KASP markers associated with resistance to powdery mildew in peas and use thereof

The KASP marker technology was used to identify the deletion of specific SNP sites in the pea genome, solving the problem of identifying pea powdery mildew resistance, achieving high efficiency and accuracy in pea breeding, and improving the breeding efficiency of disease-resistant varieties.

CN116121432BActive Publication Date: 2026-06-05INSTITUTE OF CROP SCIENCE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211101822.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-09-09
Publication Date
2026-06-05
Estimated Expiration
2042-09-09

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively identify pea powdery mildew resistance, leading to severe yield losses caused by pea powdery mildew and impacting pea production.

Method used

Using KASP marker technology, the genotype of peas was determined by detecting the deletion of specific SNP sites in the pea genome, and fluorescence signal scanning and software analysis were used to assess their resistance to powdery mildew.

Benefits of technology

This method enables rapid and accurate identification of pea powdery mildew resistance, improves pea breeding efficiency, shortens the breeding cycle, and enhances the ability to breed disease-resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure BDA0003840796480000071
    Figure BDA0003840796480000071
Patent Text Reader

Abstract

The application discloses a KASP marker related to pea powdery mildew resistance and application thereof. The application also discloses a SNP site related to pea powdery mildew resistance, which is the 583th deoxyribonucleotide of the DNA molecule described in sequence 4 in the sequence listing in the pea genome, and the polymorphism is T / -; the application further discloses a KASP marker developed based on the SNP site for identifying the pea powdery mildew resistance. Experiments prove that the KASP marker can be effectively applied to identification of pea powdery mildew resistance resources and molecular marker assisted breeding of a pea powdery mildew resistance offspring population, and has important value in pea production, breeding work and research on disease resistance mechanism.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the KASP marker related to pea powdery mildew resistance and its application. Background Technology

[0002] Peas (Pisum sativum L.) are the world's third largest legume crop, grown in nearly 90 countries worldwide, and are a major source of protein for humans and animals. Peas have been cultivated in China for over 2000 years, and are widely grown throughout the country as a vegetable, grain, and animal feed. According to the Food and Agriculture Organization of the United Nations (FAO), in 2013, my country's dried pea seed production reached 1.38 million tons, ranking second in the world, only after Canada; furthermore, my country is the world's largest producer of edible peas.

[0003] Pea powdery mildew is one of the most important diseases affecting pea production. Caused by the obligate parasitic fungus *Erysiphe pisi* DC, it is prevalent in temperate and subtropical regions, particularly severe under warm daytime and cool nighttime conditions. In typical years, it can cause 25%-50% yield loss, and in severe outbreaks, highly susceptible varieties can suffer yield losses exceeding 80%. Currently, the most economical, effective, and environmentally safe method for controlling pea powdery mildew is to cultivate and promote resistant varieties. Developing molecular markers related to pea powdery mildew resistance can identify germplasm resources, screen for resistant germplasm, and provide resistance sources for variety breeding. It can also be used for prospective selection of improved varieties, rapidly and efficiently improving target traits, significantly enhancing the efficiency and predictability of breeding superior resistant varieties, and playing a crucial role in accelerating the development of new resistant varieties.

[0004] KASP (Kompetitive allele specific PCR) is a new SNP genotyping method that has emerged in recent years. It features high accuracy, flexibility and low cost, and has been widely used in high-throughput SNP genotyping and InDels detection in various plants. Summary of the Invention

[0005] The technical problem to be solved by this invention is how to identify pea powdery mildew resistance in order to screen pea germplasm resources, varieties, lines or individual plants resistant to powdery mildew.

[0006] To address the aforementioned technical problems, this invention first provides a method for identifying or assisting in the identification of pea powdery mildew resistance.

[0007] The method for identifying or assisting in the identification of powdery mildew resistance in peas provided by this invention includes the following steps: detecting whether the genotype of the pea to be tested is a deletion genotype, and determining the powdery mildew resistance of the pea to be tested based on the genotype of the pea to be tested: if the genotype of the pea to be tested is a deletion genotype, then the pea to be tested exhibits or is a candidate for exhibiting resistance to powdery mildew; if the genotype of the pea to be tested is not a deletion genotype, then the pea to be tested exhibits or is a candidate for exhibiting resistance to powdery mildew or susceptibility to powdery mildew;

[0008] The deleted genotype is a homozygous genotype where all SNP sites are deleted; the SNP site is the 583rd deoxyribonucleotide in the pea genome corresponding to the DNA molecule described in sequence 4 of the sequence listing.

[0009] The method described above, which involves detecting whether the genotype of the pea to be tested is a deletion genotype, may include the following steps: using the genomic DNA of the pea to be tested as a template, performing PCR amplification using a primer set, scanning the obtained amplification product for fluorescence signals, and determining whether the pea genotype to be tested is a deletion genotype based on the fluorescence signals.

[0010] Furthermore, the method for determining whether the genotype of the pea to be tested is a deletion genotype based on the fluorescence signal includes the following steps: After PCR amplification, the fluorescence signal is processed using a Douglas-Araya high-throughput automated fluorescence signal scanner, and the genotyping results are exported using Douglas-specific Kraken software, thereby determining whether the genotype of the pea to be tested is a deletion genotype: If the fluorescence signal data of the amplification product of the pea to be tested turns red after software analysis, then the genotype of the pea to be tested is a deletion genotype; otherwise, the genotype of the pea to be tested is not a deletion genotype.

[0011] Furthermore, the primer set consists of upstream primer F1, upstream primer F2, and downstream primer R;

[0012] The upstream primer F1 is the single-stranded DNA shown in sequence 1 of the sequence listing;

[0013] The upstream primer F2 is the single-stranded DNA shown in sequence 2 of the sequence listing;

[0014] The downstream primer R is the single-stranded DNA shown in sequence 3 of the sequence listing.

[0015] The above method may further include the following steps: using the genomic DNA of the pea to be tested as a template, performing PCR amplification with a primer set, detecting the size of the amplification product, and determining whether the pea genotype to be tested is a deletion genotype based on the size of the amplification product.

[0016] Furthermore, the method for determining whether the genotype of the pea to be tested is a deletion genotype based on the size of the amplification product includes the following steps: if the size of the amplification product of the pea to be tested is 62 bp, then the genotype of the pea to be tested is a deletion genotype; otherwise, the genotype of the pea to be tested is not a deletion genotype.

[0017] Furthermore, the primer set consists of upstream primer F3, upstream primer F4, and downstream primer R;

[0018] The upstream primer F3 is the single-stranded DNA shown at positions 22-52 of sequence 1 in the sequence listing;

[0019] The upstream primer F4 is the single-stranded DNA shown at positions 22-48 of sequence 2 in the sequence listing;

[0020] The downstream primer R is the single-stranded DNA shown in sequence 3 of the sequence listing.

[0021] In the above method, the PCR amplification reaction system may consist of 2.0 μL of pea genomic DNA (10 ng / μL), 2.5 μL of KASPMaster Mix, 0.07 μL of mixed primers (including upstream primer F1, upstream primer F2 and downstream primer R), and 0.43 μL of ddH2O.

[0022] The PCR amplification program can be as follows: 95°C thermal activation for 15 minutes; 95°C denaturation for 20 seconds, annealing and extension at 65-55°C for 25 seconds, 10 cycles, with a decrease of 1.0°C per cycle; 95°C denaturation for 10 seconds, annealing and extension at 56°C for 60 seconds, 30 cycles.

[0023] To address the aforementioned technical problems, this invention provides a new application for substances used to detect the genotype of SNP loci in peas.

[0024] This invention provides the application of a substance for detecting the genotype of a pea SNP locus in any of the following (a1)-(a8):

[0025] (a1) To identify or assist in the identification of powdery mildew resistance in the tested peas;

[0026] (a2) Prepare products for identifying or assisting in the identification of powdery mildew resistance in peas to be tested;

[0027] (a3) Screening or assisted screening of powdery mildew resistant pea germplasm resources, varieties, lines or single plants (screening or assisted screening of powdery mildew resistant pea germplasm resources, varieties, lines or single plants with missing genotypes);

[0028] (a4) Prepare products for screening or assisting screening of pea germplasm resources, varieties, lines or single plants resistant to powdery mildew (screening or assisting screening of pea germplasm resources, varieties, lines or single plants resistant to powdery mildew with missing genotypes);

[0029] (a5) Improve pea germplasm resources, varieties, lines or individual plants;

[0030] (a6) Prepare products that improve pea germplasm resources, varieties, lines or single plants;

[0031] (a7) Pea breeding;

[0032] (a8) Preparation of pea breeding products;

[0033] The missing genotype is a homozygous individual where all SNP sites are missing;

[0034] The SNP site is the 583rd deoxyribonucleotide in the pea genome, corresponding to the DNA molecule described in sequence 4 of the sequence listing.

[0035] To solve the above-mentioned technical problems, the present invention also provides any one of the following products (b1)-(b3):

[0036] (b1) The primer set described above;

[0037] (b2) PCR reagents containing the primer set described in (b1);

[0038] (b3) A kit containing the primer set described in (b1) or the PCR reagent described in (b2).

[0039] Furthermore, the kit may also include at least one of KASP Master Mix and ddH2O, a standard positive template, etc.

[0040] The application of the above-mentioned product in any of the following (c1)-(c4) is also within the scope of protection of this invention:

[0041] (c1) To identify or assist in the identification of powdery mildew resistance in the tested peas;

[0042] (c2) Screening or assisted screening of powdery mildew resistant pea germplasm resources, varieties, lines or single plants (screening or assisted screening of powdery mildew resistant pea germplasm resources, varieties, lines or single plants with missing genotypes);

[0043] (c3) Improve pea germplasm resources, varieties, lines or individual plants;

[0044] (c4) Pea breeding;

[0045] The missing genotype is a homozygous individual where all SNP sites are missing;

[0046] The SNP site is the 583rd deoxyribonucleotide in the pea genome, corresponding to the DNA molecule described in sequence 4 of the sequence listing.

[0047] To address the aforementioned technical problems, this invention also provides a method for screening or assisting in the screening of powdery mildew-resistant pea germplasm resources, varieties, lines, or individual plants (screening or assisting in the screening of powdery mildew-resistant pea germplasm resources, varieties, lines, or individual plants with missing genotypes).

[0048] The method for screening or assisting in screening pea germplasm resources, varieties, lines or individual plants resistant to powdery mildew provided by the present invention includes the step of selecting pea germplasm resources, varieties, lines or individual plants with missing genotypes; the missing genotype is a homozygous individual with all SNP sites missing; the SNP site is the 583rd deoxyribonucleotide in the pea genome corresponding to the DNA molecule described in sequence 4 of the sequence listing.

[0049] To address the aforementioned technical problems, this invention ultimately provides a method for improving pea germplasm resources, varieties, lines, or individual plants.

[0050] The method for improving pea germplasm resources, varieties, lines or single plants provided by the present invention includes the step of using powdery mildew-resistant pea germplasm resources, varieties, lines or single plants (powdery mildew-resistant pea germplasm resources, varieties, lines or single plants with missing genotypes) as breeding materials for breeding.

[0051] The application of any of the methods described above in pea breeding is also within the scope of protection of this invention.

[0052] In any of the above applications or methods, the deleted genotype is a deletion homozygous genotype, which means that the deoxyribonucleotides at the SNP sites on both homologous chromosomes have been deleted.

[0053] In any of the above-described applications or methods, the pea breeding is molecular marker-assisted selection breeding, especially molecular marker-assisted breeding of pea powdery mildew resistant progeny populations. The purpose of the breeding is to select powdery mildew resistant pea germplasm resources, varieties, lines, or individual plants.

[0054] In any of the applications or methods described above, the pea or the pea to be tested can be any pea germplasm resource, variety, strain, or single plant. Specifically, the germplasm resource can be any one of the 62 pea germplasm resources in Table 1. Specifically, the single plant can be a single plant from the offspring population obtained by crossing Chengwan 8 as the female parent and Guiwan 1 as the male parent (e.g., an F2 population single plant).

[0055] The beneficial effects of this invention are as follows:

[0056] (I) This invention validated the KASP marker in Guiwan 1 and its resistant, stable hybrid offspring families. KASP analysis showed that the molecular marker formed three distinct scatter plots among resistant and susceptible parents and 131 individual plants in the F2 population. These three groups of differently colored scatter plots corresponded to three genotypes: deletion homozygous genotype (resistant to powdery mildew), TT homozygous genotype (susceptible to powdery mildew), and T-heterozygous genotype (susceptible to powdery mildew), respectively. This demonstrates that the KASP marker of this invention can be effectively applied to marker-assisted breeding of powdery mildew-resistant pea offspring populations.

[0057] (II) The present invention validated the KASP marker in 62 pea germplasm resources. The results showed that the KASP marker of the present invention could be used to successfully identify powdery mildew resistant pea resources with missing genotypes (homozygous), thus proving that the marker is effective in identifying powdery mildew resistant pea resources.

[0058] This invention provides a SNP locus associated with powdery mildew resistance in peas, which is T / - polymorphic. Based on this SNP locus, a KASP marker for identifying powdery mildew resistance in peas was developed. Experiments have demonstrated that this KASP marker can be effectively applied to the identification of powdery mildew-resistant pea resources and marker-assisted breeding of powdery mildew-resistant pea progeny populations. It can significantly shorten the breeding cycle and accelerate the breeding process, and has important value in pea production, breeding work, and research on disease resistance mechanisms. Attached Figure Description

[0059] Figure 1 This is a scatter plot of genotypes of all individual plants in the F2 population derived from the cross between the disease-resistant resource Guiwan 1 and the disease-susceptible variety Chengwan 8, using KASP technology in Example 1 of this invention. In the plot, 1 represents a red scatter plot, where red dots represent the homozygous disease-resistant genotype --; 2 represents a green scatter plot, where green dots represent the heterozygous genotype T-; and 3 represents a blue scatter plot, where blue dots represent the homozygous disease-susceptible genotype TT.

[0060] Figure 2 This is a scatter plot of genotypes from 62 pea resources analyzed using KASP technology in Example 2 of this invention. In the plot, 1 represents a red scatter plot, where the red dots represent the homozygous disease-resistant genotype --, and 3 represents a blue scatter plot, where the blue dots represent the homozygous disease-susceptible genotype TT. Detailed Implementation

[0061] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0062] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0063] The Guiwan No. 1 variety in the following examples is numbered G0007959 in the National Crop Germplasm Resource Long-Term Bank. This variety was systematically bred by the Guangxi Academy of Agricultural Sciences from local peas in Sanjiang Dong Autonomous County, Liuzhou City, Guangxi. The systematic breeding method includes the following steps: first, selecting superior mutant single plants in the field, then selecting superior plant rows, then selecting superior lines, and finally breeding superior varieties.

[0064] The pea variety Chengwan 8 described in the following examples is described in the literature “Comparison of leafy vegetable quality of different pea varieties (lines). Anhui Agricultural Sciences, 2022, 50(10):36-40”.

[0065] The 62 pea germplasm resources in the following examples are all described in the literature “Sun, S., Deng, D., Duan, C., Zong, X., Xu, D., He, Y., Zhu, Z. Two novel er1 alleles conferring powdery mildew (Erysiphe pisi) resistance identified in a worldwide collection of pea (Pisumsativum L.) germplasms. Int. J. Mol. Sci. 2019, 20(20), 5071”.

[0066] Example 1: Development of KASP markers associated with pea powdery mildew resistance

[0067] I. Discovery of SNP markers associated with pea resistance to powdery mildew

[0068] By comparing the differential loci between the powdery mildew-resistant pea variety Guiwan 1 and the powdery mildew-susceptible pea variety Chengwan 8, a SNP locus associated with powdery mildew resistance in peas was found. This SNP locus is located at position 583 of the DNA molecule shown in sequence 4 of the sequence listing in the pea genome (pea genome reference version number: Pisum sativum Cameor v1a genome scaffolds). The polymorphism of this locus is T / -, and there are TT genotype, T- genotype and -- genotype.

[0069] II. Development of KASP markers associated with pea powdery mildew resistance

[0070] Three specific primers for KASP were designed flanking the SNP site identified in step one using KASP technology, including two forward primers and one shared reverse primer, to develop a functional marker. Primer design and synthesis were performed by Zhongyujin Marker (Beijing) Biotechnology Co., Ltd. The sequences of the three specific primers for the KASP marker are as follows:

[0071] FAM forward primer: GAAGGTGACCAAGTTCATGCT ATATGCGTATCACAAAAAATTGGATCAACTT (Sequence 1, the underlined sequence is the FAM fluorescent sequence);

[0072] HEX forward primer: GAAGGTCGGAGTCAACGGATT GCGTATCACAAAAAATTGGATCAACTG (Sequence 2, the underlined sequence is the HEX fluorescent sequence);

[0073] Universal reverse primer sequence: CCTTGGCCTTTGTGTTTGAAGTGGAA (Sequence 3).

[0074] The amplification product of the KASP marker in the powdery mildew-resistant pea variety Guiwan 1 was 62 bp, while the amplification product in the powdery mildew-susceptible pea variety Chengwan 8 was 67 bp.

[0075] III. Validation of KASP Tags

[0076] The effectiveness of the KASP marker was verified using Guiwan No. 1 and Chengwan No. 8, and 131 F2 population plants derived from them. The specific method for preparing the 131 F2 population plants is as follows: Chengwan No. 8 was used as the female parent and Guiwan No. 1 was used as the male parent for hybridization to obtain F1 seeds. One F1 seed was sown and harvested to obtain 131 F2 seeds. The plant obtained after sowing each F2 seed is the individual plant of the F2 population.

[0077] 1. Identification of resistance to pea powdery mildew

[0078] The following steps were used to identify pea seed resistance to powdery mildew: Pea seeds were sown in disposable paper cups with vermiculite as the substrate and cultured in a greenhouse at 18-22℃. When the pea seedlings reached the fourth leaf node, the propagated powdery mildew conidia were shaken onto the seedlings and cultured in the greenhouse at 18-22℃ for 10 days. After 10 days, the disease incidence in each line was investigated, and powdery mildew resistance was identified using the root resistance evaluation criteria. The resistance evaluation criteria were: level 0 for immunity; levels 1 and 2 for resistance; and levels 3 and 4 for susceptibility. The susceptibility to powdery mildew was graded from 0 to 4: Level 0: No disease; Level 1: A small number of white spots on the green leaves; Level 2: The area of ​​the spots was less than 1 / 2 of the leaf area; Level 3: The pathogen infected most of the leaf surface, with only a small portion of the leaf surface showing green; Level 4: The pathogen almost covered the entire leaf surface.

[0079] 2. Genotyping

[0080] The SNPline platform based on the LGC system used the KASP markers in step two to perform genotyping on individual plants of Guiwan No. 1 and Chengwan No. 8 and their 131 F2 populations.

[0081] PCR reaction system (in 5 μL): 2.0 μL 10 ng / μL pea genomic DNA, 2.5 μL KASP Master Mix, 0.07 μL mixed primers, and 0.43 μL ddH2O.

[0082] PCR amplification program: 95℃ heat activation for 15 minutes; 95℃ denaturation for 20 seconds, 65-55℃ annealing and extension for 25 seconds, 10 cycles, decreasing by 1.0℃ per cycle; 95℃ denaturation for 10 seconds, 56℃ annealing and extension for 60 seconds, 30 cycles.

[0083] After PCR amplification, fluorescence signals were processed using a Douglas-Araya high-throughput automated fluorescence scanner, and genotyping results were exported using Douglas-specific Kraken software.

[0084] KASP analysis showed that three distinct scatter plot regions were formed among the resistant and susceptible parents and 131 F2 individual plants. Figure 1 These three groups of scatter plots, each with a different color, correspond to the deletion homozygous genotype (-- genotype, red), the TT homozygous genotype (blue), and the T-heterozygous genotype (green), respectively. Among them, the F2 plants with the deletion homozygous genotype (-- genotype, red) are all powdery mildew resistant, while the F2 plants with the TT homozygous and T-heterozygous genotypes are all powdery mildew susceptible.

[0085] Example 2: Application of KASP markers associated with pea powdery mildew resistance

[0086] Test materials: 62 pea germplasm resources.

[0087] Experimental methods: Genotyping and powdery mildew resistance identification were performed on all 62 pea germplasm resources according to the method in Example 1.

[0088] Experimental results: The KASP markers presented two distinct scatter plot regions across all tested resistant and susceptible pea resources. The powdery mildew-resistant pea resource, Guiwan 1, appeared in the red scatter plot region, while other resistant and susceptible pea resources appeared in the blue scatter plot region. Figure 2This indicates that the KASP marker can accurately identify powdery mildew-resistant pea resources with missing genotypes (homozygous missing genotypes) and other powdery mildew-resistant or powdery mildew-susceptible pea resources. It can be used for screening pea powdery mildew resistance identification and molecular marker-assisted selection breeding.

[0089] Table 1. Resistance phenotypes of 62 pea germplasm resources to powdery mildew and genotypes obtained using KASP markers.

[0090]

[0091]

[0092] Note: I represents immunity; R represents disease resistance; S represents disease infection.

[0093] In practical applications, the following methods can be used to identify or assist in identifying powdery mildew resistance in peas: Detect whether the genotype of the pea to be tested is a deletion genotype, and determine the powdery mildew resistance of the pea to be tested based on the genotype: If the genotype of the pea to be tested is a deletion genotype, then the pea to be tested exhibits or is a candidate for resistance to powdery mildew; if the genotype of the pea to be tested is not a deletion genotype, then the pea to be tested exhibits or is a candidate for resistance to powdery mildew or susceptibility to powdery mildew.

[0094] The deleted genotype is a homozygous genotype where all SNP sites are deleted; the SNP site is the 583rd deoxyribonucleotide in the pea genome corresponding to the DNA molecule described in sequence 4 of the sequence listing.

[0095] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A method for identifying or assisting in the identification of powdery mildew resistance in peas, comprising the following steps: detecting whether the genotype of the pea to be tested is a deletion genotype; determining the powdery mildew resistance of the pea to be tested based on the genotype of the pea to be tested: if the genotype of the pea to be tested is a deletion genotype, then the pea to be tested exhibits or is a candidate for exhibiting resistance to powdery mildew; if the genotype of the pea to be tested is not a deletion genotype, then the pea to be tested exhibits or is a candidate for exhibiting susceptibility to powdery mildew; The missing genotype is a homozygous individual with all SNP sites missing; the SNP site is the 583rd deoxyribonucleotide in the DNA molecule corresponding to sequence 4 in the sequence listing of the pea genome; the peas are single plants of the offspring population obtained by crossing Chengwan 8, Guiwan 1, Bawan6, Longwan 1 and the offspring population obtained by crossing Chengwan 8 as the female parent and Guiwan 1 as the male parent. The pea genome reference version number is Pisum sativum Cameor v1a genome scaffolds.

2. The method according to claim 1, characterized in that: The method for detecting whether the genotype of the pea to be tested is a deletion genotype is as follows: 1) or 2): 1) Using the genomic DNA of the peas to be tested as a template, PCR amplification was performed using a primer set. The obtained amplification products were scanned for fluorescence signals, and the genotype of the peas to be tested was determined based on the fluorescence signals to determine whether the genotype was a deletion genotype. 2) Using the genomic DNA of the peas to be tested as a template, PCR amplification was performed using a primer set. The size of the amplification product was detected, and the genotype of the peas to be tested was determined based on the size of the amplification product.

3. The method according to claim 2, characterized in that: In step 1), the primer set consists of upstream primer F1, upstream primer F2, and downstream primer R; The upstream primer F1 is the single-stranded DNA shown in sequence 1 of the sequence listing; The upstream primer F2 is the single-stranded DNA shown in sequence 2 of the sequence listing; The downstream primer R is the single-stranded DNA shown in sequence 3 of the sequence listing.

4. The method according to claim 2, characterized in that: In step 2), the primer set consists of upstream primer F3, upstream primer F4, and downstream primer R; The upstream primer F3 is the single-stranded DNA shown at positions 22-52 of sequence 1 in the sequence listing; The upstream primer F4 is the single-stranded DNA shown at positions 22-48 of sequence 2 in the sequence listing; The downstream primer R is the single-stranded DNA shown in sequence 3 of the sequence listing.

5. The application of reagents for detecting the genotype of the pea SNP locus to be tested in any of the following (a1)-(a8): (a1) To identify or assist in the identification of powdery mildew resistance in the tested peas; (a2) Prepare products for identification or auxiliary identification of powdery mildew resistance in peas to be tested; (a3) Screening or assisted screening of pea germplasm resources, varieties, lines or single plants resistant to powdery mildew; (a4) Prepare products for screening or assisting in screening pea germplasm resources, varieties, lines or single plants resistant to powdery mildew; (a5) Improve pea germplasm resources, varieties, lines or individual plants; (a6) To prepare products that improve pea germplasm resources, varieties, lines or single plants; (a7) Pea breeding; (a8) Preparation of pea breeding products; The SNP site is the 583rd deoxyribonucleotide in the DNA molecule corresponding to sequence 4 in the sequence listing in the pea genome; the peas are single plants of the offspring population obtained by crossing Chengwan 8, Guiwan 1, Bawan 6, Longwan 1 and the offspring population obtained by crossing Chengwan 8 as the female parent and Guiwan 1 as the male parent. The pea genome reference version number is Pisum sativum Cameor v1a genome scaffolds.

6. The application of any one of the products listed in (b1)-(b3) below in any one of the products listed in (c1)-(c4) below: (b1) The primer set according to any one of claims 2-4; (b2) PCR reagents containing the primer set described in (b1); (b3) A kit containing the primer set described in (b1) or the PCR reagent described in (b2); (c1) To identify or assist in the identification of powdery mildew resistance in the tested peas; (c2) Screening or assisted screening of pea germplasm resources, varieties, lines or single plants resistant to powdery mildew; (c3) Improve pea germplasm resources, varieties, lines or individual plants; (c4) Pea breeding; The peas mentioned are single plants of offspring obtained by hybridization of Chengwan 8, Guiwan 1, Bawan 6, Longwan 1, and Chengwan 8 as the female parent and Guiwan 1 as the male parent.

7. A method for screening or assisting in screening pea germplasm resources, varieties, lines, or individual plants resistant to powdery mildew, comprising the step of selecting pea germplasm resources, varieties, lines, or individual plants with a missing genotype; wherein the missing genotype is a homozygous individual with all SNP sites missing; wherein the SNP site is the 583rd deoxyribonucleotide in the DNA molecule corresponding to sequence 4 in the sequence listing of the pea genome; wherein the peas are Chengwan 8, Guiwan 1, Bawan 6, Longwan 1, and individual plants of the offspring population obtained by crossing Chengwan 8 as the female parent and Guiwan 1 as the male parent; The pea genome reference version number is Pisum sativum Cameor v1a genome scaffolds.

8. A method for improving pea germplasm resources, varieties, lines or individual plants, comprising the step of using powdery mildew-resistant pea germplasm resources, varieties, lines or individual plants screened according to the method of claim 7 as breeding materials for breeding.

9. The application of the method of claim 7 or 8 in pea breeding.

Citation Information

Patent Citations

  • Molecular marker co-segregated with pea powdery mildew-resistant allele er1-9 and application thereof

    CN107058306A

  • Tomato powdery mildew resistance related KASP molecular marker and application thereof

    CN114836571A