New use of mettl14 / mir-17-5p / mfn2 axis
By regulating the METTL14/miR-17-5p/MFN2 axis, the mitochondrial homeostasis of colorectal cancer cells was adjusted, solving the problem of chemotherapy resistance, providing a new method for assessing chemotherapy sensitivity, and enhancing the efficacy of 5-FU chemotherapy.
Patent Information
- Application Number
- CN202211171593.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-09-26
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2042-09-26
AI Technical Summary
There are no effective interventions for chemotherapy resistance in colorectal cancer, especially resistance to 5-fluorouracil (5-FU) chemotherapy regimens, and the interaction between m6A methylation and mitochondrial homeostasis has not been reported, which affects the efficacy of chemotherapy.
By regulating the METTL14/miR-17-5p/MFN2 axis, miR-17-5p expression is reduced and MFN2 overexpression is promoted, forming the METTL14/miR-17-5p/MFN2 axis, regulating mitochondrial homeostasis, and enhancing the sensitivity of colorectal cancer to 5-FU chemotherapy.
By detecting the expression levels of METTL14, miR-17-5p, or MFN2 in colorectal cancer patients, we can determine the patients' resistance and sensitivity to 5-FU chemotherapy, provide new chemotherapy targets and research ideas, and improve the efficacy of chemotherapy.
Smart Images

Figure CN116121375B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of colon cancer, and particularly relates to a new use of a METTL14 / miR-17-5p / MFN2 axis, in particular, application of METTL14, miR-17-5p and MFN2 in preparation of a detection reagent or kit for 5-FU drug resistance effect of colon cancer. BACKGROUND
[0002] Colorectal cancer (CRC) seriously threatens the survival and health of all mankind, and its incidence ranks the third in the world, while its mortality ranks the second. Although surgical treatment is the best means for the treatment of colorectal cancer, chemotherapy is still the most important treatment for patients in the advanced stage. However, tumor chemotherapy resistance is the key to affect the treatment effect and survival prognosis of patients with colorectal cancer, and is also the main reason for treatment failure. At present, the mechanism of tumor chemotherapy resistance has not been fully elucidated, and there is still a lack of effective intervention means in clinic, and how to effectively reverse the chemotherapy resistance is still a difficult problem to be solved. The chemotherapy regimen based on 5-fluorouracil (5-FU) is the cornerstone of the treatment of patients with advanced colorectal cancer, and the study on the 5-FU chemotherapy resistance of colorectal cancer and its molecular mechanism is the key to improve the therapeutic effect of colorectal cancer.
[0003] Recent studies have shown that epigenetic changes are an important molecular feature of cancer, which can be used as a biomarker for diagnosis and prediction of treatment response. The specific process and molecular mechanism of m6A methylation modification in regulating chemotherapy resistance of colorectal cancer is still unclear. In recent years, it has been gradually recognized that mitochondrial homeostasis is an important defense mechanism in cells, which widely participates in tumor metabolic reprogramming, drug resistance and recurrence through mitochondrial biosynthesis, mitochondrial dynamics (fusion / fission), mitochondrial autophagy and other biological processes. However, at present, there is no report on the “interaction” between m6A methylation and mitochondrial homeostasis, so it is necessary to study the role and mechanism of m6A methylation in regulating mitochondrial homeostasis through epigenetic modification, which may become a breakthrough in the study of chemotherapy resistance of colorectal cancer. SUMMARY
[0004] The purpose of the present application is to provide the application of METTL14 / miR-17-5p / MFN2 axis in the preparation of a detection reagent or kit for 5-FU drug resistance effect of colon cancer.
[0005] The above purpose of the present application is achieved by the following technical solutions:
[0006] The application of METTL14 / miR-17-5p / MFN2 axis in the preparation of a detection reagent for 5-FU drug resistance effect of colon cancer.
[0007] Further, the application discloses a METTL14 / miR-17-5p / MFN2 axis and a preparation method of the METTL14 / miR-17-5p / MFN2 axis.
[0008] Preferably, the METTL14 / miR-17-5p / MFN2 axis comprises METTL14, miR-17-5p and MFN2.
[0009] Preferably, overexpression of METTL14 reduces expression of miR-17-5p, low expression of miR-17-5p promotes overexpression of MFN2, forms the METTL14 / miR-17-5p / MFN2 axis, and further makes a colorectal cancer patient more sensitive to 5-FU chemotherapy.
[0010] The application aims to clarify the effect of miR-17-5p on 5-FU chemotherapy resistance of colorectal cancer, further clarify the mechanism of METTL14 in up-regulating miR-17-5p expression through m6A methylation modification, explore the molecular network of miR-17-5p in regulating mitochondrial homeostasis by promoting MFN2 expression, connect m6A methylation and mitochondrial homeostasis imbalance with miR-17-5p as a "bridge", and provide a new research idea for chemotherapy treatment of colorectal cancer and a new scientific basis for establishing the METTL14 / miR-17-5p / MFN2 axis as a treatment target for chemotherapy resistance of colorectal cancer patients.
[0011] The application finds through experiments that in CRC, METTL14 down-regulates and reduces the m6A modification level, further reduces the recognition and combination of YTHDC2 to pri-miR-17, increases the stability of pri-miR-17 mRNA, and promotes the expression of miR-17-5p. Overexpressed miR-17-5p inhibits MFN2, reduces mitochondrial fusion, enhances mitochondrial fission and mitochondrial autophagy, and finally induces 5-FU chemotherapy drug resistance in CRC.
[0012] Therefore, the following conclusions are drawn:
[0013] Compared with only transfecting an empty control plasmid, when METTL14 is overexpressed, a colorectal cancer patient is more sensitive to 5-FU.
[0014] Compared with only transfecting a control inhibitor, when miR-17-5p is low-expressed, a colorectal cancer patient is more sensitive to 5-FU.
[0015] Compared with only transfecting an empty control plasmid, when MFN2 is overexpressed, a colorectal cancer patient is more sensitive to 5-FU.
[0016] Compared with only transfecting empty control plasmid, overexpression of METTL14 reduces the expression of miR-17-5p, low expression of miR-17-5p promotes overexpression of MFN2, forms METTL14 / miR-17-5p / MFN2 axis, and further makes colorectal cancer patients more sensitive to 5-FU chemotherapy.
[0017] Compared with the prior art, the application has the following advantages: in CRC, METTL14 is down-regulated and reduces the m6A modification level, further reduces the recognition and combination of YTHDC2 to pri-miR-17, increases the stability of pri-miR-17 mRNA, and promotes the expression of miR-17-5p. Overexpressed miR-17-5p inhibits MFN2, causes the decrease of mitochondrial fusion, the increase of mitochondrial fission and mitochondrial autophagy, and finally induces 5-FU chemotherapy drug resistance in CRC, so that the drug resistance, chemotherapy resistance or sensitivity of the patient to 5-FU chemotherapy can be judged by detecting whether METTL14, miR-17-5p or MFN2 in the colorectal cancer patient and the control is relatively overexpressed or low expressed. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1is miR-17-5p reduces 5-FU-induced apoptosis in Example 1, where (A) up- and down-regulated genes in HCT116 cells after miR-17-5p overexpression; (B) top 20 KEGG pathway enrichments and KEGG secondary classifications of miR-17-5p overexpressed HCT116 cells; (C) relative expression of miR-17-5p in normal intestinal epithelial cells and CRC cell lines; (D) relative expression of miR-17-5p in 43 pairs of CRC tissues from clinical cohorts; (E) overexpression and knockdown efficiency of miR-17-5p in HCT116 cells; (F) apoptosis assay of HCT116 cells with different miR-17-5p expression levels after 5-FU treatment; (G) 5-FU IC50 of HCT116 cells with different miR-17-5p expression levels; (H) EdU proliferation assay of HCT116 cells with different miR-17-5p expression levels after 5-FU treatment; (I) 5-FU intervention procedure of xenograft nude mice model; (J) overexpression efficiency of stably transfected miR-17-5p CRC cells and tumor size of xenografts after 6 times of 5-FU treatment; (K) tumor volume change during 5-FU treatment; (L) tumor weight of xenografts in different groups; (M) H&E and immunohistochemical analysis of Caspase7 in two groups; (N) Western blot analysis of Caspase7, cleaved-Caspase7, BCL2 and BAX protein expression levels in different HCT116 cell groups treated with 5-FU; *, P < 0.05; **, P < 0.01; ***, P < 0.001. Error bars, SD; scale bars, 400 μm in (H) and 100 μm in (L);
[0019] Figure 2is miR-17-5p reduces 5-FU-induced apoptosis through mitochondrial dynamics and mitophagy in Example 1; (A) Prediction of miR-17-5p target genes by online databases such as TargetScan, miRDB, miRWalk, and StarBase, and RNA-seq; (B) Gene set enrichment analysis (GSEA) of GSE81005 indicates that “complex containing mitochondrial protein” and “mitochondrial envelope” play a role in CRC cells with different sensitivity to 5-FU; HCT8 / WT: HCT-8 human CRC wild-type cells; HCT8 / 5-FU: its 5-FU-induced resistant cell line; (C) Expression of MFN2 in TCGA CRC cohort; (D) Analysis of overall survival of MFN2 from GEPIA database; (E) Transmission electron microscopy (TEM) images of mitochondria in control cells and miR-17-5p overexpressed cells; *, mitochondria; #, lysosome; &, autolysosome; (F) Mitochondrial morphology of control HCT116 cells and miR-17-5p overexpressed cells with or without Mdivi-1 under confocal microscope; (G) mtDNA copy number of HCT116 cells with different miR-17-5p expression levels; (H) Mitochondrial membrane potential shown by JC-1 staining. Red fluorescence: JC-1 aggregate; Green fluorescence: JC-1 monomer; (I) Colocalization (yellow spots) of lysosome (LysoTracker Red) and mitochondria (MitoTracker Green); Yellow spots indicate autolysosomes containing mitochondria; (J) Apoptosis assay of control and miR-17-5p overexpressed HCT116 cells with or without Mdivi-1; (K) Western blot analysis of LC3B, p62, FIS1, and MFN2 protein expression levels in HCT116 cells with different miR-17-5p expression levels; (L) Prediction of miR-17-5p binding sites in the 3’UTR region of MFN2 based on TargetScan; (M) Co-transfection of miR-17-5p and luciferase vectors encoding wild-type or mutant MFN2 3’-UTR region into HCT116 cells, and measurement of relative luciferase activity; (N) Western blot analysis of Caspase7, cleaved-Caspase7, LC3B, p62, BCL2, BAX, MFN2, and DRP1; *, P<0.05; **, P<0.01; ***, P<0.001. Error bars, SD; scale bar, 500 nm in (E), 10 μm in (F), 400 μm in (H) and (I);
[0020] Figure 3is MFN2 co-expression promotes apoptosis of CRC cells in Example 1; (A, B) rescue experiment of MFN2 and miR-17-5p: IC50 of 5-FU and Annexin V-PE / 7AAD apoptosis in HCT116 cells; (C) Western blot analysis of MFN2, PARP, cleaved-PARP, BAX, Caspase7 and cleaved-Caspase7 in rescue experiment;
[0021] Figure 4 is low expression of METTL14 in CRC tissues in Example 1; (A) METTL14 expression in TCGA CRC cohort and GSE41657 adenoma and adenocarcinoma cohort; (B) relative expression of METTL14 in 43 pairs of CRC tissues from clinical cohort; (C) overall survival and disease-free survival analysis of METTL14 in GEPIA database.
[0022] Figure 5 is METTL14 promotes 5-FU-induced cell apoptosis in Example 1; (A) overexpression and knockdown efficiency of METTL14 in HCT116 cells; (B) 5-FU IC50 of different groups of HCT116 cells; (C) EdU proliferation test of HCT116 cells with different METTL14 expression levels after 5-FU treatment; (D) apoptosis assay of HCT116 cells with different METTL14 expression levels after 5-FU treatment; (E) Western blot analysis of PARP, cleaved-PARP, Caspase7, cleaved-Caspase7, BCL2 and BAX protein expression levels in HCT116 cells with different METTL14 expression levels treated with 5-FU; (F) knockdown efficiency of stably transfected METTL14 CRC cells; (G) subcutaneous implantation of tumor cells in nude mice; (H) tumor size and weight of xenografts after 6 times of 5-FU treatment; (I) change of tumor volume during 5-FU treatment; (J) H&E and immunohistochemical analysis of Caspase7 levels in two groups; *, P<0.05; **, P<0.01; ***, P<0.001; error bar, SD; scale bar, 400 μm in (C), 100 μm in (J);
[0023] Figure 6METTL14 modulates the expression of miR-17-5p by m6A modification in Example 1; (A) quantification of m6A levels in HCT116 cells after METTL14 knockdown or overexpression; (B) relative expression of pri-miR-17, pre-miR-17 and miR-17-5p after METTL14 knockdown or overexpression; (C) possible m6A modification sites on pri-miR-17 predicted by SRAMP database; (D) MeRIP and MeRIP-qPCR analysis demonstrated m6A modification on pri-miR-17; (E) qPCR analysis of pri-miR-17 levels in different HCT116 cell groups after ActD treatment; *, P<0.05; **, P<0.01; ***, P<0.001; error bar, SD;
[0024] Figure 7 METTL14 knockdown enhances pri-miR-17 mRNA stability through m6A-YTHDC2 dependent pathway in Example 1; (A) RT-PCR analysis of m6A writers in HCT116 cells after METTL14 knockdown; (B) Western blot analysis of YTHDC2 in HCT116 cells transfected with YTHDC2 and co-transfected with si-METTL14 / YTHDC2; (C) relative expression of pri-miR-17 and miR-17-5p in HCT116 cells transfected with YTHDC2 and co-transfected with si-METTL14 / YTHDC2; (D) RT-PCR analysis of pri-miR-17 levels in different HCT116 cell groups after ActD treatment; (E) luciferase vectors encoding pri-miR-17 with wild type or m6A sequence mutation were constructed; (F) YTHDC2 induced post-transcriptional repression of pri-miR-17 in HCT116 cells; *, P<0.05; **, P<0.01; ***, P<0.001; error bar, SD;
[0025] Figure 8METTL14 knockdown significantly enhanced CRC 5-FU resistance through miR-17-5p / MFN2 axis in Example 1; (A) Correlation of METTL14 and miR-17-5p expression levels in CRC tissues (n=30); (B) RT-PCR analysis of METTL14, miR-17-5p and MFN2 expression levels in normal intestinal epithelial cells and CRC cell lines; (C, D) IC50 of 5-FU and AnnexinV-PE / 7AAD apoptosis in HCT116 cells in METTL14 and miR-17-5p rescue experiments; (E) Western blot analysis of LC3B, p62, BAX, BCL2, Caspase7, cleaved-Caspase7, MFN2, FIS1, METTL14 in rescue experiments; (F) Transfection efficiency of miR-17-5p and control vector (NC / miR-17-5p) or METTL14 (METTL14 / miR-17-5p) stably co-expressed cell lines; (G) Subcutaneous injection of tumor cells in nude mice; (H, I) Tumor size and weight of three groups of xenografts after 6 times of 5-FU treatment; (J) Changes in tumor volume during 5-FU treatment; (K) H&E, immunohistochemical analysis of Caspase7 and MFN2 in three groups. *, P < 0.05; **, P < 0.01; ***, P < 0.001. Error bars, SD. Scale bar, 100 μm in (K);
[0026] Figure 9 METTL14 / miR-17-5p / MFN2 axis induces 5-FU chemoresistance in colorectal cancer in Example 1. DETAILED DESCRIPTION
[0027] The application will be further described in conjunction with the following examples and drawings. The raw materials used below, unless otherwise specified, are commercially available.
[0028] Example 1
[0029] I. The implementation process is summarized as follows:
[0030] 1. Western blot (WB) and immunohistochemical (IHC) analysis
[0031] Using anti-AP METTL14, anti-MFN2, anti-FIS1, anti-DRP1, anti-BAX, anti-BCL2 and anti-Caspase7 / cleaved-Caspase7 (26158-1-AP, 12186-1-AP, 10956-1-AP, 12957-1-, 50599-2-Ig, 12789-1-AP, 27155-1-AP; 1:1000; Proteintech, USA); anti-LC3A / B and anti-p62 (306019, 380612; 1:1000; ZenBio, China); anti-PARP and anti-cleaved-PARP (9542, 5625; 1:1000; CST, USA); and anti-YTHDC2 (ab220160, 1:1000, Abeam, UK) antibodies. The loading control is mouse anti-GAPDH monoclonal antibody (60004-1-Ig; 1:10000; Proteintech).
[0032] For IHC analysis, serial tumor sections with a thickness of 4 pm were prepared. Then, deparaffinization and antigen retrieval were performed according to the manufacturer’s instructions. The sections were incubated with anti-Caspase7 / p20 antibody (T40049S, 1:200; PA6277S, 1:100; Abmart). Color development was performed with DAB developer (ZSGB-BIO) and observed under a microscope.
[0033] 2. RNA m6A quantification
[0034] Total RNA was extracted from cells using TRIzol reagent. Total RNA m6A quantification was performed using m6A RNA Methylation Detection Kit (ab185912; Abeam, UK) according to the manufacturer’s instructions.
[0035] 3. RNA immunoprecipitation (RIP) and methylated RNA immunoprecipitation (MeRIP)
[0036] RIP and MeRIP assays were performed using RNA Immunoprecipitation (RIP) Kit and Methylated RNA Immunoprecipitation (MeRIP) Kit (BersinBio, China) according to the manufacturer’s protocol.
[0037] 4. Transient transfection and lentivirus stable infection
[0038] Specific miR-17-5p mimics, miR-17-5p inhibitors and METTL14-specific siRNAs were synthesized by GenePharma (China). For plasmid construction, METTL14 was purchased from Vigenebio (China). Cells were transfected with Lipofectamine 3000 reagent (Invitrogen, USA) according to the manufacturer’s instructions. The above are shown in Supplementary Table S1.
[0039] To construct cell lines stably overexpressing miR-17-5p, full-length hsa-miR-17-5p (GeneChem, China) and empty control were cloned into lentiviral vector system (puro-miR-17-5p and puro-NC). Lentivirus was transfected into SW480 cells according to the manufacturer’s instructions. Puro-miR-17-5p and puro-NC cells were selected with puromycin (2 pg / ml; BioSharp, China). Cell lines stably overexpressing or knockdown METTL14 were constructed by cloning METTL14 (Obio, China) and shMETTL14 (Obio) into lentiviral vector system (neo-METTL14, neo-NC; neo-shMETTL14, neo-shNC). The sequence of shMETTL14 is the same as siMETTL14 shown in Table 1. After transfection of lentivirus, these cells were selected with G418 (800 pg / ml; BioSharp, China). To obtain miR-17-5p / METTL14 co-expressing cells, METTL14 lentivirus was infected into miR-17-5p overexpressing CRC cell lines and selected with G418 (800 pg / mL; BioSharp).
[0040] 5. Apoptosis assay
[0041] Cells were seeded in six-well plates at a concentration of 2 x 10 5 cells per well overnight and treated with 5-FU (25 mM; Selleck, USA) for 48 hours. Then, cells were harvested, washed, and stained with Annexin V-PE / 7-AAD reagent according to the manufacturer’s protocol (KeyGen, China). Apoptosis was detected by flow cytometry (BD, USA).
[0042] 6. IC50 determination
[0043] Cells were seeded in 96-well plates at a concentration of 5000 cells per well overnight and treated with different concentrations of 5-FU for 48 hours. The medium in each well was replaced with a mixture containing 10 pL CCK8 (Meilunbio, China) and 90 pL of culture medium. Two hours later, the absorbance was measured using an enzyme label meter (Molecular Devices, USA) at an OD value of 450 nm. GraphPad Prism 8 (GraphPad Software, USA) was used to calculate the half-maximal inhibitory concentration (IC50).
[0044] 7. EdU proliferation assay
[0045] Cells were seeded in 96-well plates at a concentration of 8000 cells per well, incubated overnight and treated with 5-FU (25 pM) for 48 hours. EdU staining was performed according to the manufacturer's instructions of the EdU kit (Ribobio, China).
[0046] 8. RNA stability
[0047] Cells were seeded in 12-well plates at a concentration of 2 x 10 5 cells per well, incubated overnight and treated with actinomycin D (ActD; 5 pg / mL, Selleck). Cells were harvested after the indicated time (0, 15, 30, 60 and 120 minutes) of treatment and RNA was isolated from these cells for qRT-PCR analysis.
[0048] 9. Measurement of mitochondrial DNA (mtDNA) copy number
[0049] Total genomic DNA was extracted using a DNA extraction kit (Accurate Biotechnology, China). Then 100 ng of DNA and forward and reverse primers for mitochondrial encoded cytochrome c oxidase-2 (MT-C02) (10 pM for each primer) were added to the reaction with TB Green Premix Ex Taq II (Takara). The relative gene expression level was calculated by using the 2- AACt method. GAPDH was used as an endogenous control gene to calculate the AACt value for each sample. The primers are shown in Table 2.
[0050] Table 1 Sequences of miRNA mimics, inhibitors and siRNAs
[0051] sense (5'-3') antisense (5'-3') has-miR-17-5p mimics CAAAGUGCUUACAGUGCAGGUAG ACCUGCACUGUAAGCACUUUGUU mic-NC UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT has-miR-17-5p inhibitor CUACCUGCACUGUAAGCACUUUG / i-NC CAGUACUUUUGUGUAGUACAA / si-METTL14 CAGCAUUGGUGCCGUGUUATT UAACACGGCACCAAUGCUGTT si-YTHDC2 GCUUAAGACAAUAGAUGCATT UGCAUCUAUUGUCUUAAGCTT si-NC UUCUCCGAACGUGUCACGTT ACGUGACACGUUCGGAGAATT
[0052] Table 2 Primers for RT-PCR
[0053] Forward Primer Reverse Primer GAPDH GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA METTL14 GTTGGAACATGGATAGCCGC CAATGCTGTCGGCACTTTCA pri-miR-17 TGCTTACAGTGCAGGTAGTGATA CAAAAAGCACTCAACATCAGCAGG pre-miR-17 GCAGGAAAAAAGAGAACATCACC TGGCTTCCCGAGGCAG miR-17-5p GCGCAAAGTGCTTACAGTGC AGTGCAGGGTCCGAGGTATT U6 AGAGAAGATTAGCATGGCCCCTGC ATCCAGTGCAGGGTCCGAGG YTHDF1 TCCGATTCCATACCTCACCACCTAC AACCTGTGCTGATAGATGTTGTTCCC YTHDC1 GCAAGCAGATCCAGCCAGTCTTC TCTTCCACTCCTTCCTCCTCATTCTC YTHDF2 TAACAAGAGACTGGATGCTGCTTATCG GATTTCATTTCTGCCACGCCACAG YTHDF3 AGCAGCAGTGGTATGACTAGCATTG GGGTTTAAGTTTCGGTTGAGGTTTGG YTHDC2 GAGGCCTTTCTGGTGACCTC TTGTTGAGTCGCCCACTTGT MT-ND1 AACATACCCATGGCCAACCT AGCGAAGGGTTGTAGTAGCCC MT-CO2 CAAACCTACGCCAAAATCCA GAAATGAATGAGCCTACAGA
[0054] II. Experimental Conclusions
[0055] (1) miR-17-5p is highly expressed in colorectal cancer, reducing apoptosis of colorectal cancer cells and increasing chemotherapy resistance.
[0056] Previous studies have reported that miR-17-5p plays an oncogenic role in promoting CRC proliferation and metastasis, but how it affects chemotherapy response remains unclear. In this study, RNA sequencing (RNA-seq) was performed on HCT116 cells overexpressing miR-17-5p (NCBI Gene ID: 406952). The results showed that 385 genes were upregulated and 169 genes were downregulated. Figure 1 (Figure A). Among the top 20 enriched pathways revealed by RNA-seq results, cell growth and death, as well as antitumor drug resistance, were significantly enriched pathways, suggesting that miR-17-5p plays a crucial role in chemotherapy resistance. Figure 1 Figure B). The expression level of miR-17-5p in commonly used colorectal cancer cell lines is significantly higher than that in normal intestinal epithelial cell lines (Figure B). Figure 1 (Figure C in the middle)
[0057] RT-PCR analysis from clinical samples confirmed that miR-17-5p was overexpressed in 43 individuals with CRC compared to adjacent normal mucosal tissue. Figure 1 (Figure D in the original text). To evaluate the biological function of miR-17-5p in CRC cell lines, this example uses miR-17-5p mimics (miR-17-5p) and inhibitors to perform in vitro analysis on HCT116 cells. Overexpression and knockdown efficiencies are shown in Figure D. Figure 1 As shown in Figure E.
[0058] To further determine whether miR-17-5p affects CRC cell apoptosis, flow cytometry was used to study cell apoptosis. The results showed that 5-FU-induced miR-17-5p overexpression reduced the apoptosis rate of HCT116 cells, while knockdown of miR-17-5p increased HCT116 cell apoptosis. Figure 1 (Figure F in the middle)
[0059] The IC50 values of 5-FU against the parental cell line HCT-116 and cell lines transfected with mimics or inhibitors were determined using the CCK-8 assay. Overexpression of miR-17-5p significantly upregulated the IC50 value of 5-FU, from 21.22 μM to 26.37 μM; while knockdown of miR-17-5p decreased the IC50 value to 9.24 μM. Figure 1 (China G map).
[0060] EdU proliferation assay on HCT116 cells treated with 5-FU showed that overexpression of miR-17-5p promoted tumor proliferation, while knockdown inhibited its proliferation (Fig. 5A). Figure 1 Fig. 5B.
[0061] The colorectal cancer cell line SW480 stably overexpressing miR-17-5p and its control cells were inoculated subcutaneously into nude mice at a concentration of 5 x 10 6 / 100 μL, and 5-FU was injected intraperitoneally 72 hr after inoculation (5 mg / kg, 2 times / week, Figure 1 Fig. 5C). The results showed that the tumors overexpressing miR-17-5p grew faster and were larger in volume (Fig. 5D, E, F). Figure 1 Fig. 5G, H, I). In addition, immunohistochemistry showed that the proportion of Caspase7-positive staining cells in the overexpression group was lower than that in the NC group (Fig. 5J). Figure 1 Fig. 5K, L). Western blot results showed that compared with the control group, overexpression of miR-17-5p upregulated BCL-2 and downregulated the expression levels of cleaved-Caspase7 and BAX proteins (Fig. 5M). Figure 1 Fig. 5N).
[0062] These results showed that miR-17-5p enhanced CRC tumor growth both in vivo and in vitro, indicating that miR-17-5p reduced CRC apoptosis and promoted 5-FU resistance. Conversely, when miR-17-5p was lowly expressed, colorectal cancer cells were more sensitive to 5-FU. Therefore, it was proved at the cellular level that when miR-17-5p was lowly expressed, colorectal cancer cells were more sensitive to 5-FU. Therefore, it can be further prepared by preparing a reagent or kit to detect whether miR-17-5p is relatively overexpressed or lowly expressed in colorectal cancer patients, to judge the drug resistance, chemotherapy resistance or sensitivity of the patients to 5-FU chemotherapy.
[0063] (2) miR-17-5p regulates mitochondrial dynamics by targeting MFN2
[0064] To further understand the mechanism of miR-17-5p regulating 5-FU chemotherapy resistance of CRC, the potential target of miR-17-5p was searched using TargetScan, miRDB, miRWalk and StarBase online databases, and the target was intersected with the RNA-seq results. Among all the identified genes, 44 were predicted as target genes of miR-17-5p (Fig. 6A). Figure 2Gene set enrichment analysis (GSEA) was performed to evaluate the biological relevance of the identified target genes. It suggested that "mitochondrial protein inclusion complex" and "mitochondrial envelope" had important influence on the biological function of 5-FU resistance Figure 2 Interestingly, Mitofusin 2 (MFN2, NCIB Gene ID: 9927) was identified as one of the 44 target genes (Fig. 2B), and has been reported to play a key role in mitochondrial dynamics. Figure 2
[0065] The TCGA database was used to evaluate the MFN2 mRNA level in this example, and it was found that the expression of MFN2 in CRC tissues was significantly lower than that in normal epithelial tissues (Fig. 2A). Figure 2 GEPIA analysis showed that lower MFN2 level was associated with lower survival rate (Fig. 2C). Figure 2
[0066] To further determine the relationship between miR-17-5p and MFN2, the following experiments were performed in this example. Transmission electron microscopy observation of mitochondria and autophagosomes showed that the mitochondria in the miR-17-5p overexpression group were obviously fragmented compared with the control group, which indicated that miR-17-5p increased fission and reduced mitochondrial fusion (Fig. 2E). Figure 2
[0067] Similarly, MitoTracker staining showed that the mitochondria in the miR-17-5p overexpression group were fragmented and granular in shape, suggesting that miR-17-5p induced mitochondrial fission and inhibited mitochondrial fusion (Fig. 2F). Figure 2
[0068] The detection results of mtDNA copy number showed that miR-17-5p increased mitochondrial fission, while i-miR-17-5p had the opposite effect (Fig. 2G). Figure 2
[0069] JC-1 staining was used in this example to show the mitochondrial membrane potential; monomeric JC-1 emits green fluorescence, while the polymer emits red fluorescence; an increase in green fluorescence indicates a decrease in mitochondrial membrane potential, which is a marker of early apoptosis of cells. When this example used 5-FU to stimulate HCT116 cells, miR-17-5p overexpression could inhibit the formation of JC-1 monomers. However, the Dynamin-Related Protein 1 (DRP1) inhibitor Mdivi-1 attenuated this inhibitory effect (Fig. 2H). Figure 2
[0070] These results indicate that miR-17-5p reduces 5-FU-induced apoptosis of CRC cells in a mitochondria fission-dependent manner. Next, this example observed the increase of mitophagic autophagosomes (yellow) under confocal microscopy using red (MitoTracker Red) and green fluorescent probes (LysoTracker Green) to show mitochondria and lysosomes, respectively, but Mdivi-1 attenuated the effect of enhanced mitophagy Figure 2 When detecting apoptosis by flow cytometry, it was found that miR-17-5p significantly inhibited apoptosis of HCT116 cells, while Mdivi-1 reversed its anti-apoptotic effect Figure 2
[0071] WB results showed that miR-17-5p overexpression caused MFN2 downregulation, while knockdown was the opposite. In addition, the level of mitochondrial protein LC3B was significantly increased, while the level of p62 was significantly decreased in the miR-17-5p group, indicating that the formation of mitophagic bodies was accelerated (an event in the process of mitophagy). In addition, the mitochondrial fission protein (FIS1) was also elevated in the miR-17-5p group Figure 2
[0072] According to the miR-17-5p binding site in MFN2 identified by TargetScan, this example established MFN2-WT and MFN2-MUT luciferase reporter plasmids Figure 2 Figure 2
[0073] In addition, compared with the control group, miR-17-5p significantly downregulated the expression of pro-apoptotic proteins BAX and cleaved caspase7, and upregulated the expression of anti-apoptotic protein BCL-2 and autophagy biomarker LC3B.
[0074] Mdivi-1 combined with miR-17-5p can reduce the expression of DRP1 and enhance the expression of MFN2 Figure 3
[0075] The recovery experiment of co-expression of miR-17-5p and MFN2 Figure 4 showed that MFN2 can reverse the reduction of cell apoptosis caused by miR-17-5p, and the decrease in the expression of apoptosis-related proteins PARP, cleaved-PARP, BAX, Caspase7, cleaved-Caspase7.
[0076] These results show that mir-17-5p-dependent CRC 5-Fu chemotherapy resistance is mediated by controlling mitochondrial homeostasis. When MFN2 is overexpressed, colorectal cancer is more sensitive to 5-FU. Therefore, it can be further detected by reagents or kits whether MFN2 is relatively overexpressed or lowly expressed in colorectal cancer patients, to determine the drug resistance, chemotherapy resistance or sensitivity of the patients to 5-FU chemotherapy.
[0077] (3) Knocking down METTL14 can enhance the chemotherapy resistance of colorectal cancer
[0078] m6A modification has been reported in many cancer studies, and methyltransferase 14 (METTL14, NCBI Gene ID: 57721) is one of the most important regulatory proteins. According to the TCGA database and GSE41657, METTL4 is lowly expressed in adenomas, and is further reduced in colorectal cancer, which is synchronized with the progression of colorectal cancer( Figure 4 FIG. 2A). Similarly, RT-PCR analysis confirmed that METTL14 was expressed at a lower level in 43 human CRC tissues compared with adjacent normal mucosa tissues( Figure 4 FIG. 2B). In addition, GEPIA showed that lower METTL14 expression was associated with shorter overall survival and disease-free survival( Figure 5 FIG. 2C).
[0079] To study the effect of METTL14 expression level on CRC cells, the present embodiment used specific si-RNA to successfully knock down the expression of METTL14 in HCT116 cells, or used a plasmid carrying METTL14 to overexpress METTL14( Figure 5 FIG. 3A). The results showed that overexpression of METTL4 can significantly reduce the IC50 value of 5-FU in HCT116 cells (28.18 μM vs. 21.83 μM), while knocking out METTL4 can increase the IC50 value of 5-FU (24.31 μM vs. 35.81 μM) Figure 5 FIG. 3B).
[0080] Next, the present embodiment verified the effect of METTL14 overexpression or knockdown on the proliferation of HCT116 cells by EdU staining. The EdU results showed that overexpression of METTL14 significantly reduced the proliferation of HCT116 cells( Figure 5 FIG. 3C).
[0081] In addition, under the induction of 5-FU, METTL14 can increase the apoptosis rate of HCT116 cells, while knocking down METTL14 can significantly inhibit the apoptosis rate of cells Figure 5 FIG. 3D).
[0082] Western blot results showed that knocking down METTL14 inhibited the expression of apoptosis-related proteins BAX and cleaved-Caspase 7, while increasing the expression of anti-apoptosis-related protein BCL2. Figure 5 (China E diagram).
[0083] Next, in this embodiment, a stable transfected cell line with METTL14 knockdown was constructed using lentivirus ( Figure 5 (Figure F) Subcutaneous tumor formation and 5-FU sensitivity experiments were performed in nude mice. The results showed that, compared to the control group, METTL14 knockdown SW480 cells exhibited larger or faster tumor weight and growth curves. Figure 5 (G diagram, H diagram, I diagram).
[0084] Furthermore, immunohistochemical results showed that METTL14 gene knockdown led to a significant reduction in Caspase7 staining in xenograft tumors. Figure 6 (J figure).
[0085] In summary, these results indicate that METTL14 plays a crucial role in promoting CRC5-FU chemotherapy resistance; METTL14 overexpression is associated with better sensitivity to 5-FU in colorectal cancer. Therefore, further assays or kits can be used to detect relative overexpression or low expression of METTL14 in colorectal cancer patients to assess their resistance, chemotherapeutic efficacy, or sensitivity to 5-FU chemotherapy.
[0086] (4) METTL14 inhibits miR-17-5p expression through m6A modification.
[0087] Mounting evidence suggests that m6A plays a crucial role in the development and maturation of miRNAs. METTL14 knockout in HCT116 cells results in decreased m6A levels, while overexpression of METTL14 in HCT116 cells leads to higher m6A levels. Figure 5 (Figure A). To investigate the role of METTL14 in miR-17 maturation, this example established cells with METTL14 knockdown and overexpression (Figure A). Figure 6 (Figure A). The results showed that METTL14 inhibited the expression of miR-17-5p, pre-miR-17, and pri-miR-17, while knocking out METTL14 reversed these effects. Figure 6 (Figure B in the middle)
[0088] Next, in this embodiment, m6Amotif was searched in pri-miR-17. Bioinformatics analysis results supported the existence of a high-scoring m6A modification site on pri-miR-17, with the sequence being GGACC ( Figure 6Figure 3C shows the results of MeRIP. Figure 3D shows the results of qRT-PCR. Figure 6 Figure 3E shows the results of qRT-PCR.
[0089] To explore the mechanism of METTL14 affecting the content of miR-17, actinomycin D (ActD) was used to inhibit gene transcription, and the effect of METTL14 on the stability of pri-miR-17 was verified. It was found that METTL14 overexpression reduced the expression of pri-miR-17, showing poorer mRNA stability; and knockdown was on the contrary. Figure 7
[0090] In summary, these data show that METTL14-mediated m6A modification on pri-miR-17 mRNA can regulate the expression of pri-miR-17 in CRC cells, further revealing the internal mechanism of METTL14 overexpression to improve the 5-FU sensitivity of colorectal cancer.
[0091] (5) Knockdown of METTL14 can enhance the stability of pri-mir-17 mRNA through an m6A-YTHDC2-dependent pathway
[0092] m6A modification is the main mechanism of pri-miRNA maturation, decay, stability and transfer to the cytoplasm. Expression analysis showed that, compared with the negative control, after METTL14 knockdown, only YTHDC2 and YTHDF3 expression was down-regulated in HCT116 cells. Figure 7 Figure 3A shows the results of qRT-PCR.
[0093] WB experiments showed that METTL14 can also regulate the expression of YTHDC2 at the protein level. Figure 7 Figure 3B shows the results of WB. Compared with transfection of YTHDC2 alone, after co-transfection of si-METTL14 and YTHDC2, the protein level of YTHDC2 was reduced Figure 7 Figure 3C shows the results of qRT-PCR. Compared with transfection of YTHDC2 alone, after co-transfection of si-METTL14 and YTHDC2, the expression levels of pri-miR-17 and miR-17-5p were increased Figure 7 Figure 3D shows the results of qRT-PCR.
[0094] Next, this embodiment discusses whether YTHDC2 affects the stability of pri-miR-17. After si-METTL14 and YTHDC2 were co-transfected into HCT116 cells under the induction of ActD, the mRNA level of pri-miR-17 was significantly increased, and this effect was time-dependent. Figure 7 Figure 3D shows the results of qRT-PCR.
[0095] In addition, the present embodiment constructs a mutant sequence of the m6A binding site in pri-miR-17 for subsequent luciferase reporter detection, which cannot bind m6A modification Figure 7 Figure 2E). The results show that the YTHDC2 plasmid significantly reduces the luciferase activity of HCT116 cells transfected with wild-type pri-miR-17 sequence, while the luciferase activity of HCT116 cells transfected with pri-miR-17 mutant does not change significantly (Figure 2F). These results indicate that YTHDC2 can interact with pri-miR-17 transcripts, reducing the stability of m6A-modified pri-miR-17 mRNA. Figure 8
[0096] In summary, these results show that m6A "writer" METTL14 increases the level of m6A modification of pri-miR-17, which is then recognized by m6A "reader" YTHDC2, thereby affecting the stability of pri-miR-17. However, whether other molecules are involved in this process remains to be further studied.
[0097] (6) METTL14 deletion significantly enhances 5-FU resistance through the miR-17-5p / MFN2 axis
[0098] To verify the effect of METTL14 on the expression of miR-17-5p in vivo, the present embodiment detected the expression of METTL14 and miR-17-5p in 30 CRC tissues using RT-PCR.
[0099] Spearman correlation analysis showed that the levels of METTL14 and miR-17-5p were negatively correlated (Figure 3A). Figure 8
[0100] RT-PCR analysis of commonly used colorectal cancer cell lines and normal intestinal epithelial cell lines also showed high expression of miR-17-5p and low expression of METTL14 and MFN2 (Figure 3B). Figure 8
[0101] Compared with the increase in IC50 value and inhibition of apoptosis rate caused by knocking down METTL14, miR-17-5p knockdown significantly rescued the IC50 value and apoptosis rate of HCT116 cells under 5-FU stimulation (Figure 3C). Figure 8
[0102] Correspondingly, overexpression of METTL4 increased the apoptosis level, while overexpression of miR-17-5p inhibited this increase (Figure 3D). Figure 8
[0103] In addition, WB results showed that overexpression or knockdown of METTL14 led to changes in the expression of mitochondrial motor proteins MFN2 and FIS1, as well as apoptosis-related proteins Caspase7, cleaved Caspase7, BAX, BCL2, and autophagy-related proteins LC3B and p62, while co-transfection of miR-17-5p / i-miR-17-5p could offset the effects of METTL14 Figure 8 Fig. 2E).
[0104] In the nude mouse subcutaneous tumor in vivo experiment, the present embodiment constructed a miR-17-5p / METTL14 co-transfected stable cell line (Fig. 2F). The results showed that during the application of 5-FU, the tumor volume of the miR-17-5p group was larger, while the transfection of METTL14 was on the contrary, which had an inhibitory effect on the tumor mass and weight (Fig. 2G, H, I). About 2 weeks later, the tumor growth of the METTL14 / miR-17-5p group was significantly slower than that of the NC / miR-17-5p group (Fig. 2J). Figure 8 Figure 8 Figure 8
[0105] In addition, immunohistochemical analysis of the expression levels of Caspase7 and MFN2 in xenografts found that the levels of Caspase7 and MFN2 in the miR-17-5p group were lower than those in the negative control group; however, overexpression of METTL14 could eliminate these effects (Fig. 2K). In summary, these results revealed that the metl14 / miR-17-5p / MFN2 axis might play an oncogenic role in 5-FU resistance of CRC. Figure 9
[0106] Therefore, in CRC, METTL14 is down-regulated and reduces the level of m6A modification, which in turn reduces the recognition and binding of YTHDC2 to pri-miR-17, increases the stability of pri-miR-17 mRNA, and promotes the expression of miR-17-5p. Overexpression of miR-17-5p inhibits MFN2, leading to reduced mitochondrial fusion, enhanced mitochondrial fission and mitochondrial autophagy, and ultimately induces 5-FU chemotherapy drug resistance in CRC.
[0107] In summary, overexpression of METTL14 reduces the expression of miR-17-5p, and low expression of miR-17-5p promotes overexpression of MFN2, forming a METTL14 / miR-17-5p / MFN2 axis, which in turn makes colorectal cancer more sensitive to 5-FU chemotherapy.
[0108] The above embodiments of the present application are not intended to limit the scope of the present application, and the embodiments of the present application are not limited thereto. Any other modifications, replacements, or changes to the method of the present application made according to the above content of the present application, in accordance with ordinary technical knowledge and common means in the art, without departing from the above basic technical idea of the present application, shall fall within the scope of protection of the present application.
Claims
1. The use of reagents for detecting the expression levels of METTL14, miR-17-5p and MFN2 in the preparation of a detection kit for judging the 5-FU drug resistance of a colon cancer patient, METTL14 overexpression, colorectal cancer patients have better sensitivity to 5-FU; miR-17-5p low expression, colorectal cancer patients have better sensitivity to 5-FU; MFN2 overexpression, colorectal cancer patients have better sensitivity to 5-FU.
2. Use according to claim 1, characterized in that: Overexpression of METTL14 reduces the expression of miR-17-5p, low expression of miR-17-5p promotes overexpression of MFN2, forms the METTL14 / miR-17-5p / MFN2 axis, and further makes the colorectal cancer patients more sensitive to 5-FU chemotherapy.
Citation Information
Patent Citations
Analysis / diagnosis method utilizing RNA modification
CN112004942A
Kit for evaluating 5-FU treatment sensitivity / drug resistance
CN114592059A