A primer-probe combination and detection method for detecting bladder cancer-related genes

Abstract

The present invention relates to the field of molecular biological detection, and particularly to a primer-probe combination and a detection method for detecting bladder cancer-related genes. The method comprises collecting a urine specimen, washing to obtain urine exfoliated cells, extracting Twist1-ONECUT2-VIM-GDF15-TMEFF2 oncogene fragments, subjecting the extracted Twist1-ONECUT2-VIM-GDF15-TMEFF2 oncogene fragments to sulfite conversion, designing a reaction system as claimed in claim 3, utilizing the reaction system to amplify the sulfite-converted Twist1-ONECUT2-VIM-GDF15-TMEFF2 oncogene fragments, comparing and analyzing the CT value after gene amplification with a critical value, and determining a positive result when the CT value is less than or equal to the critical value. The method achieves non-invasive sampling through gene methylation detection of urine exfoliated cells, increases the compliance of test subjects in accepting the test, reduces unnecessary invasive examinations, and thus has a positive impact on clinical diagnosis and treatment decisions for bladder cancer, thereby having clinical promotion value.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biological analysis and detection, and in particular to a primer-probe combination and a detection method for detecting bladder cancer-related genes. Background Art

[0002] Bladder cancer is one of the most common malignant tumors of the urinary system, ranking first among urinary tract tumors. According to the latest national cancer statistics released by the National Cancer Center in February 2022, the incidence rate of bladder cancer in my country in 2016 was 5.95 per 100,000, and the mortality rate was 2.44 per 100,000. With economic development, the incidence and recurrence rates have been increasing annually. Prompt diagnosis of early-stage bladder cancer increases the chances of bladder preservation surgery, improving quality of life and overall survival. The postoperative recurrence rate for bladder cancer is 60% to 70%. Therefore, patients typically undergo 3-4 cystoscopies annually to monitor for recurrence. Cystoscopy requires insertion through the urethra into the bladder for a series of examinations. Improper handling during the examination can damage the urethral mucosa or bladder mucosa, leading to local bleeding and infection. Severe cases can also lead to complications such as bladder perforation, cystitis, and urinary tract inflammation. Therefore, new diagnostic methods are needed to assess bladder cancer and avoid the harmful effects of repeated cystoscopies. Summary of the Invention

[0003] In view of the above-mentioned deficiencies in the prior art, the present invention aims to provide a primer-probe combination and a detection method for detecting bladder cancer-related genes, so as to solve the human body damage caused by the prior art cystoscopic examination.

[0004] In order to solve the above problems, the present invention adopts the following technical solutions:

[0005] DNA methylation, the most common epigenetic modification in tumors, holds great promise for molecular tumor diagnosis. Detection of specific DNA methylation sites in urine using PCR has been reported to be significantly more sensitive than urine cytology and FISH for low-grade and non-muscle-invasive bladder cancer, demonstrating excellent diagnostic results and promising clinical translation. This method offers significant advantages in diagnosing early-stage, small, residual, and recurrent tumors, and is expected to be used for early diagnosis and recurrence monitoring of bladder cancer, reducing the need for invasive cystoscopy and providing a scientific basis for secondary transurethral resection.

[0006] By identifying a combination of bladder cancer-specific DNA methylation biomarkers and conducting tests based on multiple DNA methylation sites, the problem of low single DNA methylation signals can be overcome, improving both sensitivity and specificity. Furthermore, DNA methylation-based tests are simple to perform and objective in interpretation, avoiding the subjectivity of human interpretation and improving accuracy. Furthermore, the test is non-invasive, avoiding complications associated with cystoscopy and improving patient compliance.

[0007] First, the present invention provides a primer-probe combination for detecting bladder cancer-related genes, the primer-probe combination comprising:

[0008] Twist1-F: GCGGGAGTTCGTAGTTTTAC,

[0009] Twist1-R: AAAAATAATCTTCCGCAACG,

[0010] Twist1-P:FAM-AGTTGTAGACGTAGCGG-MGB;

[0011] Vimentin-F:GGGAGGTTTACGTATGGC,

[0012] Vimentin-R:CGCCTTACTATATACGATCGAA,

[0013] Vimentin-P: JOE-TAAAGGTTTGTAGAAGTTTT-MGB;

[0014] ONECUT2-F:ATAGAAGACGTCGGCGTC,

[0015] ONECUT2-R:GAACTACGAACGAACTCGC,

[0016] ONECUT2-P:FAM-CGAAATAAAAACGAACG-MGB;

[0017] GDF15-F:TTTGTTTTTGGTCGAGGC,

[0018] GDF15-R: CGATATTCGAATCTTCCCAA,

[0019] GDF15-P: JOE-CTAATTAACCCGCAACC-MGB;

[0020] TMEFF2-F:TTTTGTGTTTTCGGAAGTC,

[0021] TMEFF2-R:GAACTTCACCGAACGAACTA,

[0022] TMEFF2-P: Texas Red-CGAACAACAACAACAACC-MGB.

[0023] Furthermore, it also includes a primer probe for detecting an internal reference gene; the primer probe for detecting an internal reference gene includes:

[0024] ACTB-F: GCAAGCAGGAGTATGACG,

[0025] ACTB-R: AAGGGGTTAACGCAACTAA,

[0026] ACTB-P: CY5-TCCCCCATCTCCGAA-MGB.

[0027] Secondly, the present invention provides a reaction system for detecting bladder cancer-related genes, including a Twist1-Vimentin gene reaction system and a ONECUT2-GDF15-TMEEF2 gene reaction system; the Twist1-Vimentin gene reaction system includes a primer probe combination for detecting Twist1 and Vimentin genes, a PCR reaction solution and a DNA template; the ONECUT2-GDF15-TMEEF2 gene reaction system includes a primer probe combination for detecting ONECUT2-GDF15-TMEEF2 gene, a PCR reaction solution and a DNA template.

[0028] Furthermore, the Twist1-Vimentin gene reaction system and the ONECUT2-GDF15-TMEEF2 gene reaction system also include primer probes for detecting internal reference genes; the primer probes for detecting internal reference genes include:

[0029] ACTB-F: GCAAGCAGGAGTATGACG,

[0030] ACTB-R: AAGGGGTTAACGCAACTAA,

[0031] ACTB-P: CY5-TCCCCCATCTCCGAA-MGB.

[0032] Third, the present invention provides a method for detecting methylation of the Twist1-ONECUT2-VIM-GDF15-TMEFF2 gene, comprising:

[0033] Urine specimens were collected and washed to obtain urine exfoliated cells, and the Twist1-ONECUT2-VIM-GDF15-TM EFF2 oncogene fragment was extracted;

[0034] The extracted Twist1-ONECUT2-VIM-GDF15-TMEFF2 oncogene fragment is subjected to sulfite conversion, and a reaction system as described in claim 3 is designed, and the Twist1-ONECUT2-VIM-GDF15-TMEFF2 oncogene fragment after sulfite conversion is amplified using the reaction system;

[0035] The CT value after gene amplification was compared with the critical value. When the CT value was less than or equal to the critical value, it was positive, indicating that the collected urine exfoliated cells contained at least one of the methylated Twist1 gene, ONECUT2 gene, VIM gene, GDF15, and TMEFF2 gene.

[0036] Furthermore, the positive result when the CT value is less than or equal to the critical value includes:

[0037] The Ct value of the Twist1 gene was ≤35 and there was an "S" amplification curve, indicating that the test result was positive and the Twist1 gene was methylated;

[0038] The Ct value of ONECUT2 gene was ≤32 and there was an "S" amplification curve, indicating that the test result was positive and ONECUT2 gene was methylated;

[0039] The Ct value of the VIM gene was ≤35 and there was an "S" amplification curve, indicating that the test result was positive and the VIM gene was methylated;

[0040] The Ct value of the GDF15 gene was ≤32 and there was an "S" amplification curve, indicating that the test result was positive and the GDF15 gene was methylated;

[0041] The Ct value of the TMEFF2 gene was ≤35 and there was an "S" amplification curve, indicating that the test result was positive and the TMEFF2 gene was methylated.

[0042] Furthermore, the conditions for gene amplification are: 95°C, 300 seconds; 95°C, 5 seconds, 55°C, 35 seconds, 35 cycles.

[0043] Fourthly, the present invention provides a bladder cancer assessment system, comprising:

[0044] Gene fragment extraction module, used to collect urine specimens, wash and obtain urine exfoliated cells, and extract Twist1-ONECUT2-VIM-GDF15-TMEFF2 oncogene fragments;

[0045] A gene amplification module for performing sulfite conversion on the extracted Twist1-ONECUT2-VIM-GDF15-TMEFF2 oncogene fragment, designing a reaction system as described in claim 3, and using the reaction system to perform gene amplification on the Twist1-ONECUT2-VIM-GDF15-TMEFF2 oncogene fragment after sulfite conversion;

[0046] The analysis module is used to compare and analyze the CT value after gene amplification with the critical value. When the CT value is less than or equal to the critical value, it is positive, indicating that the collected urine exfoliated cells contain at least one of the methylated Twist1 gene, ONECUT2 gene, VIM gene, GDF15, and TMEFF2 gene.

[0047] Furthermore, the positive result when the CT value is less than or equal to the critical value includes:

[0048] The Ct value of the Twist1 gene was ≤35 and there was an "S" amplification curve, indicating that the test result was positive and the Twist1 gene was methylated;

[0049] The Ct value of ONECUT2 gene was ≤32 and there was an "S" amplification curve, indicating that the test result was positive and ONECUT2 gene was methylated;

[0050] The Ct value of the VIM gene was ≤35 and there was an "S" amplification curve, indicating that the test result was positive and the VIM gene was methylated;

[0051] The Ct value of the GDF15 gene was ≤32 and there was an "S" amplification curve, indicating that the test result was positive and the GDF15 gene was methylated;

[0052] The Ct value of the TMEFF2 gene was ≤35 and there was an "S" amplification curve, indicating that the test result was positive and the TMEFF2 gene was methylated.

[0053] Fifthly, the present invention provides the use of the primer-probe combination for detecting bladder cancer-related genes or the reaction system for detecting bladder cancer-related genes in the preparation of a Twist1-ONECUT2-VIM-GDF15-TMEFF2 gene methylation detection reagent.

[0054] The beneficial effects of the present invention are:

[0055] This kit is suitable for the qualitative detection of methylation of the Twist1-ONECUT2-VIM-GDF15-TMEFF2 gene in human urine. Abnormal DNA methylation is one of the hallmark events in the development and progression of tumors. In patients with bladder cancer, the detection of bladder cancer-specific DNA methylation sites in urine using PCR technology has shown significantly better sensitivity than urine cytology and FISH for low-grade and non-muscle invasive bladder cancer, demonstrating good diagnostic results and promising clinical translation. It has significant advantages in the diagnosis of early-stage, small, residual, and recurrent tumors, and is expected to be used for the early diagnosis of bladder cancer and recurrence monitoring, providing a scientific basis for reducing invasive cystoscopy and secondary electrosurgical resection.

[0056] Through the detection of gene methylation in urine exfoliated cells, non-invasive sampling is achieved, the compliance of the subjects in accepting the test is increased, and unnecessary invasive examinations are reduced, thereby having a positive impact on the clinical diagnosis and treatment decisions of bladder cancer and having a high clinical promotion value.

[0057] This kit is based on the principle of fluorescent PCR, combining Taqman fluorescent probes and specific primer amplification technology. It uses fluorescent PCR to detect methylation sequences of the Twist1, ONECUT2, VIM, GDF15, and TMEFF2 genes in a fully closed amplification system. Specific primers and probes are designed for the conserved region of the human ACTB gene as internal references to monitor sample collection, DNA extraction, and amplification.

[0058] The kit uses multiplex PCR amplification to measure sulfite-converted DNA, thereby detecting methylated DNA fragments of the Twist1, ONECUT2, VIM, GDF15, and TMEFF2 genes. The purified DNA solution undergoes a chemical reaction with sulfite to convert unmethylated cytosines, which are then deaminated to produce uracil sulfonates. However, methylated cytosines are not converted by sulfite. The internal control, ACTB, is used to assess the adequacy of DNA quantity for the assay. The FAM channel indicates Twist1 and ONECUT2, the VIC channel indicates BMP3, THBD, and MLH1, and the JOE channel indicates ACTB. Methylation positive and negative controls are provided in the kit, and both positive and negative controls are tested in every assay. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Figure 1 This is a graph showing the methylation amplification curve of the Twist1 gene in an embodiment of the present invention.

[0060] Figure 2 This is a graph showing the methylation amplification curve of the ONECUT2 gene in an embodiment of the present invention.

[0061] Figure 3 This is a graph showing the methylation amplification of the VIM gene in an embodiment of the present invention.

[0062] Figure 4 This is a graph showing the methylation amplification curve of the GDF15 gene in an embodiment of the present invention.

[0063] Figure 5 This is a graph showing the methylation amplification curve of the TMEFF2 gene in an embodiment of the present invention.

[0064] Figure 6 This is an amplification curve diagram of Twist1 and VIM gene methylation detection in urine samples of normal physical examination population in an embodiment of the present invention.

[0065] Figure 7 This is an amplification curve diagram of ONECUT2, GDF15, and TMEFF2 gene methylation detection in urine samples of normal physical examination population in an embodiment of the present invention. DETAILED DESCRIPTION

[0066] The present invention will be further described in detail below with reference to specific embodiments.

[0067] It should be noted that these embodiments are only used to illustrate the present invention, rather than to limit the present invention. Simple improvements to the method based on the concept of the present invention fall within the scope of protection claimed by the present invention.

[0068] Example 1

[0069] 1. Main ingredients

[0070]

[0071] Note: Reagents from different batches cannot be mixed.

[0072] 2. Specific primer and probe sequences.

[0073]

[0074]

[0075] 3. Applicable instruments

[0076] ABI 7500 Fluorescence PCR Instrument

[0077] 4. Sample requirements

[0078] 1. Sample type: urine sample.

[0079] 2. Sample collection:

[0080] 1) Pay attention to the cleanliness and dryness of the specimen container. If it is a culture specimen, it must be contained in a sterile container. For projects collecting 24-hour urine, an appropriate amount of preservative needs to be added.

[0081] 2) When collecting urine specimens, it is best to collect the midstream of the first urine in the morning. Because people drink less water and rest longer at night, morning urine can better reflect the body's true condition, such as specific gravity, pH value, protein content, etc.

[0082] 3) When collecting midstream urine, be sure to expel and discard the previous urine first, because the previous urine is easily contaminated by urethral and vaginal secretions, which can easily affect the accuracy of the test results.

[0083] 4) Before collecting urine samples, be sure to urinate on an empty stomach and do not drink water. Drinking water will dilute the urine components and affect the accuracy of the test results.

[0084] 5) Collect 150-200 ml of urine sample, centrifuge within 2 hours, and wash to obtain urine exfoliated cells.

[0085] V. Inspection Methods

[0086] 1. Reagent Preparation

[0087] 1.1 Remove the PCR reaction solution from the kit, thaw it at room temperature, and after it is fully thawed, gently shake it to mix it and briefly centrifuge it for later use.

[0088] 1.2 Based on the number of samples to be tested (n), calculate the number of reactions required, and aliquot 20 μl of PCR reaction solution into each reaction.

[0089] 2. Sample Processing

[0090] 2.1 Sampling

[0091] Take out the urine sample from the refrigerator at 2-8℃.

[0092] 2.2 Nucleic acid extraction and sulfite conversion

[0093] Refer to our nucleic acid extraction or purification kits for urine nucleic acid extraction and nucleic acid sulfite conversion.

[0094] If the treated DNA cannot be used immediately, it can be stored at 2 to 8 degrees for 24 hours, or at -25 to -15 degrees for 72 hours.

[0095] 3. Add sample

[0096] Sample loading: Add the sample DNA to be tested to the PCR reaction tubes in which the reagents have been prepared. Add 30 μL of DNA to each PCR reaction, cap the tube tightly, and centrifuge briefly at low speed. Note: The sealed PCR plate can be placed at 2-8°C for up to 4 hours. Set the sample number according to the sample type. The 96-well sample loading layout of the PCR instrument is shown in the table below. In the table, PC stands for positive control, NC stands for negative control, NTC stands for no template control, and S stands for test sample.

[0097]

[0098] 4. PCR Amplification

[0099] 4.1 Sample setting: Set the sample number according to the sample type.

[0100] 4.2 Fluorescence channel selection: For Twist1 / Vimentin genes, select three channels for each sample: FAM, JOE, and CY5; for ONECUT2 / GDF15 / TMEEF2 genes, select four channels for each sample: FAM, JOE, Texas Red, and CY5; set the reference fluorescence (Passive Reference) to none.

[0101] 4.3 Reaction conditions (reaction volume set to 50 μL):

[0102]

[0103] 4.4 Save the file and run the program.

[0104] 5. Results Analysis

[0105] After the reaction is completed, the results are automatically saved and analyzed using the instrument software. The Start, End, and Threshold values ​​of the Baseline are adjusted according to the analyzed image (users can adjust the Start value between 2 and 8 and the End value between 10 and 20 based on actual conditions. The fluorescence threshold (Threshold) is set so that the threshold line just exceeds the highest point of the amplification curve (irregular noise line) of the negative quality control product, and the Ct value is displayed as undet). Click Analyze to automatically obtain the analysis results.

[0106] 6. Result determination

[0107] Interpret PCR reaction results according to Table 1. If the internal control ACTB indicates sufficient DNA was added to the individual (ACTB Ct values ​​are shown in Table 1), the results for Twist1, ONECUT2, VIM, GDF15, and TMEFF2 are considered the results of this PCR reaction. If the ACTB Ct value is greater than the threshold set in the table, the PCR reaction is defined as "invalid."

[0108] Table 1: Interpretation of individual PCR reaction results

[0109]

[0110]

[0111] V. Positive judgment value or reference interval The receiver operating characteristic curve provided in this embodiment is as follows Figure 3 As shown, it can be seen that the ROC curve is close to the upper left corner, indicating that the prediction result is highly accurate.

[0112] VI. Interpretation of Test Results

[0113] 1) If the Ct value of the internal reference gene is ≤30, the Ct value of the Twist1 gene is ≤35 and there is an "S" amplification curve, it indicates that the test result is positive and the Twist1 gene is methylated; if the Ct value of the ONECUT2 gene is ≤32 and there is an "S" amplification curve, it indicates that the test result is positive and the ONECUT2 gene is methylated; if the Ct value of the VIM gene is ≤35 and there is an "S" amplification curve, it indicates that the test result is positive and the VIM gene is methylated; if the Ct value of the GDF15 gene is ≤32 and there is an "S" amplification curve, it indicates that the test result is positive and the GDF15 gene is methylated; if the Ct value of the TMEFF2 gene is ≤35 and there is an "S" amplification curve, it indicates that the test result is positive and the TMEFF2 gene is methylated; if any one of these is positive, the test result is methylation positive;

[0114] 2) If the Ct value of the internal reference gene is greater than 30 or no amplification occurs, the experiment is invalid, indicating that the added DNA contains PCR inhibitors. The DNA needs to be re-extracted and tested after sulfite treatment.

[0115] 3) If the Ct value of the internal reference gene is ≤30, the Ct value of the Twist1 gene is >35 and there is no amplification curve, it indicates that the test result is negative and the Twist1 gene is not methylated; the Ct value of the ONECUT2 gene is >32 and there is no amplification curve, it indicates that the test result is negative and the ONECUT2 gene is not methylated; the Ct value of the VIM gene is >35 and there is no amplification curve, it indicates that the test result is negative and the VIM gene is not methylated; the Ct value of the GDF15 gene is >32 and there is no amplification curve, it indicates that the test result is negative and the GDF15 gene is not methylated; the Ct value of the TMEFF2 gene is >35 and there is no amplification curve, it indicates that the test result is negative and the TMEFF2 gene is not methylated;

[0116] 4) If the result is negative, the risk of bladder cancer is low and regular follow-up is recommended; if the result is positive, the risk of bladder cancer is high and microscopic examination or tissue biopsy is recommended for confirmation.

[0117] Example 2

[0118] The experimental samples of this program are tested with samples with known clinical information, as shown in the following table:

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127] The validation and evaluation results are shown in the table above. Urine samples from 37 bladder cancer patients and 44 non-bladder cancer patients (including other cancers, cystitis, and other benign diseases) were collected. Among the 29 bladder cancer patients, 35 tested positive for Twist1, ONECUT2, VIM, GDF15, and TMEFF2, with a sensitivity of 94.6%. Among the 44 non-bladder cancer patient samples, 4 tested positive (1 for urothelial carcinoma without recurrence, 1 for bladder cancer recurrence, 1 for right kidney stones, and 1 for prostate hyperplasia), with a specificity of 90.9%. All 20 normal physical examination samples tested negative, with a specificity of 100%.

[0128] The amplification curve of the methylation detection of the urine sample of the patient clinically diagnosed with bladder cancer provided in this embodiment is as follows: Figure 1-5 As shown, it can be seen that the Ct value of the internal reference gene is ≤30, the Ct value of the Twist1 gene is ≤35 and there is an "S" amplification curve, indicating that the test result is positive and the Twist1 gene is methylated; the Ct value of the ONECUT2 gene is ≤32 and there is an "S" amplification curve, indicating that the test result is positive and the ONECUT2 gene is methylated; the Ct value of the VIM gene is ≤35 and there is an "S" amplification curve, indicating that the test result is positive and the VIM gene is methylated; the Ct value of the GDF15 gene is ≤32 and there is an "S" amplification curve, indicating that the test result is positive and the GDF15 gene is methylated; the Ct value of the TMEFF2 gene is ≤35 and there is an "S" amplification curve, indicating that the test result is positive and the TMEFF2 gene is methylated; if any one of them is positive, the test result is methylation positive;

[0129] The amplification curves of the methylation detection of urine samples from clinically diagnosed normal physical examination population provided in this embodiment are as follows: Figure 6 As shown, it can be seen that the Ct value of the internal reference gene is ≤30, and there is no amplification of Twist1, ONECUT2, VIM, GDF15, and TMEFF2 genes, indicating that the test result is negative and the HIST1H4F gene is not methylated; the receiver operating characteristic curve provided in this example is shown in Figure 7 As shown, it can be seen that the ROC curve is close to the upper left corner, indicating that the prediction result is highly accurate.

[0130] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described with reference to the preferred embodiments of the present invention, it should be understood by those skilled in the art that various changes can be made in form and details without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A primer-probe combination for detecting bladder cancer-related genes, characterized in that: The primer-probe combination includes: Twist1-F: GCGGGAGTTCGTAGTTTTAC, Twist1-R: AAAAATAATCTTCCGCAACG, Twist1-P:FAM-AGTTGTAGACGTAGCGG-MGB; Vimentin-F:GGGAGGTTTACGTATGGC, Vimentin-R:CGCCTTACTATATACGATCGAA, Vimentin-P: JOE-TAAAGGTTTGTAGAAGTTTT-MGB; ONECUT2-F:ATAGAAGACGTCGGCGTC, ONECUT2-R:GAACTACGAACGAACTCGC, ONECUT2-P:FAM-CGAAATAAAAACGAACG-MGB; GDF15-F:TTTGTTTTTGGTCGAGGC, GDF15-R: CGATATTCGAATCTTCCCAA, GDF15-P: JOE-CTAATTAACCCGCAACC-MGB; TMEFF2-F:TTTTGTGTTTTCGGAAGTC, TMEFF2-R:GAACTTCACCGAACGAACTA, TMEFF2-P: Texas Red-CGAACAACAACAACAACC-MGB; Also included are primer probes for detecting an internal reference gene; the primer probes for detecting an internal reference gene include: ACTB-F: GCAAGCAGGAGTATGACG, ACTB-R: AAGGGGTTAACGCAACTAA, ACTB-P: CY5-TCCCCCATCTCCGAA-MGB.

2. A reaction system for detecting bladder cancer-related genes, characterized in that: It includes a Twist1-Vimentin gene reaction system and a ONECUT2-GDF15-TMEEF2 gene reaction system; the Twist1-Vimentin gene reaction system includes a primer-probe combination for detecting Twist1 and Vimentin genes, a PCR reaction solution, and a DNA template; the ONECUT2-GDF15-TMEEF2 gene reaction system includes a primer-probe combination for detecting ONECUT2-GDF15-TMEEF2 gene, a PCR reaction solution, and a DNA template; The primer-probe combination for detecting Twist1 and Vimentin genes is: Twist1-F: GCGGGAGTTCGTAGTTTTAC, Twist1-R: AAAAATAATCTTCCGCAACG, Twist1-P:FAM-AGTTGTAGACGTAGCGG-MGB; Vimentin-F:GGGAGGTTTACGTATGGC, Vimentin-R:CGCCTTACTATATACGATCGAA, Vimentin-P: JOE-TAAAGGTTTGTAGAAGTTTT-MGB; The primer-probe combination for detecting ONECUT2-GDF15-TMEEF2 gene is: ONECUT2-F:ATAGAAGACGTCGGCGTC, ONECUT2-R:GAACTACGAACGAACTCGC, ONECUT2-P:FAM-CGAAATAAAAACGAACG-MGB; GDF15-F:TTTGTTTTTGGTCGAGGC, GDF15-R: CGATATTCGAATCTTCCCAA, GDF15-P: JOE-CTAATTAACCCGCAACC-MGB; TMEFF2-F:TTTTGTGTTTTCGGAAGTC, TMEFF2-R:GAACTTCACCGAACGAACTA, TMEFF2-P: Texas Red-CGAACAACAACAACAACC-MGB; The Twist1-Vimentin gene reaction system and the ONECUT2-GDF15-TMEEF2 gene reaction system also include primer probes for detecting internal reference genes; The primer probe for detecting the internal reference gene includes: ACTB-F: GCAAGCAGGAGTATGACG, ACTB-R: AAGGGGTTAACGCAACTAA, ACTB-P: CY5-TCCCCCATCTCCGAA-MGB.

3. A bladder cancer assessment system, characterized in that: include: Gene fragment extraction module, used to collect urine specimens, wash and obtain urine exfoliated cells, and extract Twist1-ONECUT2-VIM-GDF15-TMEFF2 oncogene fragments; A gene amplification module for performing sulfite conversion on the extracted Twist1-ONECUT2-VIM-GDF15-TMEFF2 oncogene fragment, designing a reaction system as described in claim 2, and using the reaction system to perform gene amplification on the Twist1-ONECUT2-VIM-GDF15-TMEFF2 oncogene fragment after sulfite conversion; The analysis module is used to compare and analyze the CT value after gene amplification with the critical value. When the CT value is less than or equal to the critical value, it is positive, indicating that the collected urine exfoliated cells contain at least one of the methylated Twist1 gene, ONECUT2 gene, VIM gene, GDF15, and TMEFF2 gene.

4. The bladder cancer assessment system according to claim 3, characterized in that: The positive test when the CT value is less than or equal to the critical value includes: The Ct value of the Twist1 gene is ≤35 and there is an "S" amplification curve, indicating that the test result is positive and the Twist1 gene is methylated; The Ct value of ONECUT2 gene is ≤32 and there is an "S" amplification curve, indicating that the test result is positive and ONECUT2 gene is methylated; The Ct value of the VIM gene is ≤35 and there is an "S" amplification curve, indicating that the test result is positive and the VIM gene is methylated; The Ct value of the GDF15 gene is ≤32 and there is an "S" amplification curve, indicating that the test result is positive and the GDF15 gene is methylated; The Ct value of the TMEFF2 gene is ≤35 and there is an "S" amplification curve, indicating that the test result is positive and the TMEFF2 gene is methylated.

5. Use of the primer-probe combination for detecting bladder cancer-related genes according to claim 1 or the reaction system for detecting bladder cancer-related genes according to claim 2 in the preparation of a Twist1-ONECUT2-VIM-GDF15-TMEFF2 gene methylation detection reagent.

Images