Application of miRNA in Recombinant Protein Expression in CHO Cells
By increasing the amount of miR-885-3p or miR-185-5p in CHO cells, using these miRNAs to regulate the expression of target genes, the problem of insufficient yield in CHO cells in recombinant protein production was solved, and the effect of significantly increasing the expression of recombinant protein was achieved.
Patent Information
- Application Number
- CN202211584487.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-09
- Publication Date
- 2025-06-13
- Estimated Expiration
- 2042-12-09
AI Technical Summary
Although the prior art has increased the yield of CHO cells in the production of recombinant proteins, with the development of the biopharmaceutical industry, the demand for recombinant proteins produced by mammalian cells is still increasing, and further increasing the yield has become an urgent problem to be solved.
These miRNAs are used to regulate the expression of target genes by increasing the amount of miR-885-3p or miR-185-5p in CHO cells, thereby increasing the expression of recombinant proteins. The method includes transfecting miRNA mimics or overexpression vectors into CHO cells to increase the amount and durability of the miRNA.
Increasing the amount of miR-885-3p or miR-185-5p significantly increases the expression of recombinant proteins in CHO cells, is suitable for a wide range of recombinant protein production, and improves production efficiency and yield.
Smart Images

Figure CN116121301B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the application of miRNA in the recombinant protein expression of CHO cells, and belongs to the fields of molecular biology and biotechnology. Background Art
[0002] Recombinant proteins produced by genetic engineering have been widely used in industries such as medicine, beauty, and health care. Recombinant proteins can be expressed in prokaryotic cells and eukaryotic cells. However, the effectiveness and immunogenicity of recombinant proteins are directly related to post-translational modification (PTM). Therefore, mammalian cell lines are the most suitable production hosts for biopharmaceuticals. Among them, CHO cells are the most commonly used expression system. Compared with other expression systems, CHO cells have the following advantages for producing recombinant proteins: they can better adapt to high-density suspension culture; they are less sensitive to virus infection; they have post-translational modifications similar to humanized cells and can produce high-quality proteins suitable for safe use by humans, with a low incidence of immune reactions; they have a powerful gene amplification system, such as the dihydrofolate reductase (DHFR)-mediated gene amplification system or the glutamine synthetase (GS)-mediated gene amplification system, and can obtain a high yield of recombinant proteins; foreign genes can be stably integrated into CHO cells; CHO cells are fibroblast cells and hardly secrete endogenous proteins, which is very beneficial for the separation and purification of recombinant proteins. Although CHO cells have been widely used in the production of recombinant proteins, there are still many problems to be solved in the process of producing recombinant proteins by CHO cells. It has been found through research that the performance of CHO cell lines can be improved by genetic engineering, such as gene knockout mediated by small interfering RNA, zinc finger nucleases or the CRISPR / Cas9 system; the expression of transgenic genes can be increased by optimizing the design of expression vectors, and the purpose of anti-apoptosis and promoting production can also be achieved by increasing the expression of beneficial genes, but it may increase the translation burden of cells.
[0003] MicroRNA (miRNA) is a class of regulatory non-coding RNAs with a fragment length of about 23 nucleotides. A single miRNA can bind to the mRNA sequences of one or more target genes and regulate the expression of target proteins by initiating degradation or inhibiting translation, belonging to the post-transcriptional regulation level. miRNA has been widely applied in the field of tumor and tumor treatment. Recently, miRNA has been applied to the field of CHO cell engineering to improve cell phenotypes related to yield and quality. These endogenous small RNAs can regulate cell pathways and do not compete with the translation mechanism of host cells when overexpressed in cells.
[0004] Although the current unit yield of recombinant proteins has reached a relatively high level, with the continuous development of the biopharmaceutical industry, the demand for recombinant proteins produced by mammalian cells is increasing, and further improving the yield of mammalian cells has become an urgent problem to be solved. Summary of the Invention
[0005] To solve the above problems, the object of the present invention is to provide the application of miRNA in the recombinant protein expression of CHO cells. As a new type of regulatory molecule, miRNA has the following advantages: 1) One miRNA may bind to multiple target genes and regulate multiple pathways in the protein expression process; 2) The formation of miRNA does not require a translation process, and the regulation is more convenient and rapid. Increasing the amount of miR-885-3p or miR-185-5p in CHO cells expressing recombinant proteins can significantly increase the expression level of recombinant proteins.
[0006] To achieve the above object, the technical solution adopted by the present invention is:
[0007] The application of miRNA in the recombinant protein expression of CHO cells, increasing the amount of miRNA in CHO cells used for expressing recombinant proteins to improve the expression level of recombinant proteins; the miRNA is miR-885-3p or miR-185-5p; the nucleotide sequence of miR-885-3p is as shown in SEQ ID NO.1; the nucleotide sequence of miR-185-5p is as shown in SEQ ID NO.2.
[0008] In the present invention, increasing the amount of miR-885-3p or miR-185-5p in CHO cells expressing recombinant proteins can significantly increase the expression level of recombinant proteins, and it can be widely applied to the production of recombinant proteins by CHO cells.
[0009] Preferably, increasing the amount of miRNA in CHO cells used for expressing recombinant proteins includes transfecting the mimic of the miRNA into CHO cells used for expressing recombinant proteins.
[0010] The miRNA mimic is convenient to synthesize and can quickly exert its regulatory effect.
[0011] Further preferably, the transfection amount of the miRNA mimic is 20-30 nM.
[0012] When the amount of the mimic is 20-30 nM, neither the mimic is wasted nor a good transfection efficiency can be obtained.
[0013] Preferably, increasing the amount of miRNA in CHO cells used for expressing recombinant proteins includes transfecting the overexpression vector of the miRNA into CHO cells used for expressing recombinant proteins.
[0014] The miRNA overexpression vector can make up for the short acting time of miRNA mimics and the shortcoming of being unable to play a regulatory role for a long time. It has a longer acting time and a more obvious effect.
[0015] Further preferably, the overexpression vector is a recombinant expression vector containing the precursor sequence of miR-885-3p or the precursor sequence of miR-185-5p; the nucleotide sequence of the miR-885-3p precursor sequence is as shown in SEQ ID NO.3, and the nucleotide sequence of the miR-185-5p precursor sequence is as shown in SEQ ID NO.4.
[0016] After the precursor sequence in the vector is expressed in cells and processed, it becomes a mature miRNA sequence and plays its role in regulating protein expression.
[0017] Preferably, the recombinant protein is one of EGFP, SEAP, and adalimumab. Brief Description of the Drawings
[0018] Figure 1 It shows the effect of transfecting miR-885-3p mimics on the amount of green fluorescence in Example 1 of the present invention;
[0019] Figure 2 It shows the effect of transfecting miR-885-3p mimics on the expression level of SEAP protein in Example 2 of the present invention;
[0020] Figure 3 It shows the map of the miR-885-3p recombinant expression vector in Example 3 of the present invention;
[0021] Figure 4 It shows the effect of the miR-885-3p recombinant expression vector on the expression level of SEAP protein in Example 3 of the present invention;
[0022] Figure 5 It shows the effect of the miR-885-3p recombinant expression vector and the miR-185-5p recombinant expression vector on the yield of adalimumab in Example 4 of the present invention;
[0023] Figure 6 It shows the effect of transfecting miR-185-5p mimics on the amount of green fluorescence in Example 5 of the present invention;
[0024] Figure 7 It shows the effect of transfecting miR-185-5p mimics on the expression level of SEAP protein in Example 6 of the present invention;
[0025] Figure 8 It shows the map of the miR-185-5p recombinant expression vector in Example 7 of the present invention;
[0026] Figure 9 Effect of miR-185-5p recombinant expression vector on SEAP protein expression level in Example 7 of the present invention. Specific implementation manners
[0027] The present invention will be further described below in conjunction with specific implementation manners, but the protection scope of the present invention is not limited thereto; unless otherwise specified, various reagents, instruments, etc. used in the examples are commercially available products.
[0028] Some biological materials, experimental reagents, experimental equipment, etc. involved in the following examples and test examples are briefly introduced as follows:
[0029] Biological materials:
[0030] CHO-EGFP cells, CHO-SEAP cells, and CHO-adalimumab are cell lines overexpressing the corresponding proteins constructed by this laboratory using conventional means without other special modifications. The original CHO cells were purchased from the Shanghai Institute of Cells.
[0031] I. Specific implementation example of the application of miR-885-3p in recombinant protein expression in CHO cells
[0032] In the present invention, miR-885-3p mimics were transfected into CHO-EGFP cells and CHO-SEAP cells respectively. After 72 h, the expression level of EGFP was detected by flow cytometry. Compared with the control group, the expression level of EGFP in the transfection group increased; after 72 h, the expression of SEAP was detected by ELISA. Compared with the control group, the yield of SEAP in the transfection group increased. Recombinant expression vectors containing the precursor sequence of miR-885-3p were transfected into CHO-SEAP cells and CHO-adalimumab cells respectively. After 7 days, the expression of SEAP was detected by ELISA. Compared with the control group, the yield of SEAP in the transfection group increased significantly; after 7 days, the expression of adalimumab antibody was detected by ELISA and Western blot. Compared with the control group, the expression level of adalimumab antibody in CHO cells transfected with the above recombinant vector increased significantly.
[0033] Example 1 Effect of miR-885-3p mimics on EGFP protein expression
[0034] 1. Synthesis of miR-885-3p mimics
[0035] The miR-885-3p mimics were synthesized by Shanghai GenePharma Co., Ltd., and the sequence was: 5'-AGGCAGCGGGGUGUAGUGGAUA-3' (as shown in SEQ ID NO.1).
[0036] 2. Effect of miR-885-3p mimic on the expression of EGFP protein in CHO-EGFP cells
[0037] On the day before transfection, inoculate the suspension of actively growing CHO-EGFP cells into a 12-well plate; the next day, transfect miR-885-3p mimic (25 nM), and detect the expression of green fluorescent protein in CHO-EGFP by flow cytometry 72 h later (the transfection reagent is lipo2000).
[0038] The results are as Figure 1 shown. The expression of EGFP in CHO-EGFP cells transfected with miR-885-3p mimic is higher than that in CHO-EGFP cells transfected with miRNA NC, and the fluorescence intensity increases from 54511 in the control to 57879. This indicates that miR-885-3p can increase the protein production of EGFP in CHO-EGFP cells.
[0039] Example 2 miR-885-3p mimic promotes the expression of SEAP protein in CHO-SEAP cells
[0040] On the day before transfection, inoculate the suspension of actively growing CHO-SEAP cells into a 12-well plate; the next day, transfect miR-885-3p mimic (25 nM), and detect the expression of SEAP by ELISA 72 h later.
[0041] The results are as Figure 2 shown. The expression level of alkaline phosphatase (0.547 U) in CHO-SEAP cells transfected with miR-885-3p mimic is higher than that in CHO-EGFP cells transfected with miRNA NC (0.392 U). This indicates that miR-885-3p can increase the protein production of SEAP in CHO-SEAP cells.
[0042] Example 3 Effect of miR-885-3p recombinant expression vector on the expression of SEAP protein
[0043] 1. Construction of miR-885-3p recombinant expression vector
[0044] Using the PCDNA6.2-GM-EmGFP-miR-shRNA1-PGK-Puro vector as the parental vector, construct an overexpression vector of miR-885-3p, and the inserted sequence is the precursor sequence of miR-885-3p: 5'-CCGCACUCUCUCCAUUACACUACCCUGCCUCUUCUCCAUGAGAGGCAGCGGGGUGUA GUGGAUAGAGCACGGGU-3' (shown as SEQ ID NO.3). The vector map is as Figure 3 shown.
[0045] 2. Effect of miR-885-3p overexpression on SEAP protein expression in CHO-SEAP cells
[0046] Inoculate the suspension of actively growing CHO-SEAP cells into a 12-well plate one day before transfection; the next day, transfect the constructed miR-885-3p recombinant expression vector (2 μg vector, and the transfection reagent is lipo2000), and detect the expression of SEAP by ELISA 7 days later.
[0047] The results are as Figure 4 shown. The expression level of alkaline phosphatase (3 U) in CHO-SEAP cells transfected with the miR-885-3p recombinant expression vector was significantly higher (p < 0.01) than that in the control cells transfected with the negative control vector (1.56 U). This indicates that miR-885-3p can increase the protein production of SEAP in CHO-SEAP cells.
[0048] Example 4 miR-885-3p recombinant expression vector promotes the expression of adalimumab in CHO-adalimumab cells
[0049] Inoculate the suspension of actively growing CHO-adalimumab cells into a 12-well plate one day before transfection; the next day, transfect the constructed miR-885-3p recombinant expression vector, and detect the expression of adalimumab by Western blot and ELISA 7 days later.
[0050] The Western blot results are as Figure 5 shown. The production of adalimumab in CHO-adalimumab cells transfected with the miR-885-3p recombinant expression vector was significantly higher than that in the control cells transfected with the negative control vector.
[0051] The ELISA results showed that after transfection with the miR-885-3p overexpression vector, the antibody production of adalimumab increased from 1.35 mg / L to 2.07 mg / L, an increase of 53.3%.
[0052] II. Specific examples of the application of miR-185-5p in the recombinant protein expression of CHO cells
[0053] In CHO-EGFP cells and CHO-SEAP cells, miR-185-5p mimics were transfected respectively. After 72 h, flow cytometry was used to detect the expression level of EGFP. Compared with the control group, the expression level of EGFP in the transfection group increased; after 72 h, ELISA was used to detect the expression of SEAP. Compared with the control group, the yield of SEAP in the transfection group increased. In CHO-SEAP cells and CHO-adalimumab cells, recombinant expression vectors containing the precursor sequence of miR-185-5p were transfected respectively. After 7 days, ELISA was used to detect the expression of SEAP. Compared with the control group, the yield of SEAP in the transfection group increased significantly; after 7 days, ELISA and Western blot were used to detect the expression of adalimumab antibody. Compared with the control group, the expression level of adalimumab antibody in CHO cells transfected with the above recombinant vector increased significantly.
[0054] Example 5 Effect of miR-185-5p mimics on the expression of EGFP protein
[0055] 1. Synthesis of miR-185-5p mimics
[0056] The miR-185-5p mimics were synthesized by Shanghai GenePharma Co., Ltd., and the sequence was: 5'-UGGAGAGAAAGGCAGUUCCUGA-3' (as shown in SEQ ID NO.2).
[0057] 2. Effect of miR-185-5p mimics on the expression of EGFP protein in CHO-EGFP cells
[0058] The suspension of actively growing CHO-EGFP cells was seeded into 12-well plates one day before transfection; the next day, miR-185-5p mimics (25 nM) were transfected, and after 72 h, flow cytometry was used to detect the expression of green fluorescent protein in CHO-EGFP.
[0059] The results were as Figure 6 shown. The expression of EGFP in CHO-EGFP cells transfected with miR-185-5p mimics was higher than that in CHO-EGFP cells transfected with miRNA NC, and the fluorescence intensity increased from 54511 in the control to 56604. It shows that miR-185-5p can increase the protein yield of EGFP in CHO-EGFP cells.
[0060] Example 6 miR-185-5p mimics promote the expression of SEAP protein in CHO-SEAP cells
[0061] Inoculate the suspension of actively growing CHO-SEAP cells into a 12-well plate one day before transfection; on the next day, transfect miR-185-5p mimic (25 nM), and detect the expression of SEAP by ELISA 72 h later.
[0062] The results are as Figure 7 shown. The expression level of alkaline phosphatase (0.521) in CHO-SEAP cells transfected with miR-185-5p mimic is higher than that in CHO-EGFP cells transfected with miRNA NC (0.392), indicating that miR-185-5p can increase the protein production of SEAP in CHO-SEAP cells.
[0063] Example 7 Effect of miR-185-5p recombinant expression vector on the expression of SEAP protein
[0064] 1. Construction of miR-185-5p recombinant expression vector
[0065] Using the pCDNA6.2-GM-EmGFP-miR-shRNA1-PGK-Puro vector as the parent vector, construct an overexpression vector of miR-185-5p, and the inserted sequence is the precursor sequence of miR-185-5p: 5'-AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCU GGCUUUCCUCUGGUCCUUCCCUCCCA-3' (as shown in SEQ ID NO.4). The vector map is as Figure 8 shown.
[0066] 2. Effect of miR-185-5p overexpression on the expression of SEAP protein in CHO-SEAP cells
[0067] Inoculate the suspension of actively growing CHO-SEAP cells into a 12-well plate one day before transfection; on the next day, transfect the constructed miR-185-5p recombinant expression vector, and detect the expression of SEAP by ELISA 7 days later.
[0068] The results are as Figure 9 shown. The expression level of alkaline phosphatase (2.7 U) in CHO-SEAP cells transfected with the miR-185-5p overexpression vector is significantly higher (p<0.01) than that in the control cells transfected with the negative control vector (1.56 U), indicating that miR-185-5p can increase the protein production of SEAP in CHO-SEAP cells.
[0069] Example 8 miR-185-5p recombinant expression vector promotes the expression of adalimumab in CHO-adalimumab cells
[0070] Inoculate the suspension of actively growing CHO - adalimumab cells into a 12 - well plate one day before transfection; the next day, transfect the constructed miR - 185 - 5p recombinant expression vector, and detect the expression of adalimumab antibody by Western blot and ELISA after 7 days.
[0071] The results of Western blot are as Figure 5 shown. The yield of adalimumab antibody in CHO - adalimumab cells transfected with the miR - 185 - 5p recombinant expression vector is significantly higher than that in the control cells transfected with the negative control vector.
[0072] The ELISA results show that after transfection with the miR - 185 - 5p recombinant expression vector, the antibody yield of adalimumab increased from 1.35 mg / L to 1.82 mg / L, an increase of 34.8%.
[0073] To verify whether all miRNAs can increase the expression level of recombinant proteins in CHO cells, corresponding detections were carried out on common miRNAs. The specific operations are as follows:
[0074] Comparative Example 1 Effect of miR - 370 - 3p and miR - 219c - 5p mimics on the expression of SEAP protein in CHO - SEAP cells
[0075] Inoculate the suspension of actively growing CHO - SEAP cells into a 12 - well plate one day before transfection; the next day, transfect miR - 370 - 3p (25 nM) and miR - 219c - 5p mimics (25 nM) respectively, and detect the expression of SEAP by ELISA after 72 h.
[0076] The ELISA results show that the expression level of alkaline phosphatase in CHO - SEAP cells transfected with miR - 370c - 3p mimics is 0.345 U, the expression level of alkaline phosphatase in CHO - SEAP cells transfected with miR - 219c - 5p mimics is 0.323 U, while the expression level of alkaline phosphatase in the control cells transfected with miRNA NC mimics is 0.372 U. The two miRNAs decreased the expression level of alkaline phosphatase in CHO - SEAP cells.
[0077] Comparative Example 2 Effect of miR - 106b - 5p recombinant expression vector on the expression of adalimumab antibody in CHO - adalimumab cells
[0078] Inoculate the suspension of actively growing CHO - adalimumab cells into a 12 - well plate one day before transfection; the next day, transfect the constructed miR - 106b - 5p recombinant expression vector, and detect the expression of adalimumab antibody by ELISA after 7 days.
[0079] ELISA results showed that after transfection with the miR-106b-5p recombinant expression vector, the antibody production of adalimumab was 1.23 mg / L, and the antibody production of adalimumab in the control cells transfected with the negative control vector was 1.35 mg / L. miR-106b-5p had little effect on the expression of adalimumab antibody in CHO-adalimumab cells.
[0080] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. Application of miRNA in recombinant protein expression in CHO cells, which is characterized in that: increasing the amount of miRNA in CHO cells for expressing recombinant proteins to improve the expression level of recombinant proteins; the miRNA is miR-185-5p; the nucleotide sequence of miR-185-5p is as shown in SEQ ID NO.
2.
2. The application of miRNA in recombinant protein expression in CHO cells according to claim 1, which is characterized in that: the increasing the amount of miRNA in CHO cells for expressing recombinant proteins includes transfecting mimics of the miRNA into CHO cells for expressing recombinant proteins.
3. The application of miRNA in recombinant protein expression in CHO cells according to claim 2, which is characterized in that: the transfection amount of the miRNA mimics is 20-30 nM.
4. The application of miRNA in recombinant protein expression in CHO cells according to claim 1, which is characterized in that: the increasing the amount of miRNA in CHO cells for expressing recombinant proteins includes transfecting an overexpression vector of the miRNA into CHO cells for expressing recombinant proteins.
5. The application of miRNA in recombinant protein expression in CHO cells according to claim 4, which is characterized in that: the overexpression vector of the miRNA is a recombinant expression vector containing the precursor sequence of miR-185-5p; the nucleotide sequence of the miR-185-5p precursor sequence is as shown in SEQ ID NO. 4.
Citation Information
Patent Citations
CELL ENGINEERING USING RNAs
US20150140591A1