Ester-producing yeast with multiple tolerances and its isolation method and application

Abstract

The present invention discloses an ester-producing yeast with multiple tolerances, and an isolation method and application thereof. The present invention isolates a high-esterification-power ester-producing yeast Millerozyma farinose CZ001 from Daqu, which is resistant to high temperature, acid and ethanol. The strain is deposited in the China General Microbiological Culture Collection Center with a deposit number of CGMCC NO.26211. After the culture conditions of the yeast are optimized using the response surface method, its growth and esterification power are significantly improved. The yeast is used to make bran koji and Daqu, which can significantly improve the esterification power of bran koji and Daqu. The present invention can be used for the production of wines, especially koji, and has important value in improving the esterification power of koji, improving the aroma components of liquor, improving efficiency, saving energy and reducing emissions, and enriching the germplasm resources of brewing microorganisms.

Description

Technical Field

[0001] The present invention relates to the field of ester-producing yeast, in particular to ester-producing yeast with multiple tolerances and an isolation method and application thereof. Background Art

[0002] Liquor occupies an important position in daily life. With the upgrading of consumption, people are pursuing higher and higher quality of liquor. High-end liquor gradually occupies a larger market share. How to improve the quality and enrich the flavor compound components is of great significance to both enterprises and society. Yeast is one of the important materials for brewing liquor. It contains a large number of functional microorganisms. The high or low esterification power of the yeast affects the flavor compound content and quality of the liquor. Studying high esterification power yeast and using it in koji production can improve the esterification power of koji, thereby improving the quality of liquor, meeting people's demand for high-quality liquor, and is of great significance to the long-term development of enterprises.

[0003] The process of making koji and brewing liquor is accompanied by extreme environmental conditions, such as high temperature, low pH, high ethanol, etc. These environmental conditions can seriously affect the growth and survival of yeast, thereby affecting the application effect of yeast. It is difficult for a yeast strain to have the characteristics of high esterification ability, high temperature resistance, acid resistance, and ethanol resistance at the same time. Therefore, the development of excellent yeast that can meet the above conditions at the same time is still an important research direction.

[0004] In addition, factors such as different regions, raw materials, and production processes will also affect the application effect of yeast. Screening for high-esterification yeast can enrich the germplasm resource bank of brewing microorganisms and increase the excellent yeast resources available for enterprises to choose from, which is of great significance for solving enterprise problems. Summary of the invention

[0005] The present invention provides an ester-producing yeast with multiple tolerances and an isolation method and application thereof, so as to solve the problems of insufficient esterification ability and adaptability of the ester-producing yeast in the prior art.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] A multi-tolerance ester-producing yeast, the ester-producing yeast being strain Millerozyma farinosaCZ001, deposited in the China General Microbiological Culture Collection Center on December 25, 2022, with a deposit number of CGMCCNO.26211.

[0008] Furthermore, the strain M. farinosa CZ001 grows well under the condition of 25-55°C.

[0009] Furthermore, the strain M. farinosa CZ001 grows well under the condition of pH 2-9.

[0010] Furthermore, the strain M. farinosa CZ001 grows well under the condition of ethanol content of 0-18% vol.

[0011] A method for isolating the above-mentioned ester-producing yeast with multiple tolerances, comprising selecting Daqu based on esterification ability, and then obtaining the strain M. farinose CZ001 from the selected Daqu through separation, purification and screening; optimization by response surface methodology determined that the growth and esterification ability of the strain M. farinosa CZ001 were significantly improved under the conditions of 10.51% glucose content, 4.8% peptone content and 2.08% yeast powder content.

[0012] Application of the above-mentioned ester-producing yeast with multiple tolerances to improve the esterification ability in wine.

[0013] The invention discloses an application of the above-mentioned ester-producing yeast with multiple tolerances in improving the esterification capacity in distiller's yeast.

[0014] Compared with the prior art, the present invention has the following advantages:

[0015] The present invention provides an ester-producing yeast having multiple excellent characteristics such as high temperature resistance, acid resistance, ethanol resistance and high esterification ability, and an isolation method and a method for optimizing culture conditions thereof. The ester-producing yeast of the present invention can be applied to wine, especially koji, and can improve the esterification ability. The present invention has important value in enriching the germplasm resource library of brewing microorganisms, improving the aroma components of liquor, improving efficiency, and saving energy and reducing emissions. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a comparison chart of yeast esterification ability. Among them: CK, control yeast (high-activity dry yeast for liquor brewing and ester production produced by Angel Yeast Co., Ltd.); different lowercase letters indicate significant differences (P < 0.05); the values ​​in the figure were repeated more than 3 times.

[0017] Figure 2 Agarose gel electrophoresis diagram of PCR amplification of ITS1-5.8S-ITS2 region and D1 / D2 region of 26S rDNA. Among them: i, electrophoresis band corresponding to CZ001; ii, electrophoresis band corresponding to CZ002; iii, electrophoresis band corresponding to CZ003. -, negative control; A, amplification of ITS1-5.8S-ITS2 region band; B, amplification of 26S rDNA D1 / D2 region band.

[0018] Figure 3 Phylogenetic tree diagram for the amplified ITS1-5.8S-ITS2 region.

[0019] Figure 4Phylogenetic tree of the D1 / D2 region of amplified 26S rDNA.

[0020] Figure 5 The growth curve of yeast. A, CZ001; B, CZ002; C, CZ003; D, control yeast. OD600 is the detection value after the bacterial solution is diluted 5 times; the values ​​in the figure are repeated more than 3 times.

[0021] Figure 6 The following is a comparison of the growth of four yeast strains at different temperatures. Among them: CK, control yeast; OD600 is the detection value after the bacterial solution was diluted 5 times. Different lowercase letters indicate significant differences (P < 0.05); the values ​​in the figure were repeated more than 3 times.

[0022] Figure 7 The growth comparison of four yeast strains at different pH values. CK, control yeast; OD600 is the detection value after the bacterial solution was diluted 5 times. Different lowercase letters indicate significant differences (P < 0.05); the values ​​in the figure were repeated more than 3 times.

[0023] Figure 8 The figure is a comparison of the growth of four yeast strains under different ethanol contents. Among them: CK, control yeast. OD600 is the detection value after the bacterial solution is diluted 5 times. Different lowercase letters indicate significant differences (P < 0.05); the values ​​in the figure were repeated more than 3 times.

[0024] Fig. 9 The yields of four esters produced by the strains. CK, control yeast. Different lowercase letters indicate significant differences (P < 0.05); the values ​​in the figure were repeated more than 3 times.

[0025] Fig.10 The ester production preference of the strains for the four esters. CK, control yeast. Different lowercase letters indicate significant differences (P < 0.05); the values ​​in the figure were repeated more than 3 times.

[0026] Fig.11 The effect of glucose content on the growth of CZ001. Among them: OD600 is the detection value after the bacterial solution is diluted 5 times; the values ​​in the figure are repeated more than 3 times.

[0027] Fig.12 The effect of peptone content on the growth of CZ001. Among them: OD600 is the detection value after the bacterial solution is diluted 5 times; the values ​​in the figure are repeated more than 3 times.

[0028] Fig.13 The effect of yeast powder content on the growth of CZ001. Among them: OD600 is the detection value after the bacterial solution is diluted 5 times; the values ​​in the figure are repeated more than 3 times.

[0029] Fig.14 The surface maps and contour maps of the interaction between various factors. Among them: A, surface map (i) and contour map (ii) of the interaction between glucose and peptone; B, surface map (i) and contour map (ii) of the interaction between glucose and yeast powder; C, surface map (i) and contour map (ii) of the interaction between peptone and yeast powder.

[0030] Fig.15 The growth comparison of CZ001 before and after optimization. Among them: OD600 is the detection value after the bacterial solution is diluted 5 times; the values ​​in the figure are repeated more than 3 times.

[0031] Fig.16 This is a comparison of the esterification ability of CZ001 before and after optimization. The values ​​in the figure are repeated more than 3 times.

[0032] Fig.17 The effect of adding CZ001 on the esterification capacity of wine koji. A, esterification capacity of bran koji made by adding CZ001 before and after optimization; B, effect of adding CZ001 on the esterification capacity of Daqu. CK1: conventional Daqu without strain addition; CK2: fortified Daqu with control strain added; F-CZ001: fortified Daqu with experimental strain CZ001 added; F-CZ001*2: fortified Daqu with 2 times the dose of CZ001 added. Among them: the values ​​in the figure were repeated more than 3 times. DETAILED DESCRIPTION

[0033] The present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0034] Embodiment 1

[0035] This embodiment discloses a method for isolating ester-producing yeast with multiple tolerances, comprising the following steps:

[0036] Step 1: Selection of high esterification Daqu

[0037] Five different sources of Luzhou-flavor Daqu were selected and numbered DQ1, DQ2, DQ3, DQ4, and DQ5. The esterification power of the five Daqu was tested, and the results are shown in Table 1. Daqu DQ1, DQ2, and DQ5 have high esterification power, so they are mainly isolated from these three Daqu in the subsequent screening of high esterification power yeast.

[0038] Table 1 Esterification power of Daqu

[0039]

[0040] Step 2, Isolation and purification of ester-producing yeast: Isolate and purify the strain from Daqu by streaking multiple times.

[0041] Step 3: Screening of high esterification yeast

[0042] The esterification capacity of yeast was tested by gas chromatography. After screening the strains, three yeast strains with high esterification capacity, CZ001, CZ002, and CZ003, were finally obtained. Figure 1 The esterification ability of these three yeast strains is better than that of the control yeast (high-activity dry yeast for brewing liquor produced by Angel Yeast Co., Ltd.) (the control yeast mentioned below is all this control yeast).

[0043] Step 4: Identification of high esterification yeast

[0044] (4.1) Extraction of yeast genomic DNA

[0045] The genomic DNA of CZ001, CZ002 and CZ003 was extracted by the water-boiling template method.

[0046] (4.2) PCR amplification

[0047] Using genomic DNA as a template for PCR amplification, universal primers ITS1 / ITS4 and NL1 / NL4 were used to perform PCR amplification on the ITS1-5.8S-ITS2 region and the D1 / D2 region of 26S rDNA. The PCR amplification system and conditions are shown in Tables 2 and 3.

[0048] Table 2 Preparation of PCR reaction solution (50 μL system)

[0049]

[0050] Table 3 PCR reaction conditions

[0051]

[0052] Note: Denaturation, annealing, and extension constitute one cycle, which was repeated 35 times.

[0053] (4.3) Gel electrophoresis detection of amplified products

[0054] Take 3 μL of amplified product, add 1 μL of Loading Buffer, mix well, and perform electrophoresis in 1% agarose gel. Figure 2 As shown, the amplified bands of the three strains were relatively single, with lengths ranging from 750 to 1000 bp.

[0055] (4.4) DNA sequencing and sequence alignment

[0056] The purified PCR products were sent to Shanghai BGI Genomics Co., Ltd. for sequencing, and the ITS1-5.8S-ITS2 sequences of CZ001, CZ002, and CZ003 and the D1 / D2 sequence of 26S rDNA were obtained. The sequence information is as follows.

[0057] ITS1-5.8S-ITS2 sequence of CZ001:

[0058] TGCGGAAGGATCATTACAGTATTTGGACGTAATTCTTCTAGTATCTTGCCAGCGCTTAACTGCGCGGCGAGTGCTATTAGAAGTCCATAAGTTCTTACACACAGTGTTTTTTGTTTGTGAAAAAAATTTACTTTGGTCTGGAGCTAGAAATAGTTTTGGGCCAGAGGTCAACCTAACTTCAATTTATATTGAATTGTTTTTAATTTTATTTGTCAAATTATTGATATTAATCAAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCGCAAGGTTTGGTGTTGAGCGATATAGATATTCAGTATCTATTTGCTTGAAATGGATTGGCATGAGTATTTACAGTAGATAAATGCCGTTTGACTCTTCAATGTATTAGGTCTAACCAACTCGTTGAAACAGTTAGCGGTAGTATCTGTGTAAAAGAGGCTCGGCCTTACAACAATCTACAAAGTTTGACCTCAAATCAGGTAGGAATACCCGCTGAACTTAAGC

[0059] ITS1-5.8S-ITS2 sequence of CZ002:

[0060] TGCGGAAGGATCATTATAGTATTCTATTGCCAGCGCTTAATTGCGCGGCGATAAACCTTACACACATTGTCTAGTTTTTTTGAACTTTGCTTTGGGTGGTGAGCCTGGCTTACTGCCCAAAGGTCTAAACACATTTTTTTAATGTTAAAACCTTTAACCAATAGTCATGAAAATTTTTAACAAAAATTAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTATTGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCACCCTCTGGTATTCCAGAGGGTATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTGTCAAGGGTTAACTTGAAATATTGACTTAGCAAGAGTGTACTAATAAGCAGTCTTTCTGAAATAATGTATTAGGTTCTTCCAACTCGTTATATCAGCTAGGCAGGTTTAGAAGTATTTTAGGCTCGGCTTAACAACAATAAACTAAAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAA

[0061] ITS1-5.8S-ITS2 sequence of CZ003:

[0062] TGCGGAAGGATCATTATAGTATTCTATTGCCAGCGCTTAATTGCGCGGCGATAAACCTTACACACATTGTCTAGTTTTTTTGAACTTTGCTTTGGGTGGTGAGCCTGGCTTACTGCCCAAAGGTCTAAACACATTTTTTTAATGTTAAAACCTTTAACCAATAGTCATGAAAATTTTTAACAAAAATTAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCAACGATGAAGAACGCAGCGAAATGCGATACGTATTGTGAATTGCAGATTTTCGTGAATCATCGAATCTTTGAACGCACATTGCACCCTCTGGTATTCCAGAGGGTATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTCGGGTTTGGTATTGAGTGATACTCTGTCAAGGGTTAACTTGAAATATTGACTTAGCAAGAGTGTACTAATAAGCAGTCTTTCTGAAATAATGTATTAGGTTCTTCCAACTCGTTATATCAGCTAGGCAGGTTTAGAAGTATTTTAGGCTCGGCTTAACAACAATAAACTAAAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGGCGGAGGA

[0063] D1 / D2 sequence of the 26S rDNA of CZ001:

[0064] GAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGGCGTCCGAGTTGTAATTTGAAGAAGGCTACTTTGGGGCTGGAGTTTGTCTAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGAGATAAGCTTCCCAGTTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACATGGTATTTTGTAAACCTTCTCTCTCGTGGAGGGGGCCCCTTGCAGCTTACTGGGCCAGCATCAGTTTGGGCGGTAGGATAATGACTAAGGAATGTGACTTGCCTTCGGGGAAGTGTTATAGCCTTGGTTGATACTGCCAGCCTAGACTGAGGACCGCGTCTTTGACAAGGATGTTGGCATAATGATCTTAAGCCACCCGTCT

[0065] D1 / D2 sequence of the 26S rDNA of CZ002:

[0066] GAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGCACCTTCGGTGTTCGAGTTGTAATTTGAAGATGGTAACCTTGGGTTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGATGAGATGCCCATTCCTATGTAAGGTGCTATCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTAGATCAGACTTGGTGTTTTACGATTATCTTCTCTTCTTGAGCTGTGCACTCGTATTTCACTGGGCCAGCATCGATTCGGATGGCAAGATAATGGCAGTTGAATGTGGCTTCACTTCGGTGGAGTGTTATAGCTTCTGCTGATATTGCCTGTCTGGATCGAGGGCTGCGTCTTTTGACTAGGATGCTGGCGTAATGATCTAATGCCGCCCGTCTTG

[0067] D1 / D2 sequence of 26S rDNA of CZ003:

[0068] AGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTAGCACCTTCGGTGTTCGAGTTGTAATTTGAAGATGGTAACCTTGGGTTTGGCTCTTGTCTATGTTCCTTGGAACAG GACGTCATAGAGGGTGAGAATCCCGTCTGATGAGATGCCCATTCCTATGTAAGGTGCTATCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAA CAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTAGATCAGACTTGGTGTTTTACGATTATCTTCTCTTCTTGAGCTGTGCACTCGTATTTCACTGGGCC AGCATCGATTCGGATGGCAAGATAATGGCAGTTGAATGTGGCTTCACTTCGGTGGAGTGTTATAGCTTCTGCTGATATTGCCTGTCTGGATCGAGGGCTGCGTCTTTTGACTAGGATGCTGGCGTAATGATCTAATGCCGCCCGTCT

[0069] The ITS1-5.8S-ITS2 sequence and the D1 / D2 sequence of 26S rDNA were submitted to the NCBI database for comparison. CZ001 was M. farinosa, and CZ002 and CZ003 were Wickerhamomyces anomalus. A phylogenetic tree was constructed based on their sequences ( Figure 3 , 4 ). Then the tolerance of high esterification yeast was tested and the culture conditions were optimized.

[0070] Embodiment 2

[0071] This example discloses the tolerance test and culture condition optimization experiment of the high esterification yeast obtained in Example 1, and the process is as follows:

[0072] 1. Drawing of yeast growth curve

[0073] Inoculate the yeast suspension cultured for 24 hours into 50 mL YPD medium at 1% v / v inoculation volume, and culture at 30°C and 180 rpm. Take a sample every 3 hours (200 μL). Add 1 mL of sterile water to the sample, centrifuge at 5500 rpm for 4 minutes, and remove the supernatant; repeat twice and dry; add 1 mL of sterile water to the sample and shake evenly. Use sterile water as a blank control and use a multifunctional microplate reader to detect the OD of the sample. 600 , draw a growth curve ( Figure 5 ). Both the experimental yeast and the control yeast tended to be stable after growing for 24 hours, so 24 hours was used as the measurement time in subsequent tolerance tests.

[0074] 2. Yeast tolerance test

[0075] 2.1 Temperature resistance test

[0076] The activated yeast suspension was inoculated into YPD medium at 1% v / v inoculation volume. The culture was carried out in a shaker at 25°C, 30°C, 35°C, 40°C, 45°C, 50°C, and 55°C at 180 rpm. Samples were taken after 24 hours to measure OD 600 .like Figure 6 As shown, the OD values ​​of CZ001, CZ002, CZ003 and control yeast 600 When the culture temperature was between 45℃ and 55℃, the OD values ​​of CZ001, CZ002, and CZ003 600 were significantly higher than the control yeast, and the OD of CZ001 600 In summary, compared with the control yeast, CZ001, CZ002, and CZ003 all have stronger high temperature resistance, especially CZ001 has the strongest tolerance to high temperature.

[0077] 2.2 Acid resistance test

[0078] The activated yeast suspension was inoculated into YPD medium with pH values ​​of 2, 3, 5, 7, and 9 at a 1% v / v inoculation rate. Culture was carried out at 30°C and 180 rpm. Samples were taken after 24 hours to measure the OD 600 .like Figure 7 As shown. In the pH range of 2-9, the OD values ​​of CZ001 and CZ003 600 At pH 2, the OD of CZ001 600 It is 5.48 times that of the control yeast.

[0079] 2.3. Ethanol resistance test

[0080] The activated yeast suspension was inoculated with 1% v / v inoculation volume into YPD medium with ethanol content of 0% vol, 3% vol, 6% vol, 9% vol, 12% vol, 15% vol, and 18% vol. Cultured at 30°C and 180 rpm, and samples were taken after 24 hours to measure OD 600 The results are as follows Figure 8 As shown, the OD values ​​of CZ001 and CZ003 were significantly higher in the range of 0-18% vol of ethanol. 600 were significantly higher than the control yeast, and the OD of CZ001 600 Highest.

[0081] 3. Detection of preference for four esters produced by yeast

[0082] The strains were tested for their preference for producing four esters (ethyl caproate, ethyl acetate, ethyl butyrate, and ethyl lactate) in a mixed ester-producing medium (1% caproic acid, 1% acetic acid, 1% butyric acid, 1% lactic acid, and 20% ethanol medium), as well as their total production of the four esters. Fig. 9 , Fig.10 As shown, strain CZ001 produced the largest total amount of the four major esters and the smallest ratio of ethyl acetate to ethyl hexanoate.

[0083] 4. Optimization of culture conditions of M. farinosa CZ001 by response surface methodology

[0084] 4.1 Single Factor Experiment

[0085] The effects of different glucose content, different peptone content, and different yeast powder content in YPD medium on the growth of M. farinosa CZ001 were examined. Figure 11-13 ). These three single factors all significantly affected the growth of CZ001, so they were used as factors for subsequent response surface optimization.

[0086] 4.2 Box-Behnken experiment

[0087] According to the principle of central composite design, a three-factor, three-level Box-Behnken experiment was designed. Glucose, peptone, and yeast powder were used as independent variables, and the coding levels of the experimental factors are shown in Table 4.

[0088] Table 4 Factors and levels of response surface analysis

[0089]

[0090] The experimental design included 17 experimental points, with the OD of 24h culture as the 600 (diluted 5 times) is the response Y value. The experimental results are shown in Table 5.

[0091] Table 5 Box-Behnken test results

[0092]

[0093]

[0094] The following equation was obtained by performing multiple regression analysis on the above results:

[0095] Y=0.8822+0.0150X1+0.0740X2+0.0278X3+0.0087X1X2+0.0058X1X3-0.0358X2X3-0.1392X1 2 -0.1432X2 2 -0.3557X3 2

[0096] The model was subjected to variance analysis, and the results are shown in Table 6. Model F = 130.20, P < 0.01, indicating that the model is extremely significant; the lack of fit term P = 0.0740 > 0.05, the model lack of fit is not significant, indicating that the experimental error is mainly caused by random error.

[0097] The coefficient of determination R of the model 2 =0.9941, adjustment coefficient R 2 (adj.R 2 )=0.9864, indicating that the model can explain 98.64% of the variation in CZ001 bacterial concentration. The signal-to-noise ratio (A deq Precision=28.6535) is greater than 4, so the fit and credibility are good. The model can be used to predict the OD of M. farinosa CZ001. 600 Conduct analysis and forecasting.

[0098] The CV value (coefficient of variation of Y) indicates the accuracy of the experiment. The smaller the CV value, the more reliable the experiment is. The CV value of this experiment is 4.54%, indicating that the experimental results are relatively reliable and have certain practical guiding significance.

[0099] Table 6 Results of variance analysis of regression model

[0100]

[0101]

[0102] Set one experimental variable to zero and plot the effects of the other two experimental variables on the response surface. A three-dimensional surface plot and contour plot were plotted based on the model ( Fig.14 ). They can intuitively show the relationship between any two factors and the response value Y. The prediction results show that the response value Y has an extreme point, namely OD 600(diluted 5 times) is 0.99, and the corresponding values ​​of the three independent variables are glucose content 10.51%, peptone content 4.80%, and yeast powder content 2.08%.

[0103] 4.3 Model Validation

[0104] In order to verify the OD of CZ001 after optimization 600 Whether it is consistent with the predicted results, the yeast is cultured under the predicted conditions and the OD is tested 600 (diluted 5 times). Fig.15 As shown, the OD of CZ001 before optimization 600 was 0.88; after optimization, it was 1.07, which was 21.59% higher than before optimization. 600 The model prediction value is 0.99, and the actual value differs from the predicted value by only 7.47%, indicating that the model is reliable.

[0105] In addition, the esterification ability of CZ001 before and after optimization was tested. Fig.16 As shown in the figure, the esterification capacity of CZ001 after optimization is higher than that before optimization. The esterification capacity before and after optimization is 0.45 mg / mL.100 h and 0.67 mg / mL.100 h, respectively, and the latter is 1.48 times that of the former.

[0106] Embodiment 3

[0107] This embodiment discloses the application of high esterification yeast in distiller's yeast.

[0108] A. Making wine yeast

[0109] Method for making bran koji: bran koji was made at a ratio of bran koji to water = 1:1. CZ001 before and after optimization and control strains were inoculated into bran koji at a 1% inoculation rate and cultured at 30°C for 72h; Method for making fortified Daqu: conventional Daqu without strain addition was CK1, and fortified Daqu made by adding 2L control strain was CK2; fortified Daqu made by adding 2L optimized CZ001 was F-CZ001, and fortified Daqu made by adding 4L optimized CZ001 was F-CZ001*2. Each Daqu was made in one room, with 3840 Daqu in each room.

[0110] B. Test of esterification capacity of koji

[0111] The results are as follows Fig.17 As shown. For bran koji ( Fig.17 A), the esterification capacity of bran koji of CK, before optimization and after optimization was 0.51, 0.81 and 1.31 mg / g.100h respectively. The esterification capacity of bran koji after optimization was 61.73% higher than that before optimization and 156.86% higher than that of CK; for Daqu ( Fig.17B), the esterification power of CK1, CK2, F-CZ001, and F-CZ001*2 is 2.69 mg / g respectively . 100h, 3.63mg / g . 100h, 4.52mg / g . 100h, 4.75mg / g . After 100 hours, the esterification capacity of Daqu F-CZ001 increased by 68.03% and 24.52% compared with Daqu CK1 and CK2, respectively, and the esterification capacity of Daqu F-CZ001*2 increased by 76.58% and 30.85% compared with Daqu CK1 and CK2, respectively. Therefore, the addition of optimized CZ001 can significantly improve the esterification capacity of bran koji and Daqu.

[0112] In this example, high-esterification Daqu was selected, and three high-esterification strains were isolated from the Daqu. After molecular biological identification, they were determined to be powdered Miller yeast Millerozyma farinosa and Wickham yeast Wickerhamomyces anomalus, and were named M. farinose CZ001, W. anomalus CZ002, and W. anomalus CZ003, respectively. By testing the high temperature resistance, acid resistance and ethanol resistance, the high-esterification yeast M. farinosa CZ001 with high temperature resistance, acid resistance and ethanol resistance was obtained. The culture conditions of CZ001 were optimized using the response surface methodology. When the glucose content in the culture medium was 10.51%, the peptone content was 4.80%, and the yeast powder content was 2.08%, the OD of CZ001 cultured at 30°C for 24 hours was 600 (5 times diluted) is 1.07, which is 21.59% higher than before optimization. After optimized culture, the esterification capacity is 0.67mg / mL.100h, which is 1.48 times higher than before optimization. When it is applied to bran koji production, the esterification capacity of bran koji after optimization is 61.73% higher than before optimization, and it is also 156.86% higher than CK; when it is applied to Daqu production, it can significantly improve the esterification capacity of Daqu, and it is better than the control strain.

[0113] In summary, the present invention has isolated a high esterification capacity ester-producing yeast M. farinosa CZ001 that is resistant to high temperature, acid and ethanol. The esterification capacity of bran and daqu can be significantly improved by optimizing its culture conditions and applying it to the production of bran and daqu.

[0114] The ester-producing yeast M. farinosa CZ001 of the present invention is deposited in the China General Microbiological Culture Collection Center, the deposit address is: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the deposit number is: CGMCCNO.26211, and the deposit date is: December 25, 2022.

[0115] The preferred embodiments of the present invention are described in detail above in conjunction with the accompanying drawings. The embodiments described in the present invention are merely descriptions of the preferred embodiments of the present invention, and do not limit the concept and scope of the present invention. The various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction, and such combinations should also be regarded as the contents disclosed in the present disclosure as long as they do not violate the concept of the present invention. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0116] The present invention is not limited to the specific details of the above-mentioned embodiments. Within the technical concept of the present invention and without departing from the design concept of the present invention, various modifications and improvements made to the technical solution of the present invention by technical personnel in this field should fall within the protection scope of the present invention. The technical contents for which protection is sought in the present invention have been fully recorded in the claims.

Claims

1. An ester-producing yeast with multiple tolerances, characterized in that: The ester-producing yeast is a strain of Saccharomyces milleri Millerozyma farinosa CZ001 was deposited in the China General Microbiological Culture Collection Center on December 25, 2022, with the deposit number CGMCC NO. 26211.

2. The ester-producing yeast with multiple tolerance according to claim 1, characterized in that: The strain M. farinosa CZ001 grows well at 25-55℃.

3. The ester-producing yeast with multiple tolerance according to claim 1, characterized in that: The strain M. farinosa CZ001 grows well at a pH of 2-9.

4. The ester-producing yeast with multiple tolerance according to claim 1, characterized in that: The strain M. farinosa CZ001 grows well in ethanol content of 0-18% vol.

5. Use of the ester-producing yeast with multiple tolerances as claimed in any one of claims 1 to 4 to improve the esterification capacity in distiller's yeast.

Images