A primer pair, sgRNA, and application for amplifying exon 1 of the sheep DQA gene
By designing amplification primer pairs and sgRNA, and combining them with the CRISPR/Cas9 system, gene editing of exon 1 of the sheep DQA gene was performed, which solved the problem of low efficiency in existing technologies and achieved a highly efficient gene editing effect, supporting the study of DQA gene function.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-30
- Publication Date
- 2026-03-10
AI Technical Summary
There is a lack of efficient gene editing methods in the current technology to edit the sheep DQA gene, especially large fragment deletions and frameshift mutations through the CRISPR/Cas9 system, which affect the study of DQA gene function.
We designed and used specific amplification primer pairs and sgRNA, combined with the CRISPR/Cas9 system, to perform gene editing on exon 1 of the sheep DQA gene. This included PCR amplification of primer pairs DQAF1 and DQAR1, designing and synthesizing sgRNA, constructing recombinant vectors pX330DQAsg1 and pX330DQAsg2, and screening and validating gene-edited cells.
The study achieved highly efficient editing of exon 1 of the sheep DQA gene, with a positive rate of 65% and a 15% probability of editing occurring on both sets of chromosomes in the genome, greatly improving the efficiency and accuracy of gene editing.
Smart Images

Figure CN116121240B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of gene editing, and particularly relates to an amplification primer pair of a sheep DQA gene No. 1 exon, sgRNA and application. BACKGROUND
[0002] When using the CRISPR / Cas9 system for gene editing, an sg (single-guide) sequence needs to be designed according to the genomic sequence first, and multiple sgRNAs can be designed in the target gene, but the position and base sequence of the sequence will affect the efficiency of editing the target gene, and the use of sgRNA with high editing efficiency can more easily obtain cells or zygotes edited by the target gene, which can reduce the experimental time and cost for obtaining gene edited cells or animal individuals. The CRISPR / Cas9 technology is the most commonly used gene editing technology at present. The homologous recombination, ZFN (zinc finger nuclease) and TANLEN (transcription activator-like effector nuclease) technologies used before can also achieve precise knockout of large fragments of target genes, but the efficiency of natural homologous recombination in cells is extremely low (10 -6 ). The design of ZFN and TALEN technologies is complicated, the cost is higher and the efficiency is lower, while the gene editing efficiency of the CRISPR / Cas9 technology is higher and can mediate homologous recombination, so the Cas9 system has more advantages compared with ZFN and TALEN.
[0003] The DQA (SLA class II histocompatibility antigen, DQ haplotype D alpha chain) gene is the SLA class II histocompatibility antigen and DQ haplotype D alpha chain. DQA mainly exists in lymph, skin and spleen and other tissues, participates in cellular immunity and humoral immunity of the body, and plays an important role in initiating the response of helper T cells to important pathogens. The function of the DQA gene is not clear at present, and gene editing technology can help to verify the function of DQA, but there is no report on editing the sheep DQA gene, and there is no example of using the CRISPR / Cas9 system to edit the DQA gene. SUMMARY
[0004] The purpose of the present application is to provide an amplification primer pair of a sheep DQA gene No. 1 exon, sgRNA and application. After the CRISPR / Cas9 gene editing is guided, large fragment deletion and frame shift mutation can be caused, the gene editing efficiency is high, and it is helpful for the research on the function of the DQA gene.
[0005] This invention provides a primer pair for amplifying exon 1 of the sheep DQA gene, the primer pair comprising DQAF1 and DQAR1, the nucleotide sequence of DQAF1 being shown in SEQ ID NO.1 and the nucleotide sequence of DQAR1 being shown in SEQ ID NO.2.
[0006] The present invention also provides a method for amplifying exon 1 of the sheep DQA gene, comprising using sheep genomic DNA as a template, preparing a PCR system using the above primer pairs, performing PCR amplification, and obtaining exon 1 of the sheep DQA gene.
[0007] Preferably, the PCR amplification program includes: 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 45 s, 34 cycles; and 72°C further extension for 5 min.
[0008] The present invention also provides a set of sgRNAs targeting exon 1 of the sheep DQA gene, including two pairs of single-stranded oligonucleotide sequences: DQAsg1-F, DQAsg1-R, DQAsg2-F and DQAsg2-R.
[0009] The nucleotide sequence of DQAsg1-F is shown in SEQ ID NO.3, the nucleotide sequence of DQAsg1-R is shown in SEQ ID NO.4, the nucleotide sequence of DQAsg2-F is shown in SEQ ID NO.5, and the nucleotide sequence of DQAsg2-R is shown in SEQ ID NO.6.
[0010] The present invention also provides a set of recombinant vectors containing the above-mentioned sgRNA.
[0011] Preferably, all the recombinant vectors are based on the pX330 vector.
[0012] This invention also provides the application of the above-mentioned sgRNA or the above-mentioned recombinant vector in gene editing of exon 1 of the DQA gene in the sheep genome.
[0013] Preferably, the gene editing method includes CRISPR / Cas9.
[0014] Preferably, the gene editing method includes: (1) annealing DQAsg1-F and DQAsg1-R, DQAsg2-F and DQAsg2-R respectively to obtain DQAsg1 and DQAsg2, digesting them with enzymes and then ligating them into the pX330 vector to construct the recombinant vectors pX330DQAsg1 and pX330DQAsg2;
[0015] (2) The recombinant vectors pX330DQAsg1 and pX330DQAsg2 were co-transfected with the g418 resistance vector p1452 into sheep somatic cells. After culture and g418 resistance screening, gene-edited cells were obtained.
[0016] Preferably, after obtaining the gene-edited cells in step (2), the method further includes extracting the genomic DNA of the gene-edited cells for PCR amplification and / or sequencing verification.
[0017] Beneficial Effects: This invention provides a primer pair for amplifying exon 1 of the sheep DQA gene. The sequence of this region is obtained through primer amplification and PCR amplification. After sequencing confirms the sequence is correct, two sgRNAs are designed based on this sequence. In this embodiment, using the two designed sgRNAs, gene editing of the exon 1 region is performed based on the CRISPR / Cas9 system. Forty monoclonal cell lines were obtained through screening. After sequencing, 26 clones were found to be gene-editing positive, representing a positive rate of 65%. Six clones showed editing on both sets of chromosomes (alleles), and the probability of editing on both alleles was 15%. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 For sequence design and experimental implementation process;
[0020] Figure 2 The results are as follows: A. Primer amplification results, exon 1 amplification yielded 215bp; B. DQA exon 1 sequence obtained from sequencing; C. Schematic diagram of the sgRNA designed from DQA exon 1 and its location.
[0021] Figure 3 The results show the partial sequencing of the DQA gene in the obtained monoclonal cells. Detailed Implementation
[0022] This invention provides a primer pair for amplifying exon 1 of the sheep DQA gene, the primer pair comprising DQAF1 and DQAR1, the nucleotide sequence of DQAF1 being shown in SEQ ID NO.1 and the nucleotide sequence of DQAR1 being shown in SEQ ID NO.2.
[0023] In this embodiment of the invention, PCR primers targeting exon 1 are preferably designed based on the reference sequence provided by the DQA gene (NC_056073) of sheep (version ARS-UI_Ramb_v2.0) published by NCBI, and the fragment length obtained by amplification based on the PCR primers is 215bp.
[0024] The sequence of the primer pair described in this invention, upstream primer DQAF1: 5'-gcttctcagctcagccctcatc-3'
[0025] Downstream primer DQAR1: 5'-ttttccctctgattccctgttccc-3'.
[0026] The present invention also provides a method for amplifying exon 1 of the sheep DQA gene, comprising using sheep genomic DNA as a template, preparing a PCR system using the above primer pairs, performing PCR amplification, and obtaining exon 1 of the sheep DQA gene.
[0027] The PCR system of this invention, in 20 μL units, preferably comprises: 1 μL each of DQAF1 and DQAR1, 1 μL of DNA template, 2×mix1 2.5 μL, and the remainder water. The PCR amplification program of this invention preferably includes: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 45 s, for 34 cycles; and a final extension at 72℃ for 5 min. In this embodiment of the invention, the Hu sheep genome is preferably used as a template, and PCR amplification is performed using the above primer pairs. After sequencing the amplified products, the sequencing results are compared with a reference sequence to confirm the DQA sequence of the Hu sheep.
[0028] The present invention also provides a set of sgRNAs targeting exon 1 of the sheep DQA gene, including two pairs of single-stranded oligonucleotide sequences: DQAsg1-F, DQAsg1-R, DQAsg2-F and DQAsg2-R.
[0029] The nucleotide sequence of DQAsg1-F is shown in SEQ ID NO.3, the nucleotide sequence of DQAsg1-R is shown in SEQ ID NO.4, the nucleotide sequence of DQAsg2-F is shown in SEQ ID NO.5, and the nucleotide sequence of DQAsg2-R is shown in SEQ ID NO.6.
[0030] This invention preferably designs sgRNA based on the DQA sequence of Hu sheep obtained by the above amplification, and synthesizes a single-stranded oligonucleotide sequence (with BbsI restriction sites added upstream and downstream). The sequence is as follows (5'-3'): (underlined are restriction site sequences)
[0031] Upstream DQAsg1-F: CACCGTGAACAGAGCTCTGATTCTG
[0032] Downstream DQAsg1-R: AAAC CAGAATCAGAGCTCTGTTCA C
[0033] Upstream DQAsg2-F: CACCG ACCTCCACTGGGGCTCATCA
[0034] Downstream DQAsg2-R: AAAC TGATGAGCCCCAGTGGAGGT C .
[0035] In this invention, the above-mentioned single-stranded oligonucleotide sequence is preferably annealed to synthesize sgRNA. The annealing procedure preferably includes 95°C for 5 min, 37°C for 10 min, and storage at 4°C. During the annealing process, upstream DQAsg1-F and downstream DQAsg1-R are mixed in a specific formulation, as are upstream DQAsg2-F and downstream DQAsg2-R.
[0036] The present invention also provides a set of recombinant vectors containing the above-mentioned sgRNA.
[0037] The recombinant vectors described in this invention are preferably based on the pX330 vector. In constructing the recombinant vectors, the preferred steps include digesting the Cas9 expression vector pX330 with BbsI, recovering the digested fragments, and then ligating them with the annealed double-stranded sgRNA under the action of T4 DNA ligase to obtain the recombinant vectors pX330DQAsg1 and pX330DQAsg2.
[0038] This invention also provides the application of the above-mentioned sgRNA or the above-mentioned recombinant vector in gene editing of exon 1 of the DQA gene in the sheep genome.
[0039] The gene editing method of the present invention preferably includes CRISPR / Cas9. When gene editing is performed using the CRISPR / Cas9 method of the present invention, it preferably includes: (1) annealing DQAsg1-F and DQAsg1-R, DQAsg2-F and DQAsg2-R respectively to obtain DQAsg1 and DQAsg2, digesting them with enzymes and then ligating them into the pX330 vector to construct the recombinant vectors pX330DQAsg1 and pX330DQAsg2;
[0040] (2) The recombinant vectors pX330DQAsg1 and pX330DQAsg2 were co-transfected with the g418 resistance vector p1452 into sheep somatic cells. After culture and g418 resistance screening, gene-edited cells were obtained.
[0041] The present invention does not specifically limit the transfection method, but in the embodiments, it is preferred to transfect Hu sheep fetal fibroblasts by liposome transfection.
[0042] After obtaining the gene-edited cells in step (2), the present invention preferably further includes extracting the genomic DNA of the gene-edited cells for PCR amplification and / or sequencing verification. Preferably, the present invention extracts DNA for PCR amplification during cell clone formation, more preferably using DQAF1 and DQAR1 primers for PCR amplification, sequencing the amplification products, and comparing the sequencing results with exon 1 of DQA to detect whether sequence editing has occurred.
[0043] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, describes a primer pair for amplifying exon 1 of the sheep DQA gene, sgRNA, and its applications provided by the present invention. However, these descriptions should not be construed as limiting the scope of protection of the present invention.
[0044] Example 1
[0045] according to Figure 1 The following experiments were conducted using the procedure shown:
[0046] 1. Based on the reference sequence provided by NCBI for the DQA gene (NC_056073) of sheep (version ARS-UI_Ramb_v2.0), PCR primers (DQAF1 and DQAR1) targeting exon 1 were designed. Using the Hu sheep genome as a template, PCR amplification was performed using the designed primers. After sequencing the amplified products, the sequencing results were compared with the reference sequence. Figure 2 ), confirming the DQA sequence of the Hu sheep.
[0047] The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 45 s, 34 cycles; 72℃ extension for 5 min; and storage at 4℃.
[0048] The amplification system was as follows (using Phanta Max mix amplification enzyme from Nanjing Novizan Biotechnology Co., Ltd., catalog number P525-03): 1 μL each of DQAF1 and DQAR1, 1 μL of DNA template, 12.5 μL of 2×mix, and water to a final volume of 25 μL.
[0049] 2. The synthesized oligonucleotide sequences of sgRNA (SEQ ID NO.3~SEQ ID NO.6) were annealed using the following annealing program: 95℃ for 5 min, 37℃ for 10 min, and stored at 4℃. Simultaneously, the Cas9 expression vector pX330 was digested with BbsI, and the digestion products were purified and recovered using an agarose gel extraction kit (Hunan Aikerui Biotechnology Co., Ltd., catalog number: AG21004).
[0050] Annealing system (10 μL): DQAsg-F 2.5 μL, DQAsg-R 2.5 μL, 10×PCR buffer 1.0 μL and the remainder ddH2O.
[0051] 3. The enzyme-digested pX330 vector and the annealed double-stranded sg sequence were ligated using T4 DNA ligase. The ligation product was transformed into competent E. coli cells, and the obtained bacterial clones were sequenced. If the sequencing results contained the designed sg sequence, the ligation was successful. Colonies containing the correct vector were cultured in large quantities, and plasmids (Tiangen Biotech Co., Ltd.: DP118-02) were extracted to obtain the recombinant vectors pX330DQAsg1 and pX330DQAsg2.
[0052] 4. Cell transfection: pX330DQAsg1, pX330DQAsg2 and g418 (genemycin) resistance vector pl452 were used to co-transfect Hu sheep fetal fibroblasts via liposome transfection (Invitrogen: LIPOFECTAMINE 3000 L3000015). The total amount of plasmid transfected in each six-well plate was 9 μg.
[0053] Transfection system 1: 7.5 μL of liposomes and 125 μL of DMEM / F12;
[0054] Transfection system 2: 3 μg of pl452 vector, 3 μg of pX330DQAsg1, 3 μg of pX330DQAsg2, 10 μL of P3000 reagent and 125 μL of DMEM / F12.
[0055] 5. After mixing System 1 and System 2, incubate at room temperature for 20 min. Then, add the mixture to the wells of a six-well plate containing Hu sheep fetal fibroblasts for transfection. Add culture medium (85% DMEM / F12 (Hyclone: SH30023.01), 15% fetal bovine serum (gibco: 10091148)) to 2 mL. 48 h after transfection, digest the cells and divide them into 20 10 cm culture dishes, and add 350 μg / ml g418 for selection culture.
[0056] 6. On days 10-12 of cell culture, cell clones are formed in the culture dish. Single clones are picked and cultured in 48-well plates. After the cells have grown to confluence, the cells are collected and the genome is extracted (genome extraction kit: (Tiangen Biotech (Beijing) Co., Ltd.), DP304-03).
[0057] 4. The monoclonal genome edited against exon 1 of DQA was amplified by PCR using primers DQAF1 and DQAR1, and the amplification products were sequenced. Figure 3 The sequencing results were compared with exon 1 of the DQA sequence to detect whether the sequence had been edited. The PCR amplification procedure and system were the same as in the first step.
[0058] After the above steps, following vector transfection, 40 monoclonal cell lines were obtained by screening for exon 1 editing. After sequencing, 26 clones were found to be gene-editing positive, with a positive rate of 65%. The number of clones with editing on both sets of chromosomes (alleles) was 6, and the probability of editing on both alleles was 15%.
[0059] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. Targeting sheep genome DQA The sgRNA of exon 1 of the gene is used in the preparation of sheep genomes DQA The application of gene editing in products using exon 1 of the gene is characterized by, The method for gene editing comprises CRISPR / Cas9; The method for gene editing comprises: (1) annealing DQAsg1-F and DQAsg1-R, DQAsg2-F and DQAsg2-R respectively to obtain DQAsg1 and DQAsg2, and connecting pX330 vector after enzyme digestion to construct recombinant vectors pX330DQAsg1 and pX330DQAsg2; the nucleotide sequence of DQAsg1-F is shown as SEQ ID NO. 3, the nucleotide sequence of DQAsg1-R is shown as SEQ ID NO. 4, the nucleotide sequence of DQAsg2-F is shown as SEQ ID NO. 5, and the nucleotide sequence of DQAsg2-R is shown as SEQ ID NO. 6; (2) co-transfecting the recombinant vectors pX330DQAsg1 and pX330DQAsg2 with g418 resistance vector pl452 into sheep somatic cells, and obtaining gene edited cells after culture and g418 resistance screening.
2. Use according to claim 1, characterized in that, After obtaining the gene edited cells in step (2), the method further comprises extracting genomic DNA of the gene edited cells for PCR amplification and / or sequencing verification.
Citation Information
Patent Citations
SgRNA combination for editing sheep SOCS2 gene, amplification primer and application
CN114574493A