese dioxide nanorods can be commercially obtained or prepared according to the preparation methods in the prior art. Exemplarily, the aminated manganese dioxide nanorods can refer to Visible Light Active Single-Crystal Nanorod / Needle-like alpha-MnO2@RGO Nanocomposites for Efficient Photoreduction of Cr(VI)[J].Journal of Physical Chemistry C,2017,121(11):6039 - 6049.; A sensitive immunoassay for simultaneous detection of foodborne pathogens using MnO2 nanoflowers-assisted loading and release of quantum dots; The specific process can be as follows: Dissolve MnSO4·H2O and (NH4)2S2O8 in distilled water, add nitrogen and stir at room temperature, then transfer the mixture to a polytetrafluoroethylene-lined stainless steel autoclave, react under hydrothermal conditions, after cooling to room temperature, centrifuge to collect the brownish-black precipitate, wash it several times with distilled water and ethanol, and dry it overnight to obtain manganese dioxide nanorods; Disperse the prepared manganese dioxide nanorods in ethanol, after introducing N2 and stirring, add 3-aminopropyltriethoxysilane to functionalize the manganese dioxide nanorods, stir and then centrifuge, wash the solid product several times with ethanol and deionized water, and then dry it in an oven to obtain the aminated manganese dioxide nanorods.

[0084] In the present invention, magnetic separation I, magnetic separation II, and magnetic separation III are respectively performed by magnetic separation using a magnet.

[0085] According to the present invention, in step (1-1), the mixing of the single-stranded DNA modified with biotin and carboxyl and the magnetic beads surface-modified with streptavidin can be that one of them is dissolved in reaction solvent I and then mixed with the other, or both are dissolved in reaction solvent I and then mixed; preferably, both are dissolved in reaction solvent I and then mixed. Further preferably, the concentration of the single-stranded DNA modified with biotin and carboxyl dissolved in reaction solvent I is 1-3 μmol / L, and the concentration of the magnetic beads surface-modified with streptavidin dissolved in reaction solvent I is 5-15 mg / mL. The inventors have found that under this preferred specific embodiment, it is beneficial to improve the efficiency of reaction I and enhance the binding interaction between streptavidin (SA) and biotin (bio).

[0086] According to the present invention, in step (1-2), the mixing of the magnetic bead-DNA, 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide can be that one of them is dissolved in reaction solvent II and then mixed with the other two, or two of them are dissolved in reaction solvent II respectively and then mixed with the other one, or all three are dissolved in reaction solvent II and then mixed; preferably, all three are dissolved in reaction solvent II and then mixed. Further preferably, the concentration of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride dissolved in reaction solvent II is 35-45 mmol / L, and the concentration of N-hydroxysuccinimide dissolved in reaction solvent II is 5-15 mmol / L. The inventors have found that under this preferred specific embodiment, it is beneficial to improve the efficiency of incubation and effectively activate the carboxyl groups on the single-stranded DNA in the magnetic bead-DNA.

[0087] According to the present invention, in step (1-3), the mixing of the carboxyl-activated magnetic bead-DNA and the amino-functionalized manganese dioxide nanorods can be that one of them is dissolved in reaction solvent III and then mixed with the other, or both are dissolved in reaction solvent III and then mixed; preferably, both are dissolved in reaction solvent III and then mixed. Further preferably, the concentration of the amino-functionalized manganese dioxide nanorods dissolved in reaction solvent III is 0.5-1.5 mg / mL. The inventors have found that under this preferred specific embodiment, it is beneficial to improve the efficiency of reaction II and enhance the connection effect between the single-stranded DNA and the manganese dioxide nanorods.

[0088] According to the present invention, preferably, the reaction solvent I, the reaction solvent II and the reaction solvent III are each independently water and / or Tris-HCl buffer; more preferably Tris-HCl buffer. The Tris-HCl buffer can specifically be a Tris-HCl buffer with a concentration of 0.05 - 0.15 mol / L, a pH of 7 - 8 (containing 0.1 - 0.3 mol / L of NaCl).

[0089] According to the present invention, preferably, relative to 1 mg of the magnetic beads surface-modified with streptavidin, the dosage of the reaction solvent I is 15 - 25 μL, the dosage of the reaction solvent II is 15 - 25 μL, the dosage of the reaction solvent III is 8 - 12 μL, the dosage of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride is 3 - 5 μmol, and the dosage of N-hydroxysuccinimide is 0.5 - 1.5 μmol.

[0090] According to the present invention, preferably, the conditions for the reaction I in step (1-1) include: the temperature is 30 - 45 °C, for example, it can be 30 °C, 35 °C, 40 °C, 45 °C, and any value within the range formed by any two of these point values; the time is 6 - 8 h, for example, it can be 6 h, 7 h, 8 h, and any value within the range formed by any two of these point values. Exemplarily, the reaction I is carried out by means of a constant temperature water bath.

[0091] According to the present invention, preferably, step (1-1) further includes: washing the substance obtained by the magnetic separation I to obtain the magnetic bead-DNA. The number of washing times can be one or more, and the washing can be carried out with water or Tris-HCl buffer to remove the unbound single-stranded DNA and prevent it from remaining on the surface of the magnetic bead-DNA, so as to improve the accuracy of the color reaction for detecting lead ions.

[0092] According to the present invention, preferably, the conditions for the incubation in step (1-2) include: the temperature is 30 - 45 °C, for example, it can be 30 °C, 35 °C, 40 °C, 45 °C, and any value within the range formed by any two of these point values; the time is 10 - 15 h, for example, it can be 10 h, 11 h, 12 h, 13 h, 14 h, 15 h, and any value within the range formed by any two of these point values. In the present invention, the carboxyl groups on the single-stranded DNA in the magnetic bead-DNA are activated through the incubation process.

[0093] According to the present invention, preferably, the conditions for Reaction II in step (1-3) include: the temperature is 30-45°C, for example, it can be 30°C, 35°C, 40°C, 45°C, and any value within the range formed by any two of these point values; the time is 5-12 h, for example, it can be 5 h, 6 h, 7 h, 8 h, 9 h, 10 h, 11 h, 12 h, and any value within the range formed by any two of these point values.

[0094] According to the present invention, preferably, step (1-3) further includes: washing the substance obtained by the magnetic separation III to obtain the biosensor. The number of washing times can be one or more, and water or Tris-HCl buffer solution can be used for washing to remove the residual free reagents on the biosensor.

[0095] According to the present invention, preferably, the conditions for the mixed reaction II in step (2) include: the temperature is 30-45°C, for example, it can be 30°C, 35°C, 40°C, 45°C, and any value within the range formed by any two of these point values; the rotation speed is 750-1250 rpm, for example, it can be 750 rpm, 850 rpm, 950 rpm, 1050 rpm, 1150 rpm, 1250 rpm, and any value within the range formed by any two of these point values; the time is 2-4 h, for example, it can be 2 h, 3 h, and 4 h, and any value within the range formed by any two of these point values.

[0096] According to the present invention, the color developer in step (2) can be any color developer suitable for the catalytic oxidation of manganese dioxide. Preferably, the color developer in step (2) is 3,3',5,5'-tetramethylbenzidine.

[0097] According to the present invention, preferably, the wavelength of the absorbance value is 620-680 nm. Exemplarily, it can be 650 nm.

[0098] In the present invention, the solid-liquid separation can adopt conventional solid-liquid separation methods in the art, such as centrifugation, filtration, etc.

[0099] According to the present invention, in step (2), determining whether the sample to be tested contains lead ions is based on using the solution obtained by mixing an equal initial amount of the biosensor and an equal amount of the chromogenic agent in the reaction solution to be tested for the chromogenic reaction as a control solution. The color of the chromogenic reaction solution can be directly compared with that of the control solution, or can be compared by absorbance values. Preferably, the process of determining whether the sample to be tested contains lead ions in step (2) includes: mixing an equal initial amount of the biosensor in the reaction solution to be tested with an equal amount of the chromogenic agent in step (2) for the chromogenic reaction and detecting the absorbance value as the control absorbance value, detecting the absorbance value of the chromogenic reaction solution as the sample absorbance value, and comparing or quantitatively calculating the sample absorbance value with the control absorbance value. For example, by recording the change in the sample absorbance value at different lead ion concentrations, plotting the standard curve of lead ion concentration vs. absorbance value, and based on the standard curve and the absorbance value of the chromogenic reaction solution, the lead ions in the sample to be tested are quantified.

[0100] According to a particularly preferred embodiment of the present invention, referring to Figure 1 , the method for detecting lead ions based on the CIRSPR-Cas system includes the following steps:

[0101] (1) Mix a solution containing single-stranded DNA modified with biotin and carboxyl with a solution containing magnetic beads surface-modified with streptavidin, and react at a temperature of 30 - 45 °C for 6 - 8 h, so that the single-stranded DNA is linked to the streptavidin on the magnetic beads through the biotin, and then magnetic separation I and washing are carried out to obtain magnetic bead-DNA. For 1 mg of the magnetic beads surface-modified with streptavidin, the amount of the single-stranded DNA modified with biotin is 1×10 -4 -3×10 -4 μmol, and the amount of reaction solvent I is 15 - 25 μL;

[0102] (2) After preparing the magnetic bead-DNA obtained in step (1) into a solution, mix it with a solution containing 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and a solution containing N-hydroxysuccinimide, and incubate at a temperature of 30 - 45 °C for 10 - 15 h, and then magnetic separation II is carried out to obtain carboxyl-activated magnetic bead-DNA. For 1 mg of the magnetic beads surface-modified with streptavidin, the amount of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride is 3 - 5 μmol, the amount of N-hydroxysuccinimide is 0.5 - 1.5 μmol, and the amount of reaction solvent II is 15 - 25 μL;

[0103] (3) Mix the solution containing the carboxyl-activated magnetic bead-DNA with the solution containing the aminated manganese dioxide nanorods, and react at a temperature of 30-45 °C for 5-12 h, so that one end of the single-stranded DNA away from the magnetic bead is connected to the aminated manganese dioxide nanorods. Then, after magnetic separation III and washing, a biosensor MBs-DNA-MnO2 is obtained. The dosage of the aminated manganese dioxide nanorods is 0.05-0.15 mg relative to 1 mg of the magnetic beads surface-modified with streptavidin;

[0104] (4) Dissolve the GR-5 DNAzyme containing the target DNA in Tris-HCl buffer (the concentration of the specific enzyme is 3-8 μM), heat it in a water bath at a temperature of 80-95 °C for 3-8 min, anneal it, and then mix it with the test sample that may contain lead ions (Pb 2+ ), the concentration of lead ions is 0.8-2500 nM) and shake it at a temperature of 30-45 °C for 60-90 min to form a test mixture I. Among them, the target DNA can activate the Cas12a protein in the CRISPR-Cas12a system. Mix the test mixture I with the CRISPR-Cas12a system solution at a temperature of 30-45 °C and react for 20-35 min to obtain a test mixture II;

[0105] (5) Mix the test mixture II obtained in step (4) with the biosensor MBs-DNA-MnO2 obtained in step (3) at a temperature of 30-45 °C and react for 2-4 h to obtain a test reaction solution. Mix the precipitate obtained by solid-liquid separation of the test reaction solution with a chromogenic agent 3,3',5,5'-tetramethylbenzidine for a chromogenic reaction to obtain a chromogenic reaction solution, and perform colorimetric analysis or absorbance value detection analysis on the chromogenic reaction solution to determine whether the test sample contains lead ions.

[0106] The present invention will be described in detail below through examples.

[0107] In the following examples, Tris (Tris(hydroxymethyl)aminomethane), EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride), NHS (N-hydroxysuccinimide), TMB (3,3',5,5'-tetramethylbenzidine), and EDTA (ethylenediaminetetraacetic acid) were purchased from Aladdin Industrial Corporation (Shanghai, China); GR-5 DNA enzyme was synthesized by GenScript (Nanjing, China) and simply purified by HPLC. The nucleotide sequence of GR-5 DNA enzyme is shown in SEQ ID No.1, which contains the target DNA fragment activating Cas12a protein shown in SEQ ID No.2; magnetic beads surface-modified with streptavidin were purchased from Suzhou Beaver Biomedical Engineering Co., Ltd.; single-stranded DNA and crRNA modified with biotin and carboxyl were purchased from Sangon Biotech (Shanghai) Co., Ltd. The nucleotide sequence of single-stranded DNA is shown in SEQ ID No.3, and the nucleotide sequence of crRNA is shown in SEQ ID No.4; Cas12a protein was purchased from GenScript Biotech Corporation, and the product numbers are Z03502; ribonuclease inhibitor was purchased from Sangon Biotech Co., Ltd., and the product number is B600478-0001; lead ion standard was purchased from Shanghai Jiji Biochemical Technology Co., Ltd., and the product number is L26415; other raw materials and reagents are conventional commercially available products. The microplate reader was purchased from China Gene Co., Ltd.; the metal mixer was provided by Shanghai Nenggong Industrial Co., Ltd.

[0108] In the following examples, the Tris-HCl buffer was a 0.1 mol / L Tris-HCl solution (0.2 mol / L NaCl, pH 7.4); the magnetic bead washing buffer (20 mmol / L hydrochloric acid, 140 mmol / L sodium chloride, 5 mmol / L magnesium chloride, pH 7.4); the 20 mmol / L hydrochloric acid buffer (20 mmol / L Tris, 140 mmol / L sodium chloride, 5 mmol / L magnesium chloride, pH 7.4); the buffer in CRISPR (pH 7.5) consisted of 2 mM Tris (pH 7.5), 1% glycerol, and 0.5 mM NaCl.

[0109] In the following examples, unless otherwise specified, room temperature refers to 25 ± 5 °C; the relative absorbance value ΔA was calculated by the following formula: ΔA = A0 - A, where A0 is the control absorbance value and A is the sample absorbance value.

[0110] Preparation Example

[0111] Preparation method of amino-functionalized manganese dioxide nanorods: Dissolve 6.7 g of MnSO4·H2O and 13.69 g of (NH4)2S2O8 in 40 mL of distilled water, add nitrogen and stir at room temperature for 2 h, then transfer the mixed solution to a polytetrafluoroethylene-lined stainless steel autoclave (40 mL), and react under hydrothermal conditions at 140 °C for 24 h. After cooling to room temperature, centrifuge to collect the brownish-black precipitate, wash it several times with distilled water and ethanol, and dry it overnight to obtain manganese dioxide nanorods; Disperse 50 mg of manganese dioxide nanorods in 20 mL of ethanol, after introducing N2 and stirring for 1 h, add 0.2 mL of 3-aminopropyltriethoxysilane to functionalize the manganese dioxide nanorods, stir for 12 h and then centrifuge, wash the solid product with ethanol and deionized water for several times, and then dry it in an oven at 60 °C for 12 h to obtain amino-functionalized manganese dioxide nanorods.

[0112] Example 1

[0113] (1) Mix 10 μL of a solution containing single-stranded DNA modified with biotin and carboxyl (concentration: 2 μmol / L) with 10 μL of a solution containing magnetic beads surface-modified with streptavidin (concentration: 10 mg / mL), and carry out a constant-temperature water bath reaction at 37 °C for 6 h, so that the single-stranded DNA is connected to the streptavidin on the magnetic beads through biotin, and then perform magnetic separation I and wash twice to remove the unbound single-stranded DNA to obtain magnetic bead-DNA;

[0114] (2) Mix the magnetic bead-DNA obtained in step (1) dissolved in 10 μL of a Tris-HCl buffer solution with 10 μL of a solution containing 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride at a concentration of 40 mM and a solution containing N-hydroxysuccinimide at a concentration of 10 mM, and incubate at 37 °C for 12 h to activate the carboxyl group on the single-stranded DNA in the magnetic bead-DNA, and then perform magnetic separation II to obtain carboxyl-activated magnetic bead-DNA;

[0115] (3) Disperse the carboxyl-activated magnetic bead-DNA obtained in step (2) in Tris-HCl buffer solution, mix it with 10 μL of a solution of amino-functionalized manganese dioxide nanorods (obtained from the preparation example) at a concentration of 1 mg / mL, and carry out a reaction at 37 °C for 8 h, so that the end of the single-stranded DNA far from the magnetic bead is connected to the amino-functionalized manganese dioxide nanorods, and then perform magnetic separation III and washing to obtain the biosensor MBs-DNA-MnO2;

[0116] (4) Add 2 μL of a solution of GR-5 DNAzyme (concentration: 10 μM) to 2 μL of Tris-HCl buffer solution, heat it in a water bath at 95 °C for 5 min, after annealing, take 2 μL of GR-5 DNAzyme and 2 μL of lead ions (Pb2+ The stock solution with a concentration of 48 nM was mixed in a metal mixer and shaken at 37 °C for 60 min to form test mixture I. 2 μL of Cas12a (concentration: 100 nM), 1 μL of crRNA (concentration: 500 nM), 2 μL of test mixture I, 2 μL of 10× Buffer, and 13 μL of ultrapure water were mixed and incubated in a 37 °C water bath for 30 min to assemble a CRISPR system as test mixture II;

[0117] (5) The test mixture II obtained in step (4) was mixed with 0.01 mg of the biosensor MBs-DNA-MnO₂ obtained in step (3) and shaken and incubated at 37 °C in a metal mixer for 3 h to obtain a test reaction solution. The test reaction solution was subjected to solid-liquid separation to remove the supernatant to obtain a precipitate; 0.01 mg of the biosensor MBs-DNA-MnO₂ obtained in step (3) was used as a control. After the precipitate and the control were respectively mixed with 100 μL of 3,3',5,5'-tetramethylbenzidine with a concentration of 2 mM for a color reaction, the color of the color reaction solution of the precipitate was significantly lighter than that of the color reaction solution of the control; the absorbance at 650 nm was recorded with an enzyme-linked immunosorbent assay (ELISA) reader to obtain the sample absorbance value A of 0.896 and the control absorbance value A₀ of 0.416, and the relative absorbance value ΔA = 0.48 was calculated.

[0118] After the amino-functionalized manganese dioxide nanorods in step (3) of Example 1, the biosensor obtained in step (3), and the precipitate in step (5) were respectively mixed with 100 μL of 3,3',5,5'-tetramethylbenzidine with the same concentration for a color reaction, the absorption spectra were as Figure 2 shown.

[0119] Example 2

[0120] (1) 5 μL of a solution containing single-stranded DNA modified with biotin and carboxyl (concentration: 1 μmol / L) was mixed with 10 μL of a solution containing magnetic beads surface-modified with streptavidin (concentration: 5 mg / mL), and the mixture was reacted in a constant-temperature water bath at 30 °C for 8 h, so that the single-stranded DNA was connected to the streptavidin on the magnetic beads through biotin. Then, magnetic separation I and two washes were performed to remove the unbound single-stranded DNA to obtain magnetic bead-DNA;

[0121] (2) The solution formed by dissolving the magnetic bead-DNA obtained in step (1) in 10 μL of Tris-HCl buffer is mixed with 5 μL of a 35 mM solution containing 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and 5 μL of a 5 mM solution containing N-hydroxysuccinimide, and incubated at 30 °C for 15 h to activate the carboxyl groups on the single-stranded DNA in the magnetic bead-DNA, and then carboxyl-activated magnetic bead-DNA is obtained by magnetic separation II;

[0122] (3) The carboxyl-activated magnetic bead-DNA obtained in step (2) is dispersed in Tris-HCl buffer and mixed with 5 μL of a solution of amino-functionalized manganese dioxide nanorods (obtained from the preparation example) with a concentration of 1 mg / mL, and reacted at 30 °C for 12 h to connect the end of the single-stranded DNA far from the magnetic bead to the amino-functionalized manganese dioxide nanorods, and then a biosensor MBs-DNA-MnO2 is obtained by magnetic separation III and washing;

[0123] (4) 2 μL of a solution of GR-5 DNAzyme (concentration 8 μM) is added to 2 μL of Tris-HCl buffer, heated in a water bath at 80 °C for 8 min, and after annealing, 2 μL of GR-5 DNAzyme is mixed with 2 μL of lead ion (Pb 2+ concentration 40 nM) stock solution, 40 nM of EDTA in a metal mixer, and shaken at 30 °C for 90 min to form a test mixture I. 2 μL of Cas12a (concentration 100 nM), 1 μL of crRNA (concentration 500 nM), 2 μL of the test mixture I, 2 μL of 10*Buffer, and 13 μL of ultrapure water are mixed and incubated in a water bath at 37 °C for 30 min to assemble a CRISPR system as a test mixture II;

[0124] (5) The test mixture II obtained in step (4) is mixed with 0.01 mg of the biosensor MBs-DNA-MnO2 obtained in step (3) and shaken and incubated at 37 °C in a metal mixer for 3 h to obtain a test reaction solution. The test reaction solution is subjected to solid-liquid separation to remove the supernatant to obtain a precipitate; 0.01 mg of the biosensor MBs-DNA-MnO2 obtained in step (3) is used as a control, and the precipitate and the control are respectively mixed with 100 μL of 3,3',5,5'-tetramethylbenzidine with a concentration of 2 mM for a color reaction. The color of the color reaction solution of the precipitate is significantly lighter than the color of the color reaction solution of the control; the absorbance at 650 nm is recorded with an enzyme-labeling instrument to obtain the sample absorbance value A and the control absorbance value A0, and the relative absorbance value ΔA is calculated. Taking the sample relative absorbance value ΔA when EDTA is added as 100%, the sample relative absorbance value ΔA without adding EDTA is 54%.

[0125] The relative absorbance value ΔA of the samples measured in Example 2 was compared, and the results are as Figure 3 shown.

[0126] Considering that lead ions, as heavy metal ions, can affect the trans-cleavage effect of Cas12a protein, EDTA was added as a masking agent in Example 2 to complex with lead ions, making the trans-cleavage effect of Cas12a protein significantly better than that without adding EDTA, indicating that lead ions do affect the role of Cas12a protein in the entire CRISPR system.

[0127] Example 3

[0128] (1) Mix 20 μL of a solution containing single-stranded DNA modified with biotin and carboxyl (concentration: 3 μmol / L) with 10 μL of a solution containing magnetic beads with streptavidin surface modification (concentration: 15 mg / mL), and perform a constant-temperature water bath reaction at 45 °C for 6 h, so that the single-stranded DNA is connected to the streptavidin on the magnetic beads through biotin, and then perform magnetic separation I and wash twice to remove the unbound single-stranded DNA to obtain magnetic bead-DNA;

[0129] (2) Dissolve the magnetic bead-DNA obtained in step (1) in a solution formed by 10 μL of Tris-HCl buffer, mix it with 10 μL of a solution containing 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride with a concentration of 45 mM and a solution containing N-hydroxysuccinimide with a concentration of 15 mM, and incubate at 45 °C for 10 h to activate the carboxyl group on the single-stranded DNA in the magnetic bead-DNA, and then perform magnetic separation II to obtain carboxyl-activated magnetic bead-DNA;

[0130] (3) Disperse the carboxyl-activated magnetic bead-DNA obtained in step (2) in Tris-HCl buffer, mix it with 15 μL of a solution containing amino-functionalized manganese dioxide nanorods (obtained in the preparation example) with a concentration of 3 mg / mL, and react at 45 °C for 5 h, so that the end of the single-stranded DNA far from the magnetic bead is connected to the amino-functionalized manganese dioxide nanorods, and then perform magnetic separation III and wash to obtain the biosensor MBs-DNA-MnO2;

[0131] (4) Add 2 μL of a solution of GR-5 DNAzyme (concentration: 14 μM) to 2 μL of Tris-HCl buffer, heat it in a water bath at 95 °C for 3 min, and after annealing, take 2 μL of GR-5 DNAzyme and 2 μL of lead ions (Pb 2+The stock solution with a concentration of 60 nM was mixed in a metal mixer and shaken at 45 °C for 60 min to form the test mixture I. Then, 2 μL of Cas12a (concentration: 100 nM), 1 μL of crRNA (concentration: 500 nM), 2 μL of the test mixture I, 2 μL of 10* Buffer, and 13 μL of ultrapure water were mixed and incubated at 45 °C in a water bath for 20 min to assemble the CRISPR system as the test mixture II;

[0132] (5) The test mixture II obtained in step (4) was mixed with 0.01 mg of the biosensor MBs-DNA-MnO2 obtained in step (3) in a metal mixer and incubated with shaking at 37 °C and rotation speeds of 0 rpm, 300 rpm, 500 rpm, 800 rpm, 1000 rpm, and 1200 rpm for 3 h to obtain the test reaction solution. The test reaction solution was subjected to solid-liquid separation to remove the supernatant to obtain a precipitate. Taking 0.01 mg of the biosensor MBs-DNA-MnO2 obtained in step (3) as a control, after the precipitate and the control were respectively mixed with 100 μL of 3,3',5,5'-tetramethylbenzidine with a concentration of 2 mM for a color reaction, the color of the color reaction solution of the precipitate was significantly lighter than that of the color reaction solution of the control; The absorbance at 650 nm was recorded with an enzyme-linked immunosorbent assay (ELISA) reader to obtain the sample absorbance value A and the control absorbance value A0, and the relative absorbance value ΔA of each sample was calculated. Taking the relative absorbance value ΔA of the sample at 1000 rpm as the reference 100%, the relative percentage value of the relative absorbance value ΔA of each other sample was calculated, and the results were as Figure 4 shown.

[0133] During the incubation of the biosensor with the activated Cas12a protein, the sedimentation of the magnetic beads will affect the progress of the reaction. By vibrating and mixing with a metal mixer, the reaction effect can be maximized. As Figure 4 shown, as the incubation rotation speed of the CRISPR system increases, the color change of the color reaction solution becomes larger and larger and finally stabilizes. When there is too little liquid in the centrifuge tube of the metal mixer and the centrifuge tube is relatively small, after the centrifuge tube is placed in the metal mixer, the higher the incubation rotation speed of the CRISPR system, the easier it is to shake randomly, so that the centrifuge tube flies out of the card slot, resulting in the inability to carry out the color reaction smoothly. Therefore, the incubation rotation speed of the CRISPR system is selected as 1000 rpm to ensure that the centrifuge tube does not fly out of the card slot and enable the CRISPR system to be well mixed to achieve the best detection effect for lead ions.

[0134] Example 4

[0135] The detection of lead ions was carried out according to the method of adding EDTA in Example 2, except that step (5) was replaced with:

[0136] (5) Mix the test mixture II obtained in step (4) with 0.01 mg of the biosensor MBs-DNA-MnO2 obtained in step (3), and set the molar ratios of Cas12a protein to crRNA to 1:0.25, 1:0.5, 1:1, 1:1.25, and 1:2.5 respectively. After shaking and incubating at 37 °C in a metal mixer for 3 h, the test reaction solution is obtained. Separate the solid from the liquid of the test reaction solution to remove the supernatant, and use 0.01 mg of the biosensor obtained in step (3) as a control. After mixing the precipitate and the control with 100 μL of 3,3',5,5'-tetramethylbenzidine with a concentration of 2 mM for a color reaction, the color of the color reaction solution of the precipitate is significantly lighter than that of the color reaction solution of the control. Use a microplate reader to record the absorbance at 650 nm to obtain the sample absorbance value A and the control absorbance value A0, calculate the relative absorbance value △A of each sample, and take the relative absorbance value △A of the sample when the molar ratio of Cas12a protein to crRNA is 1:1 as the benchmark of 100%, and calculate the relative percentage value of the relative absorbance value △A of each other sample. The results are as Figure 5 shown.

[0137] As Figure 5 shown, when the molar ratio of Cas12a protein to crRNA is 1:1, the CRISPR system has the best detection effect on lead ions. Therefore, the optimal ratio of Cas12a protein to crRNA is determined to be 1:1.

[0138] Example 5

[0139] Detect lead ions according to the method of adding EDTA in Example 2, except that step (5) is replaced with:

[0140] (5) Mix the test mixture II obtained in step (4) with 0.01 mg of the biosensor MBs-DNA-MnO2 obtained in step (3), and shake and incubate at temperatures of 20 °C, 25 °C, 30 °C, 37 °C, and 45 °C in a metal mixer for 3 h to obtain the test reaction solution. Separate the solid from the liquid of the test reaction solution to remove the supernatant to obtain a precipitate. Use 0.01 mg of the biosensor obtained in step (3) as a control. After mixing the precipitate and the control with 100 μL of 3,3',5,5'-tetramethylbenzidine with a concentration of 2 mM for a color reaction, the color of the color reaction solution of the precipitate is significantly lighter than that of the color reaction solution of the control. Use a microplate reader to record the absorbance at 650 nm to obtain the sample absorbance value A and the control absorbance value A0, calculate the absorbance value △A of each sample, and take the relative absorbance value △A of the sample at 37 °C in the metal mixer as the benchmark of 100%, and calculate the relative percentage value of the relative absorbance value △A of each other sample. The results are as Figure 6 shown.

[0141] As Figure 6As shown, the incubation temperature range of the CRISPR system is 20 - 45°C. The color change of the color reaction solution becomes larger and larger at 20 - 37°C, reaches the highest point at 37°C, and gradually decreases after 37°C. Therefore, the optimal incubation temperature of the CRISPR system and the bioreactor is 37°C.

[0142] Example 6

[0143] The detection of lead ions was carried out according to the method of adding EDTA in Example 2, except that step (5) was replaced with:

[0144] (5) Mix the test mixture II obtained in step (4) with 0.01 mg of the biosensor MBs - DNA - MnO2 obtained in step (3), shake and incubate in a metal mixer at a temperature of 37°C for 0.5 h, 1 h, 1.5 h, 2 h, 2.5 h, 3 h, 3.5 h to obtain the test reaction solution. After the solid - liquid separation of the test reaction solution to remove the supernatant to obtain a precipitate, using 0.01 mg of the biosensor obtained in step (3) as a control, after mixing the precipitate and the control with 100 μL of 3,3',5,5'-tetramethylbenzidine with a concentration of 2 mM for color development reaction, the color of the color reaction solution of the precipitate is significantly lighter than that of the color solution of the control; record the absorbance at 650 nm with an enzyme - linked immunosorbent assay instrument to obtain the sample absorbance value A and the control absorbance value A0, calculate the absorbance value ΔA of each sample, taking the relative absorbance value ΔA of the sample at 3 h of shaking and incubation as the reference 100%, calculate the relative percentage of the relative absorbance value ΔA of other samples, and the results are as Figure 7 shown.

[0145] For the incubation time of the biosensor and the activated Cas12a protein, optimization was carried out in the range of 0.5 - 3.5 h. As Figure 7 shown, the color of the color reaction solution starts to increase from 0.5 h and stabilizes after 3 h, indicating that the trans - cleavage of single - stranded DNA in the biosensor by Cas12a protein has been completed. Therefore, the optimal incubation time of the CRISPR system and the bioreactor is 3 h.

[0146] Example 7

[0147] The detection of lead ions was carried out according to the method of Example 2, except that steps (4) and (5) were replaced with:

[0148] (4) Add 2 μL of the solution of GR - 5 DNA enzyme (concentration 10 μM) to 2 μL of Tris - HCl buffer solution, heat in a water bath at 95°C for 5 min. After annealing, take 2 μL of GR - 5 DNA enzyme and 2 μL of lead ion stock solution (Pb 2+Samples with concentrations of 0.8 nM, 4 nM, 20 nM, 100 nM, 500 nM, and 2.5 μM were first shaken in a 37°C metal mixer for 60 min, and then an equimolar amount of EDTA was added to complex with lead ions to form test mixture I. 2 μL of Cas12a (concentration: 250 nM), 1 μL of crRNA (concentration: 500 nM), 2 μL of test mixture I, 2 μL of 10× Buffer, and 13 μL of ultrapure water were mixed and incubated in a 37°C water bath for 30 min to assemble a CRISPR system as test mixture II;

[0149] (5) The test mixture II obtained in step (4) was mixed with 0.01 mg of the biosensor MBs-DNA-MnO2 obtained in step (3) and shaken and incubated in a metal mixer at 37°C for 3 h to obtain a test reaction solution. The test reaction solution was subjected to solid-liquid separation to remove the supernatant to obtain a precipitate. 0.01 mg of the biosensor MBs-DNA-MnO2 obtained in step (3) was used as a control. After the precipitate and the control were respectively mixed with 100 μL of 3,3',5,5'-tetramethylbenzidine with a concentration of 2 mM for a color reaction, the color of the color reaction solution of the precipitate was significantly lighter than that of the color reaction solution of the control. The absorbance value A of the sample and the reference absorbance value A0 at 650 nm were recorded with a microplate reader, and the relative absorbance value ΔA was calculated to form a detection limit linear graph of lead ion concentration vs. relative absorbance value ΔA. The results are as Figure 8 shown.

[0150] As the content of lead ions increases, the amount of manganese dioxide on the magnetic beads decreases. With the addition of TMB that can be catalyzed, the color of the precipitate becomes lighter. In the range of 0.8 - 2500 nM, the change in the color of the color reaction solution is linearly related to the concentration of lead ions. The linear formula is y = 0.0876x + 0.5035, R 2 = 0.996, and the detection limit (LOD) is 0.54 nM.

[0151] Example 8

[0152] To simulate actual applications, rapeseed oil was purchased from a farmers' market as an actual sample. 0.1 g of the rapeseed oil sample was dissolved in 0.5 mL of methanol solution (containing 0.05 g of sodium chloride), shaken well and centrifuged to collect the supernatant. The supernatant was diluted with 0.5 mL of Tris-HCl buffer. Subsequently, it was filtered through a 0.22 μm microfiltration membrane filter to obtain a rapeseed oil sample; Known concentration lead ion standard solutions were added to the rapeseed oil sample to prepare aqueous solutions containing different concentrations of lead ions (Pb 2+ concentrations were 10 nM, 100 nM, and 1000 nM) as lead ion test samples. The specific process for lead ion detection is as follows:

[0153] (1) Mix 10 μL of a solution containing single-stranded DNA modified with biotin and carboxyl groups (at a concentration of 2 μmol / L) with 10 μL of a solution containing magnetic beads with streptavidin surface modification (at a concentration of 10 mg / mL). Carry out a constant-temperature water bath reaction at 37 °C for 6 h, so that the single-stranded DNA is linked to the streptavidin on the magnetic beads through biotin. Then, perform magnetic separation I and wash twice to remove the unbound single-stranded DNA to obtain magnetic bead-DNA;

[0154] (2) Mix 10 μL of the solution containing the magnetic bead-DNA obtained in step (1) with 10 μL of a solution containing 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride at a concentration of 40 mM and a solution containing N-hydroxysuccinimide at a concentration of 10 mM. Incubate at 37 °C for 12 h to activate the carboxyl groups on the single-stranded DNA in the magnetic bead-DNA. Then, perform magnetic separation II to obtain carboxyl-activated magnetic bead-DNA;

[0155] (3) Disperse the carboxyl-activated magnetic bead-DNA obtained in step (2) into Tris-HCl buffer, mix it with 10 μL of a solution containing amino-functionalized manganese dioxide nanorods at a concentration of 2 mg / mL, and carry out a reaction at 37 °C for 8 h, so that the end of the single-stranded DNA far from the magnetic beads is linked to the amino-functionalized manganese dioxide nanorods. Then, perform magnetic separation III and wash to obtain the biosensor MBs-DNA-MnO2;

[0156] (4) Add 2 μL of a solution of GR-5 DNA enzyme (at a concentration of 10 μM) to 2 μL of Tris-HCl buffer, heat it in a water bath at 95 °C for 5 min, and set it aside after annealing; Take 2 μL of GR-5 DNA enzyme and mix it with 2 μL of the lead ion test sample in a metal mixer, and shake it at 37 °C for 60 min. Then, add an equimolar amount of EDTA to the lead ion standard to form test mixture I (the concentrations of the lead ion standard in test mixture I are 10 nM, 100 nM, and 1000 nM respectively). Mix 2 μL of Cas12a (at a concentration of 250 nM), 1 μL of crRNA (at a concentration of 500 nM), 2 μL of test mixture I, 2 μL of 10*Buffer, and 13 μL of ultrapure water, and incubate it in a water bath at 37 °C for 30 min to assemble and form a CRISPR system as test mixture II;

[0157] (5) Mix the test mixture II obtained in step (4) with 0.01 mg of the biosensor MBs-DNA-MnO2 obtained in step (3), shake and incubate in a metal mixer at a temperature of 37 °C and a rotation speed of 1000 rpm for 3 h to obtain a test reaction solution. After subjecting the test reaction solution to solid-liquid separation to remove the supernatant to obtain a precipitate, use 0.01 mg of the biosensor obtained in step (3) as a control. After separately mixing the precipitate and the control with 100 μL of 3,3',5,5'-tetramethylbenzidine with a concentration of 2 mM for a color reaction, the color of the color reaction solution of the precipitate is significantly lighter than the color of the color reaction solution of the control. Use a microplate reader to record the absorbance at 650 nm to obtain the sample absorbance value A and the control absorbance value A0, calculate the relative absorbance value ΔA, and according to the linear relationship formula obtained in Example 7, calculate the calculated value of the lead ion concentration in each sample, and then calculate the lead ion recovery rate. The results are shown in Table 1.

[0158] Compare the detection result of the relative absorbance value ΔA of the test reaction solution linearly with the detection limit to obtain the recovery rate of lead ions, which proves that the lead ion detection method provided by the present invention has good specificity, high detection sensitivity, effectively shortens the detection time, has strong practicability, and can be used to detect lead ions in food.

[0159] Table 1 Sample absorbance values and detection recovery rates of different concentrations of lead ions in food samples

[0160]

[0161] Comparative Example 1

[0162] Refer to the prior art: Chen Jiang, Meng Weifeng, Ren Kuan, etc.; Direct determination of lead in soy sauce by graphite furnace atomic absorption spectrometry [J]; Modern Food, 2020, 1: 159-162. The atomic absorption spectrometry disclosed therein is used for lead ion detection, and its detection limit is 0.03 mg / L (145 nM).

[0163] Comparative Example 2

[0164] Refer to the prior art: Feng Haiyuan, Shi Xiaolu, Huang Qin; Determination of lead in tea garden soil by microwave digestion-hydride generation atomic fluorescence spectrometry [J]; Rock and Mineral Analysis, 2013, 32(1): 53-57. The atomic fluorescence spectrometry disclosed therein is used for lead ion detection, and its detection limit is 0.65 μg / L (3.13 nM).

[0165] Comparative Example 3

[0166] Reference to the prior art: The ultraviolet spectrophotometry disclosed in Tian Yaqin, Xu Teng, Zhang Guomei; Determination of Heavy Metals in 8 Kinds of Chinese Medicinal Herbs by Ultraviolet Spectrophotometry [J]; China Pharmacy, 2008, 19(33): 2609-2610 is used for lead ion detection, and its detection limit is 0.01 μg / mL (48.3 nM).

[0167] Comparative Example 4

[0168] Reference to the prior art: The electrochemical method disclosed in Wei Xiaoping, Liang Qingmei, Li Jianping; Determination of Zinc, Cadmium and Lead by Antimony Electrode Potentiometric Stripping Analysis [J]; Chinese Journal of Inorganic Analytical Chemistry, 2011, 1(4): 19-23 is used for lead ion detection, and its detection limit is 0.08 μg / mL (386.4 nM).

[0169] Comparative Example 5

[0170] Reference to the prior art: The high performance liquid chromatography disclosed in Lu Yuxi, Zhang Lihong, Tang Lili, etc.; On-line Derivatization High Performance Liquid Chromatography is used for lead ion detection, and its detection limit is 0.3 μg / mL (1449 nM).

[0171] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited thereto. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, including any other suitable combination of each technical feature. These simple modifications and combinations should also be regarded as the content disclosed by the present invention and fall within the protection scope of the present invention.

Claims

1. A method for detecting lead ions based on the CIRSPR-Cas system, characterized in that, It includes the following steps: (1) Mix a specific enzyme containing the target DNA fragment with a test sample that may contain lead ions to form a test mixture I, and mix the test mixture I with a CRISPR-Cas12a system solution to carry out a mixing reaction I to obtain a test mixture II; (2) Mix the test mixture II with a biosensor containing single-stranded DNA to carry out a mixing reaction II to obtain a test reaction solution, mix the precipitate obtained by solid-liquid separation of the test reaction solution with a chromogenic agent to carry out a chromogenic reaction to obtain a chromogenic reaction solution, and carry out colorimetric analysis or absorbance value detection analysis on the chromogenic reaction solution to determine whether the test sample contains lead ions; Wherein, the target DNA can activate the Cas12a protein in the CRISPR-Cas12a system; In step (1), the specific enzyme is GR-5 DNAzyme, the nucleotide sequence of the GR-5 DNAzyme is as shown in SEQ ID No.1, and the nucleotide sequence of the target DNA is as shown in SEQ ID No.2; the CRISPR-Cas12a system solution contains crRNA, Cas12a protein, ribonuclease inhibitor and buffer, and the nucleotide sequence of the crRNA is as shown in SEQ ID No.4; In step (2), the biosensor includes magnetic beads surface-modified with streptavidin, single-stranded DNA modified with biotin, and amino-functionalized manganese dioxide nanorods. The single-stranded DNA is connected to the streptavidin on the magnetic beads through the biotin, and one end of the single-stranded DNA away from the magnetic beads is connected to the amino-functionalized manganese dioxide nanorods; the nucleotide sequence of the single-stranded DNA is as shown in SEQ ID No.3; the chromogenic agent is 3,3',5,5'-tetramethylbenzidine.

2. The method according to claim 1, wherein The process of mixing the specific enzyme with the test sample includes: heating the solution containing the specific enzyme in a water bath, annealing, and then mixing and shaking with the test sample.

3. The method according to claim 2, characterized in that, The conditions of the water bath heating include: temperature 80 - 95 °C, time 3 - 8 min; the conditions of the mixing and shaking include: temperature 30 - 45 °C, time 60 - 90 min; The solvent used for the solution containing the specific enzyme is Tris-HCl buffer; The concentration of the specific enzyme in the solution containing the specific enzyme is 3 - 8 μM, and the concentration of lead ions in the test sample is 0.8 - 2500 nM.

4. The method according to claim 3, wherein The molar ratio of the specific enzyme to lead ions in the test sample is 2 - 6250:

1.

5. The method according to claim 1, wherein In step (1), the test mixture II further contains a masking agent, and the masking agent is selected from at least one of ethylenediaminetetraacetic acid, dimercaptoacetone, and mercaptoacetic acid.

6. The method according to claim 5, characterized in that, The test sample is food.

7. The method according to any one of claims 1 to 6, wherein The conditions of the mixing reaction I in step (1) include: temperature 30 - 45 °C, time 20 - 35 min.

8. The method according to any one of claims 1 to 6, characterized in that For every 1 mg of the streptavidin-coated magnetic beads, the amount of the biotinylated single-stranded DNA used is 1×10 -4 -3×10 -4 μmol, and the amount of the aminated manganese dioxide nanorods used is 0.05 - 0.15 mg.

9. The method according to claim 8, wherein The preparation method of the biosensor includes the following steps: (1-1) In reaction solvent I, a single-stranded DNA modified with biotin and carboxyl is mixed with magnetic beads surface-modified with streptavidin for reaction I, so that the single-stranded DNA is linked to the streptavidin on the magnetic beads through the biotin, and then magnetic bead-DNA is obtained by magnetic separation I; (1-2) In reaction solvent II, the magnetic bead-DNA is mixed with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide for incubation, and then carboxyl-activated magnetic bead-DNA is obtained by magnetic separation II; (1-3) In reaction solvent III, the carboxyl-activated magnetic bead-DNA is mixed with amino-functionalized manganese dioxide nanorods for reaction II, so that one end of the single-stranded DNA far from the magnetic beads is linked to the amino-functionalized manganese dioxide nanorods, and then the biosensor is obtained by magnetic separation III.

10. The method according to claim 9, characterized in that, The reaction solvent I, the reaction solvent II and the reaction solvent III are each independently water and / or Tris-HCl buffer solution; Relative to 1 mg of the magnetic beads surface-modified with streptavidin, the amount of the reaction solvent I used is 15 - 25 μL, the amount of the reaction solvent II used is 15 - 25 μL, the amount of the reaction solvent III used is 8 - 12 μL, the amount of 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride used is 3 - 5 μmol, and the amount of N-hydroxysuccinimide used is 0.5 - 1.5 μmol.

11. The method according to claim 9, wherein The conditions of the reaction I in step (1-1) include: temperature is 30 - 45 °C, time is 6 - 8 h; Step (1-1) further includes: washing the substance obtained by the magnetic separation I to obtain the magnetic bead-DNA; The conditions of the incubation in step (1-2) include: temperature is 30 - 45 °C, time is 10 - 15 h; The conditions of the reaction II in step (1-3) include: temperature is 30 - 45 °C, time is 5 - 12 h; Step (1-3) further includes: washing the substance obtained by the magnetic separation III to obtain the biosensor.

12. The method according to any one of claims 1 to 6, characterized in that The conditions of the mixed reaction II in step (2) include: temperature is 30 - 45 °C, rotation speed is 750 - 1250 rpm, time is 2 - 4 h.

13. The method according to any one of claims 1 to 6, characterized in that The wavelength of the absorbance value in step (2) is 620 - 680 nm.

14. The method according to any one of claims 1 to 6, characterized in that The process of determining whether lead ions are contained in the test sample in step (2) includes: mixing a biosensor equal in amount to the initial amount in the test reaction solution with a color-developing agent for a color-developing reaction and detecting the absorbance value as the control absorbance value, detecting the absorbance value of the color-developing reaction solution as the sample absorbance value, and comparing or quantitatively calculating the sample absorbance value with the control absorbance value.

Images