Use of a cd300ld inhibitor in the preparation of a product for preventing, diagnosing or treating a tumor

By targeting and regulating PMN-MDSC through the CD300LD gene, we developed a CD300LD inhibitor that binds to a PD1 antibody, which solved the problem of poor efficacy of existing therapies and achieved broad-spectrum anti-tumor effects and improvement of the tumor microenvironment.

CN116139275BActive Publication Date: 2026-02-17FUDAN UNIVERSITY +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202111392144.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-11-19
Publication Date
2026-02-17
Estimated Expiration
2041-11-19

AI Technical Summary

Technical Problem

Existing immune checkpoint blockade therapies such as PD1 and CTLA4 have poor efficacy in some patients. The search for new immune checkpoint molecules to promote tumor immunotherapy, especially specific targeted drugs against multinucleated myeloid-derived suppressor cells (PMN-MDSCs), has not yet been fully developed.

Method used

By using the CD300LD gene as a target, CD300LD inhibitors were developed. By regulating the activity and migration of PMN-MDSCs, the tumor immune microenvironment was improved, and a synergistic effect was generated by combining with PD1 antibodies to inhibit tumor growth.

Benefits of technology

It significantly inhibits the development of various tumor models, improves the tumor immune microenvironment, reduces PMN-MDSC, increases CD8+ T cell infiltration, enhances T cell function, and has a synergistic anti-tumor effect with CD300LD knockout and PD1 antibody. It has high safety and does not affect the normal development of the body and immune system.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0003364959300000011
    Figure HDA0003364959300000011
  • Figure HDA0003364959300000021
    Figure HDA0003364959300000021
  • Figure HDA0003364959300000022
    Figure HDA0003364959300000022
Patent Text Reader

Abstract

The present application relates to the field of biotechnology, in particular to the use of CD300LD inhibitors in the preparation of products for preventing, diagnosing or treating tumors, CD300LD inhibitors regulate the migration and function of PMN-MDSC cells by regulating S100A8 / A9 in its downstream signaling pathway, and play an important role in the establishment of tumor microenvironment; CD300LD inhibitors can effectively inhibit the development of various solid tumor mouse models, and have significant anti-tumor synergistic effect with PD1 antibodies; in the stage when the tumor has been established, the application of CD300LD inhibitors can significantly inhibit the development of tumors. The present application provides a new target and idea for tumor immunotherapy.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to the use of CD300LD inhibitor in the preparation of products for preventing, diagnosing or treating tumors. BACKGROUND

[0002] PD1, CTLA4 and other immune checkpoint blocking therapies only have good therapeutic effect in part of patients, so it is a major challenge in the field to find new immune checkpoints to further promote tumor immunotherapy. Polymorphic nuclear myeloid-derived suppressor cells (PMN-MDSC) are a kind of pathological induced neutrophils widely existing in various tumors, which can inhibit the function of effector cells such as T cells and NK cells, promote tumor development, infiltration and metastasis, and play a key role in tumor immune regulation. Specific targeting drugs for PMN-MDSC can further promote the immunotherapy of tumors, but the specific immune checkpoint molecules thereof still need to be discovered. SUMMARY

[0003] In view of the above-mentioned shortcomings of the prior art, the purpose of the present application is to provide the use of CD300LD inhibitor in the preparation of products for preventing, diagnosing or treating tumors, so as to solve the problems in the prior art.

[0004] To achieve the above-mentioned purposes and other related purposes, the present application first provides the use of CD300LD gene as a target in the preparation of tumor prevention, diagnosis or treatment drugs.

[0005] The present application also provides the use of CD300LD gene and PD1 as a target in the preparation of tumor prevention, diagnosis or treatment drugs.

[0006] The present application also provides the use of CD300LD inhibitor in the preparation of products with at least one of the following functions:

[0007] 1) preventing, diagnosing, treating tumors;

[0008] 2) regulating the activity and / or migration of myeloid cells;

[0009] 3) regulating T cell activity;

[0010] 4) regulating the downstream signaling pathway of CD300LD.

[0011] The present application also provides a composition comprising a CD300LD inhibitor, which is used for any one or more of the following purposes:

[0012] 1) preventing, diagnosing, treating tumors;

[0013] 2) regulating the activity and / or migration of myeloid cells;

[0014] 3) modulating T cell activity;

[0015] 4) modulating downstream signaling pathways of CD300LD.

[0016] As described above, the use of the CD300LD inhibitor of the present application in the preparation of a product for preventing, diagnosing or treating tumors has the beneficial effect of providing a new immune checkpoint molecule specific to PMN-MDSC, CD300LD, thereby specifically and efficiently targeting the regulation of PMN-MDSC, providing a new target and approach for solving the problem of targeting the regulation of PMN-MDSC for tumor immunotherapy. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 The figure shows the discovery of CD300LD gene and its gene expression profile in immune cells in Example 1 of the present application. A, differentially expressed genes of PMN-MDSC and neutrophils. B and C, schematic diagram of screening process for in vivo screening of myeloid cell surface receptors using Crispr-Cas9 and B16-F10 tumor model (B); screening enrichment genes (C), CD300LD gRNA is specifically deleted in tumors compared with bone marrow of tumor-bearing mice. D, flow cytometry analysis shows that CD300LD is specifically expressed in myeloid cells in white blood cells in normal mouse immune cells, especially in neutrophils (CD45 + CD11b + Ly6G + ) specifically highly expressed (n = 3). E, flow cytometry analysis of CD300LD expression in intratumoral myeloid cells: macrophages (CD45 + CD11b + F4 / 80 + ), mononuclear myeloid-derived suppressor cells M-MDSC (CD45 + CD11b + Ly6c + ly6G - ), polymorphonuclear myeloid-derived suppressor cells PMN-MDSC (CD45 + CD11b + Ly6c low ly6G +), and the results showed that CD300LD was specifically highly expressed in PMN-MDSCs. F, qRT-PCR showed the mRNA level of CD300LD in PMN-MDSCs from tumor-bearing mice and neutrophils from normal mice. G, Human Protein Atlas database analysis showed that the CD300LD gene was mainly expressed in blood / immune tissues and mainly expressed in neutrophils at the cell subtype. H, qRT-PCR quantified the CD300LD gene in peripheral blood granulocytes of healthy people and colon cancer patients. Two-tailed t test, *p<0.05, **p<0.01, ***p<0.001.

[0018] Figure 2 CD300LD knockout inhibits the occurrence and development of multiple tumors in Example 2 of the present application. A&B, schematic diagram of construction of CD300LD KO mice (A) and genotyping results (B). C, flow analysis of CD300LD expression in neutrophils of CD300LD WT and KO mice. D-F, tumor growth curve (D), tumor size at 20 days (E), and mouse survival curve (F) of melanoma (B16-F10) tumor model in CD300LD WT and KO mice (n=11). G, tumor growth curve of TC-1 cervical cancer model in CD300LD WT and KO mice (n=6). H, tumor growth curve of MC-38 colon cancer model in CD300LD WT and KO mice (n=6). I, tumor growth curve of LLC lung cancer model in CD300LD WT and KO mice (n=6). Two-tailed t test, *p<0.05, **p<0.01, ***p<0.001.

[0019] Figure 3Figure 3 shows that CD300LD knockout inhibits tumor development by PMN-MDSC in Example 3 of the present application. A, By conditionally knocking out CD300LD in myeloid cells through LyzCre, the development of B16-F10 tumor can be significantly inhibited (n=6). B, By conditionally knocking out CD300LD in PMN-MDSC of myeloid cells through S100A8Cre, the development of B16-F10 tumor can be significantly inhibited (n=9). C, By depleting PMN-MDSC in mice through Ly6g antibody, the development of B16-F10 tumor in wild type mice can be significantly inhibited, but no obvious effect in B16-F10 tumor model of CD300LD knockout mice. D-F, Macrophages (D), mononuclear myeloid-derived suppressor cells (E), and PMN-MDSC (F) were isolated from B16-F10 tumors of wild type mice or CD300LD KO mice, mixed with B16-F10 cells at a ratio of 1:1, and then inoculated subcutaneously in wild type mice. The growth curves of mice are shown, and the presence or absence of CD300LD in the multinucleated myeloid-derived suppressor cells led to differences in tumor growth. Two-tailed t test, *p<0.05, **p<0.01, ***p<0.001.

[0020] Figure 4 Figure 4 shows that CD300LD knockout improves the tumor immune microenvironment (flow cytometry results) in Example 4 of the present application. A, Flow cytometry analysis of the proportion of leukocytes (CD45 + ) and each major myeloid cell subpopulation in B16-F10 tumors. B, Flow cytometry analysis of the proportion of each lymphocyte subpopulation in B16-F10 tumors. C & D, Immunofluorescence analysis of PMN-MDSC (Ly6g + ) and CD8 + T cells in B16-F10 tumors, where C is the immunofluorescence result (Bar=200um), and D is the data statistics of immunofluorescence analysis. Two-tailed t test, *p<0.05, **p<0.01, ***p<0.001.

[0021] Figure 5 Figure 5 shows that CD300LD knockout improves the tumor immune microenvironment (single-cell sequencing results) in Example 4 of the present application. A & B, Single-cell sequencing was used to cluster immune cells in the immune microenvironment of B16-F10 tumors, where A is a tSNE plot, and B & C, distribution of immune cells in the B16-F10 tumor microenvironment of CD300LD WT and KO mice, where PMN-MDSC is significantly reduced in the KO group, and CD8 +T cells were significantly increased; B is a tSNE plot, C is a ratio plot of WT and KO corresponding cells. D, expression levels of PMN-MDSC function-related genes, and T cell recruitment and function-related genes in immune cells in WT and KO groups, the results showed that PMN-MDSC function-related genes were significantly down-regulated in KO group, and T cell infiltration and function-related gene expression were significantly increased. Two-tailed t test, *p<0.05, **p<0.01, ***p<0.001.

[0022] Figure 6 CD300LD KO significantly reduced the migration and function of PMN-MDSC in Example 5 of the present application. A, RNAseq analysis of gene expression profiles of CD300LD WT and KO PMN-MDSC, GO analysis found that the granulocyte migration signaling pathway was significantly different. B, GSEA analysis found that granulocyte migration-related genes were significantly enriched in WT PMN-MDSC. C, PMN-MDSC isolated from tumor-bearing CD300LD WT and KO mice were subjected to in vitro migration experiments, where the left side is a schematic diagram, and the right side is the experimental statistical results (n=3). D-F, PMN-MDSC isolated from tumor-bearing CD300LD WT and KO mice were subjected to in vivo migration experiments: D is a process schematic. E&F, flow cytometry analysis of WT and KO PMN-MDSC in bone marrow and tumors before injection, and after injection (E) and statistical results (F). G&H, analysis of the ability of CD300LD WT and KO PMN-MDSC to suppress T cell proliferation, where G is a flow cytometry plot, and H is a statistical analysis (n=3). Two-tailed t test, *p<0.05, **p<0.01, ***p<0.001.

[0023] Figure 7CD300LD regulates the migration and function of PMN-MDSCs through S100A8 / A9 in Example 6 of the present application. A, RNAseq analysis of differentially expressed genes in CD300LD WT and KO PMN-MDSCs, in which the expression of PMN-MDSC-associated gene S100A8 / A9 was significantly downregulated in the KO group. B, ELISA analysis of S100A8 / A9 levels in the serum of WT and KO tumor-bearing mice. C, qRT-PCR analysis of S100A8 / A9 expression in CD300LD WT and KO PMN-MDSCs (n=3). D, Effect of S100A8 / A9 protein on the in vitro migration ability of PMN-MDSCs (n=3). E, Effect of S100A8 / A9 inhibitor Tasquinimod on the suppression of T cell proliferation by WT and KO PMN-MDSCs (n=3). F & G, Intraperitoneal injection of S100A8 / A9 inhibitor Tasquinimod during tumor-bearing in mice, analysis of its effect on tumor growth curve (F), and the proportion of intratumoral PMN-MDSCs (G) (n=4-5). Two-tailed t test, *p<0.05, **p<0.01, ***p<0.001.

[0024] Figure 8 CD300LD knockout has an anti-tumor synergistic effect with PD antibodies in Example 7 of the present application. A, PD1 expression in CD300LD WT and KO mice tumor cells. B, PD1 expression in CD300LD WT and KO mice T cells (CD3 + CD8 + cells, PD-L1 + PMN-MDSC cells, and PD-L1 + tumor cells. C, PD1 expression in CD300LD WT and KO mice B cells (B220 + ), myeloid cells (Mac1 + ), and neutrophils (Mac1 + Gr1 + ). D, PD1 expression in CD300LD WT and KO mice spleen cells (n=3). E, PD1 expression in CD300LD WT and KO mice bone marrow (BM) cells (n=3). F, PD1 expression in CD300LD WT and KO mice peripheral blood (PB) cells (n=3). G, PD1 expression in CD300LD WT and KO mice thymus cells (n=3). Two-tailed t test, *p<0.05, **p<0.01, ***p<0.001.

[0025] Figure 9 CD300LD knockout has no significant effect on the development of the immune and hematopoietic system in Example 8 of the present application. A, T (CD3 + ), B (B220 + ), myeloid (Mac1 + ), and neutrophil (Mac1 + Gr1 +Flow cytometry analysis of immune cell proportion (n=3). B&C, flow cytometry analysis of HSC and each precursor cell in CD300LD WT and KO mice bone marrow (B) and statistics (C) (n=3). D, colony formation ability of HSC in CD300LD WT and KO mice (n=3). Two-tailed t test, *p<0.05, **p<0.01, ***p<0.001.

[0026] Figure 10 It is shown that the induced knockout of CD300LD can inhibit the development of established tumors, which can be used as an effective tumor treatment target. A, in CD300LD (f / f) / Mx1-Cre and CD300LD (f / f) A B16-F10 tumor model was established in mice, and Poly I:C was injected on the 7th day of tumor development to induce knockout of CD300LD. The tumor growth curve shows that CD300LD (f / f) Tumor development in CD300LD / Mx1-Cre mice was significantly inhibited (n=6). B, control group of A, mice in the same group as A, there was no significant difference in tumor growth between the two groups of mice if Poly I:C was not injected (n=6). Two-tailed t test, *p<0.05, **p<0.01, ***p<0.001. DETAILED DESCRIPTION

[0027] The present application focuses on finding key checkpoint molecules that regulate PMN-MDSC. Because PMN-MDSC is similar to neutrophils in molecular typing but functions in the opposite direction, the present application first performs transcriptome sequencing on both, analyzes the differences in membrane protein expression, and also constructs an sgRNA library for PMN-MDSC membrane proteins, combined with in vivo CRISPR-Cas9 screening in a mouse tumor model. Two strategies simultaneously point to a brand new membrane protein CD300LD. Human and mouse CD300LD are specifically expressed on neutrophils / PMN-MDSC, and their expression is significantly up-regulated after tumor-bearing. Knockout of CD300LD significantly inhibits tumor development in various models including melanoma, colon cancer, breast cancer and lung cancer. Using CD300LD conditional knockout or Ly6G antibody to clear PMN-MDSC in vivo, as well as separating different myeloid cell subpopulations for mixed tumor experiments, etc., it is proved that PMN-MDSC specifically regulates tumor immunity through CD300LD. Therefore, CD300LD is a brand new PMN-MDSC-specific tumor immunosuppression receptor, an effective immune checkpoint molecule.

[0028] Mechanism research found that CD300LD knockout led to significant improvement in tumor immunosuppressive microenvironment: PMN-MDSC was sharply reduced, CD8 +T cell infiltration was significantly increased; PMN-MDSC migration and function-related signaling pathways were significantly down-regulated; T cell migration and killing-related signaling pathways were significantly up-regulated. Further research found that CD300LD regulates the tumor migration of PMN-MDSC and the function of T cells through downstream S100A8 / A9. In summary, CD300LD knockout regulates the recruitment and function of PMN-MDSC through S100A8 / A9, thereby significantly improving the tumor immunosuppressive microenvironment and producing a broad-spectrum anti-tumor effect.

[0029] In terms of safety, unlike the current widely concerned CSF1R knockout organism, which is lethal to myeloid cells and has strong side effects, CD300LD knockout does not affect the normal development of the body and immune system. In terms of effectiveness, CD300LD inhibits the development of multiple tumor models and presents a significant anti-tumor synergistic effect with PD1 antibodies; more importantly, in the established stage of tumor, inducing CD300LD knockout can also significantly inhibit tumor development. In summary, CD300LD as a new target has good safety and anti-tumor effectiveness.

[0030] Based on the above research, the present application first provides the use of CD300LD gene as a target in the preparation of a tumor prevention, diagnosis or treatment drug.

[0031] In the present application, the word "prevention" includes preventive treatment that can result in the desired pharmacological and / or physiological effect. The effect preferably means that the occurrence of the disease can be blocked, delayed and / or the risk of disease development or deterioration can be reduced in a medical manner.

[0032] In the present application, the word "diagnosis" can be used to determine whether a certain disease exists according to the expression amount of CD300LD.

[0033] In the present application, the word "treatment" includes curative or palliative treatment that can result in the desired pharmacological and / or physiological effect. The effect preferably means that one or more symptoms of the disease can be reduced or completely eliminated in a medical manner.

[0034] The tumor described in the present application is a tumor overexpressing CD300LD. The overexpression of CD300LD generally refers to the expression level of CD300LD being higher than a certain standard, which can be at the molecular level or at the protein level. For example, CD300LD positivity can be the overexpression of mRNA of CD300LD detectable in tumor tissue. For another example, CD300LD positivity can be the overexpression of protein of CD300LD detectable in tumor tissue. For another example, CD300LD positivity can be the mRNA expression level of CD300LD in tumor tissue being higher than that in the surrounding healthy tissue. For another example, CD300LD positivity can be the protein expression level of CD300LD in tumor tissue being higher than that in the surrounding healthy tissue. The tumor can be a solid tumor (e.g., a digestive tract tumor, a respiratory tract tumor) or a blood tumor, and more specifically can be intestinal cancer, lung cancer, liver cancer, breast cancer, esophageal cancer, head and neck cancer, skin cancer, kidney cancer, leukemia, cervical cancer, coad (colon cancer), lihc (liver hepatocellular carcinoma), ov (ovarian serous cystadenocarcinoma), ucec (endometrial carcinoma), thca (thyroid cancer), skcm (cutaneous melanoma), luad (lung adenocarcinoma), hnsc (head and neck squamous cell carcinoma), gbm (glioblastoma multiforme), prad (prostate cancer), thym (thymic carcinoma), lgg (brain low-grade glioma), read (rectal adenocarcinoma), pcpg (pheochromocytoma and paraganglioma), esca (esophageal carcinoma), kirc (kidney renal clear cell carcinoma), blca (urinary bladder urothelial carcinoma), kirp (kidney renal papillary cell carcinoma), paad (pancreatic adenocarcinoma), stad (stomach adenocarcinoma), kich (kidney renal chromophobe carcinoma), brca (breast invasive carcinoma), lusc (lung squamous cell carcinoma), sarc (sarcoma), LAML (acute myeloid leukemia), etc.

[0035] The CD300LD gene as a target for preparing a tumor prevention, diagnosis or treatment drug specifically refers to taking the CD300LD gene as an action object, screening drugs or preparations to find a drug that can inhibit the expression of the CD300LD gene as a candidate drug for tumor treatment. For example, small interfering RNA (siRNA) is obtained by screening with human CD300LD gene as an action object, which can be used as a drug with the effect of inhibiting tumor cell proliferation. In addition, drugs such as antibodies and small molecules can also take the CD300LD gene as an action object.

[0036] The human CD300LD gene as a target for preparing a tumor diagnosis drug specifically refers to taking the CD300LD gene expression product as a tumor diagnosis index for the preparation of a tumor diagnosis drug.

[0037] In an embodiment, the tumor treatment drug is a molecule capable of specifically inhibiting the transcription or translation of the CD300LD gene, or capable of specifically inhibiting the expression or activity of the CD300LD protein, thereby reducing the expression level of the CD300LD gene in tumor cells, or capable of competitively inhibiting CD300LD, so as to achieve the purpose of significantly improving the tumor immune suppression microenvironment, which is specifically manifested as a sharp decrease in PMN-MDSC, a significant increase in CD8 + T cell infiltration is significantly increased; PMN-MDSC migration and function-related signaling pathways are significantly down-regulated; T cell migration and killing-related signaling pathways are significantly up-regulated. The inventors found through mechanism research that CD300LD in the tumor treatment drug regulates tumor migration of PMN-MDSC and inhibition of T cell function through downstream S100A8 / A9, thereby producing a broad-spectrum anti-tumor effect.

[0038] The tumor treatment drug or tumor diagnosis drug prepared by the CD300LD gene includes but is not limited to nucleic acid molecules, carbohydrates, lipids, small molecule chemicals, antibody drugs, polypeptides, proteins, or interfering lentiviruses.

[0039] The nucleic acid includes but is not limited to antisense oligonucleotides, double-stranded RNA (dsRNA), ribozymes, small interfering RNA prepared by endoribonuclease III, or short hairpin RNA (shRNA).

[0040] In an embodiment, the administration amount of the tumor treatment drug is a dose sufficient to reduce the transcription or translation of the human CD300LD gene, or sufficient to reduce the expression or activity of the CD300LD protein. So that the expression or activity of the human CD300LD gene is at least reduced by 50%, 80%, 90%, 95%, or 99%.

[0041] In another embodiment, the dose sufficient to reduce the activity of the CD300LD protein is a dose sufficient to competitively bind to the CD300LD protein or its receptor, so that the CD300LD protein cannot function.

[0042] The method for treating tumors by using the aforementioned tumor treatment drug mainly achieves the purpose of treatment by inhibiting the proliferation of tumor cells through reducing the expression or activity level of the human CD300LD gene. Specifically, when treating, a substance capable of effectively reducing the expression or activity level of the human CD300LD gene is administered to the patient.

[0043] In an embodiment, the target of the CD300LD gene is Exon2.

[0044] The present application also provides the use of CD300LD gene and PD1 as a target in the preparation of a tumor prevention, diagnosis or treatment drug.

[0045] The present application also provides use of the CD300LD inhibitor in the preparation of a product having at least one of the following effects:

[0046] 1) preventing, diagnosing, treating tumors;

[0047] 2) regulating the activity and / or migration of myeloid cells;

[0048] 3) regulating T cell activity;

[0049] 4) regulating the downstream signaling pathway of CD300LD.

[0050] The inventors of the present application have found that the CD300LD inhibitor can regulate the activity of myeloid cells. The regulation of the activity of myeloid cells may, for example, be a decrease in the number of myeloid cells or a decrease in the expression of immune-related genes on myeloid cells.

[0051] The regulation of the migration of myeloid cells may be achieved by significantly down-regulating the signaling pathway related to the migration of myeloid cells.

[0052] The myeloid cells are selected from macrophages, M-MDSCs or PMN-MDSCs.

[0053] The regulation of T cell activity may, for example, be a significant increase in the infiltration of immune cells in the tumor microenvironment, a significant increase in the number of CD4 + and CD8 + T cells, a significant decrease in Treg cells, a significant increase in the expression of genes related to the killing function of T cells, or a significant increase in genes related to the recruitment of T cells. The CD300LD inhibitor can regulate T cell proliferation by inhibiting the T cell inhibitory function of myeloid cells.

[0054] The regulation of the downstream signaling pathway of CD300LD may be achieved by up-regulating a gene in the downstream signaling pathway or by down-regulating a gene in the downstream signaling pathway. The gene in the downstream signaling pathway may, for example, be S100A8, S100A9, Trim10, Ms4a6d, Apol11b.

[0055] The product provided by the present application generally contains the CD300LD inhibitor as an immunotherapeutic drug. The immunotherapeutic drug for treating tumors generally reactivates and maintains the tumor-immune cycle, restores the normal anti-tumor immune response of the body, and changes the tumor microenvironment to achieve the effect of controlling and eliminating tumors.

[0056] The product necessarily contains the CD300LD inhibitor and uses the CD300LD inhibitor as an effective component for the aforementioned effects.

[0057] The effective component for the above-mentioned function in the product can be only the CD300LD inhibitor, or can include other molecules that can play the above-mentioned function.

[0058] That is, the CD300LD inhibitor is the only effective component or one of the effective components of the product.

[0059] The product can be a single-component substance, or can be a multi-component substance.

[0060] The form of the product is not particularly limited, and can be various substance forms such as a solid, a liquid, a gel, a semi-liquid, an aerosol, and the like.

[0061] The object targeted by the product is mainly a mammal. The mammal is preferably a rodent, an even-toed ungulate, an odd-toed ungulate, a lagomorph, a primate, and the like. The primate is preferably a monkey, an ape, or a human.

[0062] The product includes, but is not limited to, a drug, a health product, a food, a kit, and the like.

[0063] The CD300LD inhibitor can be a nucleic acid molecule, an antibody, a small molecule compound.

[0064] As exemplified in the embodiments of the present application, the CD300LD inhibitor can be a nucleic acid molecule that reduces the expression of a CD300LD gene in a tumor cell.

[0065] In the present application, the CD300LD inhibitor generally refers to a substance capable of inhibiting the expression and / or function of CD300LD. For example, the CD300LD inhibitor can partially inhibit, i.e., reduce the expression and / or function of CD300LD, such as reducing the expression and / or function of CD300LD by 50%, 60%, 70%, 80%, 90%, 95%, 99%; or completely inhibit, i.e., substantially completely eliminate the expression and / or function of CD300LD. The types of suitable substances capable of serving as CD300LD inhibitors should be known to those skilled in the art. For example, the CD300LD inhibitor can be an antagonist, a blocking agent, etc. For another example, the inhibitory function of the CD300LD inhibitor can be the inhibition of the expression level at the level of CD300LD gene nucleic acid molecule (e.g., mRNA level, DNA level) and / or protein molecule. For another example, the CD300LD inhibitor can also be a substance that competes with CD300LD for binding to its ligand, or a substance that competes with the ligand of CD300LD for binding to CD300LD. More specifically, the CD300LD inhibitor can be a nucleic acid molecule, a protein molecule, or a compound, etc. For example, the nucleic acid molecule can be selected from the interfering RNA against CD300LD, the antisense oligonucleotide against CD300LD, the substance for knocking out or knocking down the expression of CD300LD, and more specifically can be siRNA, miRNA, shRNA, gene knockout vector, gene expression vector (e.g., capable of expressing siRNA, shRNA, interfering RNA), etc. In a specific embodiment of the present application, the target sequence of the nucleic acid molecule can be exon 2 of CD300LD. For example, the protein molecule can be selected from the anti-CD300LD antibody, which can be a monoclonal antibody, a polyclonal antibody, etc. For another example, the CD300LD inhibitor can be CD300LD-ECD (CD300LD extracellular region), and the amino acid sequence of CD300LD-ECD can be derived from rat, mouse, human, etc.

[0066] The present application also provides a composition comprising the CD300LD inhibitor, which is used for any one or more of the following purposes:

[0067] 1) treating tumors;

[0068] 2) modulating the activity and / or migration of myeloid cells;

[0069] 3) modulating T cell activity;

[0070] 4) modulating the downstream signaling pathway of CD300LD.

[0071] The CD300LD inhibitor can be various CD300LD inhibitors as described above.

[0072] The product or composition of the present application can be used for diagnostic or therapeutic purposes, or can be used for non-diagnostic or non-therapeutic purposes.

[0073] The present application also provides an in vitro drug screening method, which comprises the following steps: mixing a cell overexpressing CD300LD with a drug to be screened, and detecting the changes of the cell.

[0074] In one embodiment, the drug to be screened is an anti-tumor drug. The anti-tumor drug is, for example, a CD300LD inhibitor.

[0075] In one embodiment, the cell overexpressing CD300LD is a myeloid immune cell. More specifically, the myeloid immune cell is selected from the group consisting of macrophages, M-MDSCs, and PMN-MDSCs.

[0076] The changes of the cell include changes in the activity, migration, expression of CD300LD, and downstream signaling pathway of CD300LD of the cell.

[0077] The present application also provides a regulation method, which comprises administering an effective amount of a CD300LD inhibitor or the composition provided above to an individual to regulate the activity of myeloid cells, or to regulate the activity of T cells, or to regulate the downstream signaling pathway of CD300LD.

[0078] The present application also provides a treatment method, which comprises administering a therapeutically effective amount of a CD300LD inhibitor or the composition provided above to an individual.

[0079] The treatment method provided by the present application can be used to treat indications including but not limited to tumors and the like.

[0080] In the present application, the "individual" generally includes humans, non-human primates, such as mammals, dogs, cats, horses, sheep, pigs, cows, and the like, which can benefit from treatment with the above-mentioned drugs, compositions, preparations, kits, or combinations.

[0081] In the present application, the "therapeutically effective amount" generally refers to an amount that can achieve the effect of treating the diseases listed above after a proper administration period. Specifically, the CD300LD inhibitor or the composition administered to the subject has a dosage that varies depending on the age and weight of the patient, the characteristics and severity of the disease, and the administration route. The total administration amount can not exceed a certain range, which can be determined by referring to the results of animal experiments and various conditions.

[0082] In some embodiments, the CD300LD inhibitor, or composition described herein is administered in an amount of about 0.001 mg / Kg to about 500 mg / Kg (e.g., about 0.001 mg / Kg to about 200 mg / Kg; about 0.01 mg / Kg to about 200 mg / Kg; about 0.01 mg / Kg to about 150 mg / Kg; about 0.01 mg / Kg to about 100 mg / Kg; about 0.01 mg / Kg to about 50 mg / Kg; about 0.01 mg / Kg to about 10 mg / Kg; about 0.01 mg / Kg to about 5 mg / Kg; about 0.01 mg / Kg to about 1 mg / Kg; about 0.01 mg / Kg to about 0.5 mg / Kg; about 0.01 mg / Kg to about 0.1 mg / Kg; about 0.1 mg / Kg to about 200 mg / Kg; about 0.1 mg / Kg to about 150 mg / Kg; about 0.1 mg / Kg to about 100 mg / Kg; about 0.1 mg / Kg to about 50 mg / Kg; about 0.1 mg / Kg to about 10 mg / Kg; about 0.1 mg / Kg to about 5 mg / Kg; about 0.1 mg / Kg to about 1 mg / Kg; about 0.1 mg / Kg to about 0.5 mg / Kg). The total daily dose can be divided, and administered in portions during the day, or by means of continuous delivery. The administration can be daily (e.g., as a single dose or as two or more divided doses) or non-daily (e.g., every other day, every two days, every three days, once a week, twice a week, once every two weeks, once a month). In some embodiments, the CD300LD inhibitor, or composition described herein is administered for a period of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more. In another embodiment, the administration is stopped for a period of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more. In one embodiment, the individual is administered the therapeutic CD300LD inhibitor, or composition for a period of time, followed by a separate period of time. In another embodiment, the individual is administered the therapeutic CD300LD inhibitor, or composition for a first period of time, the administration is stopped for a second period of time following the first period of time, and then the administration of the CD300LD inhibitor, or composition is resumed for a third period of time, followed by a fourth period of time in which the administration is stopped.In one embodiment, the time of administration is 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more. In another embodiment, the time of discontinuation of administration is 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 11 weeks, 12 weeks, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more.

[0083] In some embodiments, the methods described herein can further comprise administering one or more additional therapies (e.g., one or more additional therapeutic agents and / or one or more therapeutic regimens) in conjunction with the compounds described herein.

[0084] In some embodiments, the methods described herein can further comprise administering one or more additional cancer therapies. The one or more additional cancer therapies can include, but are not limited to, surgery, radiation therapy, chemotherapy, toxin therapy, immunotherapy, cryotherapy, cancer vaccines (e.g., HPV vaccine, Hepatitis B vaccine, Oncophage, Provenge), and gene therapy, and combinations thereof. Immunotherapy, including but not limited to, adoptive cell therapy, derivation of stem cells and / or dendritic cells, transfusions, lavage, and / or other therapies, including but not limited to, cryotherapy of tumors.

[0085] In some embodiments, the one or more additional cancer therapies is chemotherapy, which can include administration of one or more additional chemotherapeutic agents.

[0086] In some embodiments, the other chemotherapeutic agent is an immunomodulatory molecule, such as an immune checkpoint inhibitor. In some of these embodiments, the immune checkpoint inhibitor targets an immune checkpoint receptor selected from the group consisting of CTLA-4, PD-1, PD-L1, PD-1-PD-L1, PD-1-PD-L2.

[0087] In some of these embodiments, the immune checkpoint inhibitor is selected from the group consisting of: Pembrolizumab (PD1), Nivolumab (PD1), Atezolizumab (formerly known as MPDL3280A) (PDL1), MEDI4736 (PD-L1), Avelumab (PD-L1), PDR001 (PD1), BMS-986016, MGA271, Lirilumab, IPH2201, Emactuzumab, INCB024360, Galunisertib, Ulocuplumab, BKT140, Bavituximab, CC-90002, Bevacizumab, MNRP1685A, and MGA271.

[0088] The present application is herein described, by way of example only, with reference to the accompanying drawings, details of which are shown with the following examples. Embodiments of the application will be apparent to those of ordinary skill in the art from this description and from the practice of the application.

[0089] Before further description of the application, it is understood that the application is not limited in scope to the specific embodiments described herein; and that various modifications and equivalents can be employed without departing from the true spirit and scope of the application. The terminology used herein for the purpose of describing particular embodiments of the application is not intended to be limiting of the application. Unless defined otherwise, all technical and scientific terms and any acronyms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

[0090] When numerical ranges are given, understand that every numerical range is a range of values including the endpoints, and any number within the range. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Any methods, devices and materials similar or equivalent to those described herein can be used in the practice of the application, unless otherwise stated. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0091] Example 1 Screening of key functional receptors of PMN-MDSC

[0092] The immunosuppressive microenvironment of tumor is an important factor for tumor immune escape. In the tumor microenvironment, polymorphonuclear myeloid-derived suppressor cells (PMN-MDSC) are an important cell population leading to immunosuppression. Because PMN-MDSC is similar to neutrophils in molecular typing but opposite in function, this embodiment first performs transcriptome sequencing on both, analyzes the difference in membrane protein expression; at the same time, an sgRNA library for PMN-MDSC membrane proteins is constructed, combined with a mouse tumor model for in vivo screening by CRISPR-Cas9. The key functional receptors of PMN-MDSC are screened by using the two strategies, and the expression profile of the obtained candidate molecules is analyzed.

[0093] Materials and methods:

[0094] 1-1) Transcriptional analysis of PMN-MDSC and neutrophils: AutoMACS magnetic sorting was used to separate neutrophils (CD11b + Ly6G + ) in the bone marrow of normal C57 mice and PMN-MDSC (CD11b + Ly6G + ) in the spleen of B16-F10 tumor-bearing mice, and total RNA was extracted from the cells for RNAseq sequencing analysis according to methods well known in the art.

[0095] 1-2) Construction and packaging of sgRNA library targeting myeloid cell-specific surface receptors: Using RNAseq data of immune cells, the expression ratio of membrane protein genes in myeloid cells / lymphoid cells was calculated, and 300 receptor genes specifically expressed in myeloid cells were selected according to the ratio >2. For each gene, 10 sgRNA oligos were designed and synthesized according to methods well known in the art, and were constructed into a Syn003-modified lentiviral expression plasmid to obtain an sgRNA lentiviral expression library targeting myeloid cell surface receptors. The library plasmid and lentivirus packaging plasmid were co-transfected into 293T cells using Lipofectin, and the virus supernatant was collected after 48 hrs, 0.45 μm filter membrane filtered, and used for infection of target cells.

[0096] 1-3) Screening of key receptors related to myeloid cells in tumor microenvironment: Hematopoietic precursor cells (Lineage-negative cells) in Cas9 mouse fetal liver were separated by magnetic sorting, and then the precursor cells were infected with the aforementioned sgRNA library virus supernatant and transplanted into irradiated mice (9G) to reconstitute the immune system of mice; the immune cells of these mice will express different sgRNAs. After 4 weeks, 1.5×10 5 B16 cells were inoculated subcutaneously in mice to form tumors, and 2 weeks later, myeloid cells in the bone marrow and tumor of mice were separated, and the gRNA therein was amplified according to methods well known in the art for deep sequencing and comparative analysis.

[0097] 1-4) Expression analysis of CD300LD in each type of immune cells in mice: normal mouse bone marrow or B16 tumor-bearing mouse bone marrow and tumor were isolated, single cell suspension was prepared, and after labeling with CD300LD antibody and antibody of each immune cell, flow detection was carried out, and the protein expression level of CD300LD on the surface of each type of immune cell was analyzed, wherein the surface markers of each immune cell are as follows: macrophages (CD45 + / CD11b + / / F4 / 80 + ), monocytes / M-MDSC (CD45 + / CD11b + / Ly6c + ), neutrophils / PMN-MDSC (CD45 + / CD11b + / Ly6G + ), DC (CD45 + / CD11b - / CD11c + ), T cells (CD45 + / CD3 + ), CD4 + T (CD45 + / CD3 + / CD4 + ), CD8 + T (CD45 + / CD3 + / CD8 + ), B cells (CD45 + / B220 + ), NK cells (CD45 + / NKG2D + ). To analyze the RNA expression level of CD300LD, the present application uses the above molecular markers to flow sort immune cells in normal or tumor-bearing mouse bone marrow or tumor, reverse transcribe mRNA using oligo d(T)16 (Invitrogen, Cat#N8080128), and then perform qRT-PCR detection according to the following primers and conditions.

[0098] mLD-For: 5 'ACATTGACCAAGCCCCAAAAA 3'(SEQ ID NO. 1)

[0099] mLD-Rev: 5 'AGCAGGGGTAACTCCACAAAG 3'(SEQ ID NO. 2)

[0100] mGAPDH-For: 5'GTCTACATGTTCCAGTATGACTCC 3'(SEQ ID NO. 3)

[0101] mGDPDH-Rev: 5'AGTGAGTTGTCATATTTCTCGTGGT 3'(SEQ ID NO. 4)

[0102] qPCR conditions: 95 °C 5 min, (95 °C 30 s, 58 °C 30 s, 72 °C 30 s, 40 cycles), 72 °C 10 min, 4 °C

[0103] 10 min

[0104] 1-5) CD300LD expression analysis in human immune cells: Using Human Protein Atlas database, mRNA expression level of CD300LD in different types of human immune cells was analyzed. To analyze the expression level of CD300LD in clinical tumor patients, peripheral blood of normal people and intestinal cancer patients was collected, and after extracting the mRNA of white blood cells, qRT-PCR detection was performed according to the following primers and conditions:

[0105] huLD-For: 5'TCCCAGGTTACTCCATTGCC 3'(SEQ ID NO. 5)

[0106] huLD-Rev: 5'GCCTGAGCCATAAGCACACT 3'(SEQ ID NO. 6)

[0107] huGAPDH-For: 5'TGTGGGCATCAATGGATTTGG 3'(SEQ ID NO. 7)

[0108] huGDPDH-Rev: 5'ACACCATGTATTCCGGGTCAAT 3'(SEQ ID NO. 8)

[0109] qPCR conditions: 95 °C 5 min, (95 °C 30 s, 58 °C 30 s, 72 °C 30 s, 40 cycles), 72 °C 10 min, 4 °C 10 min)

[0110] Results:

[0111] Transcriptome analysis results showed that CD300LD was significantly up-regulated in PMN-MDSC compared with normal neutrophils Figure 1 A). At the same time, in vivo screening of membrane proteins specifically expressed in myeloid cells was performed using Crispr-Cas9 Figure 1B), the results showed that the CD300LD-gRNA abundance in myeloid cells of tumor microenvironment of tumor-bearing mice was significantly lower than that of myeloid cells of bone marrow Figure 1 C), indicating that the tumor microenvironment excludes CD300LD knockout. Both of the above two screenings suggest that CD300LD can be a key receptor of PMN-MDSC.

[0112] The cells expressing CD300LD were analyzed. CD300LD was specifically highly expressed in normal neutrophils, as well as tumor PMN-MDSCs Figure 1 D and E). Compared with normal neutrophils, the expression level of CD300LD in PMN-MDSCs was significantly increased Figure 1 F). In human immune cell populations, CD300LD was also specifically highly expressed in neutrophils Figure 1 G); and the expression level of CD300LD in tumor patient-derived PMN-MDSCs was significantly higher than that in normal neutrophils Figure 1 H).

[0113] The above results show that CD300LD is specifically highly expressed in neutrophils / PMN-MDSCs, and the expression in PMN-MDSC cells is significantly increased during tumor occurrence; combined with the Crispr-Cas9 screening results, i.e., the tumor microenvironment excludes CD300LD knockout, it is suggested that CD300LD is likely to be a key receptor required for PMN-MDSC to be recruited, differentiated and function in tumors.

[0114] Example 2 CD300LD knockout significantly inhibits the development of various types of tumors

[0115] To evaluate the function of CD300LD in tumor development, CD300LD knockout mice were constructed, and various different tumor models were used to analyze the effect of CD300LD knockout on tumor development.

[0116] Materials and methods:

[0117] 2-1) Construction of CD300LD knockout mice (commissioned to a third-party company, Jiechu Pharmaceutical Company): Cas9 / sgRNA (gRNA1 sequence as shown in SEQ ID NO. 9; gRNA2 sequence as shown in SEQ ID NO. 10) was used to construct mice knocking out CD300LD Exon2 (nucleotide sequence as shown in SEQ ID NO. 11);

[0118] 2-2) B16-F10 melanoma mouse model: B16 cells (1.5 x 10 5The tumor size was measured every 2-3 days, and the tumor growth curve was drawn. When the tumor volume reached 1000 cm3, the mice were determined to be dead, and the survival curve of the mice was drawn. 3 The tumor size was measured every 2-3 days, and the tumor growth curve was drawn. When the tumor volume reached 1000 cm3, the mice were determined to be dead, and the survival curve of the mice was drawn.

[0119] 2-3) TC-1 cervical cancer mouse model: TC1 cells (1.5 x 10 5 The tumor size was measured every 2-3 days, and the tumor growth curve was drawn. When the tumor volume reached 1000 cm3, the mice were determined to be dead, and the survival curve of the mice was drawn. 3 The tumor size was measured every 2-3 days, and the tumor growth curve was drawn. When the tumor volume reached 1000 cm3, the mice were determined to be dead, and the survival curve of the mice was drawn.

[0120] 2-4) MC-38 colon cancer mouse model: MC38 cells (1.0 x 10 6 The tumor size was measured every 2-3 days, and the tumor growth curve was drawn. When the tumor volume reached 1000 cm3, the mice were determined to be dead, and the survival curve of the mice was drawn. 3 The tumor size was measured every 2-3 days, and the tumor growth curve was drawn. When the tumor volume reached 1000 cm3, the mice were determined to be dead, and the survival curve of the mice was drawn.

[0121] 2-5) LLC lung cancer mouse model: LLC cells (5 x 10 5 The tumor size was measured every 2-3 days, and the tumor growth curve was drawn. When the tumor volume reached 1000 cm3, the mice were determined to be dead, and the survival curve of the mice was drawn. 3 The tumor size was measured every 2-3 days, and the tumor growth curve was drawn. When the tumor volume reached 1000 cm3, the mice were determined to be dead, and the survival curve of the mice was drawn.

[0122] Results:

[0123] CD300LD knockout mice were constructed, and CD300LD was knocked out at the genomic level and the protein level Figure 2 A-C) Using the B16-F10 melanoma model, it was found that in CD300LD knockout mice, the tumor growth was significantly lower than that in wild-type mice Figure 2 D and E), and the survival time of the mice was significantly prolonged Figure 2 F) In other three tumor models such as TC-1 cervical cancer, MC-38 colon cancer, LLC lung cancer, the tumor growth of CD300LD knockout mice was significantly lower than that of wild-type mice Figure 2 G-I). The above results show that knocking out host CD300LD can significantly inhibit the development of multiple types of tumors.

[0124] Example 3 CD300LD knockout inhibits the development of tumors through PMN-MDSC

[0125] CD300LD knockout mice can significantly inhibit the development of various types of tumors, therefore, it is extremely crucial to determine which group of cells CD300LD plays a role in. The main cell population expressing CD300LD is myeloid immune cells, including macrophages, M-MDSC and PMN-MDSC; among them, the expression of CD300LD on PMN-MDSC is much higher than that on other types of cells Figure 1 D and E). Therefore, this example analyzes which type of myeloid cells CD300LD is knocked out to inhibit tumor development.

[0126] Materials and methods:

[0127] 3-1) Effect of conditional knockout of CD300LD in different cell populations on tumor development: CD300LD fl / fl conditional knockout mice were constructed (constructed by a third-party company, Jixie Pharmaceutical Company; gRNA1 sequence as shown in SEQ ID NO. 12, gRNA2 sequence as shown in SEQ ID NO. 13), and the mice were mated with different Cre mice, including LyzCre (macrophages, neutrophils / PMN-MDSC, and other myeloid cell-specific Cre expression) and S100A8Cre (neutrophils / PMN-MDSC-specific Cre), thereby obtaining mice with conditional knockout of CD300LD in different types of myeloid cells. B16-F10 tumor experiments were performed using the above mice to detect tumor growth (see steps in Example 2, 2-2).

[0128] 3-2) Effect of PMN-MDSC depletion on tumor development using Ly6G antibody: B16-F10 tumor cells were inoculated subcutaneously in mice, and Ly6G antibody or isotype control antibody (200 μg / mouse / time) was injected on days 7, 9, 11, and 13 after inoculation to detect tumor growth.

[0129] 3-3) Detection of the effect of co-transplantation of different myeloid cells and tumor cells on tumor growth: Macrophages, M-MDSC and PMN-MDSC cells were isolated from WT or CD300LD-KO tumor-bearing mice, mixed with B16-F10 cells at a ratio of 1:1, and then inoculated subcutaneously in wild-type mice for tumor formation experiments to detect tumor growth.

[0130] Results:

[0131] The results show that conditional knockout of CD300LD in various myeloid cells (including macrophages / neutrophils / PMN-MDSC) using LyzCre significantly inhibits the development of B16 tumors Figure 3 A); conditional knockout of CD300LD in PMN-MDSC using the more specific S100A8Cre also significantly inhibits tumor developmentFigure 3 B); indicating that CD300LD expressed by PMN-MDSC plays an important role in tumor development.

[0132] To further demonstrate the role of CD300LD in tumor through PMN-MDSC, this example used Ly6G antibody to deplete neutrophils / PMN-MDSC in wild-type and CD300LD-KO tumor mice, and the results showed that the development of tumors in wild-type mice was significantly slowed down, while in CD300LD-KO mice, Ly6G antibody had no effect Figure 3 C), indicating that the anti-tumor effect caused by CD300LD knockout is mainly completed through neutrophils / PMN-MDSC.

[0133] To further demonstrate that CD300LD regulates tumor development through PMN-MDSC, macrophages, M-MDSC and PMN-MDSC cells were isolated from CD300LD WT and KO tumor-bearing mice, and then the effect of different cell populations on tumor development was analyzed by co-injection. The results showed that only CD300LD-KO PMN-MDSC significantly inhibited tumor development Figure 3 D-F).

[0134] In summary, CD300LD mainly plays an important role in tumor development through PMN-MDSC cells.

[0135] Example 4 CD300LD knockout reverses tumor immunosuppressive microenvironment

[0136] To study how CD300LD knockout inhibits tumor development, this example analyzed the changes of various immune cell populations in the tumor microenvironment of WT and CD300LD knockout mice by flow cytometry and immunohistochemical analysis, and further single-cell sequencing analysis of immune cells in the tumor microenvironment was performed.

[0137] Materials and methods:

[0138] 4-1) B16-F10 melanoma mouse model: B16-F10 cells (1.5 x 10 5 Cells / mouse) were inoculated subcutaneously in mice, and the size of the tumor was measured every 2-3 days.

[0139] 4-2) Tumor microenvironment analysis: Prepare single cell suspension from mouse tumor, use the following two groups of antibodies for labeling: Antibody group 1 (Anti-Ly6C FITC, Anti-MHCII PE, Anti-F4 / 80 PE-Cy7, Anti-Cd11b PB, Anti-CD45 BV510, Anti-Cd11c APC, Anti-Ly6G APC-Cy7) and antibody group 2 (Anti-CD3 FITC, Anti-CD8 PE, Anti-B220 PE-Cy7, Anti-CD45 BV510, Anti-CD49b APC, Anti-CD4 APC-Cy7), analyze the proportion of each immune cell population by flow cytometry.

[0140] 4-3) Immunofluorescence: Isolate mouse tumor for frozen section, use CD8-FITC antibody or Ly6G-PE antibody to stain at 4 degrees overnight, wash 3 times, mount with DAPI containing mounting fluid, and observe under a fluorescence microscope.

[0141] 4-4) Single cell sequencing of tumor immune microenvironment: Prepare single cell suspension from B16 tumor mouse tumor tissue, flow sort CD45+ immune cells, perform 10x single cell sequencing, use Sereut for dimensionality reduction, clustering and other analysis

[0142] Results:

[0143] Results are shown in Figure 4 Compared with the tumor microenvironment of WT mice, CD300LD knockout led to a significant increase in infiltrating immune cells in the tumor microenvironment, a significant decrease in PMN-MDSC cells, accompanied by a significant increase in CD4 + and CD8 + T cells, and a significant decrease in Treg cells Figure 4 A and B). Immunofluorescence results also showed that in the tumor of CD300LD knockout mice, PMN-MDSC was significantly reduced, CD8 + T cells were significantly increased Figure 4 C and D).

[0144] This example further analyzes the effect of CD300LD knockout on the tumor immune microenvironment from the single cell transcriptome level. The results also show that CD300LD knockout leads to a significant decrease in PMN-MDSC in the tumor microenvironment and a significant increase in the infiltration of CD8 + T cells Figure 5A-C). Meanwhile, the expression of multiple important genes related to immune was significantly decreased in PMN-MDSC, such as S100a8, S100a9, Cxcr2, Cxcl2, Cxcl3, etc.; while the expression of multiple important genes related to T cell killing function was significantly increased, such as Gzma, Gzmb, Ifng, Prf1 and Klrk1, etc.; the expression of genes related to T cell recruitment was also significantly increased, such as Cxcl10, Cxcl9, Ccl5 and H2-Ab1, etc. Figure 5 D).

[0145] The above results prove that CD300LD knockout leads to a significant decrease in the population of immune suppressor cells PMN-MDSC in the tumor microenvironment, and a significant increase in immune effector T cells, indicating that CD300LD knockout significantly improves the immunosuppressive microenvironment in the tumor.

[0146] Example 5 CD300LD knockout inhibits the migration and function of PMN-MDSC

[0147] Since CD300LD knockout inhibits the development of tumors by regulating PMN-MDSC, and the population of PMN-MDSC in the tumor microenvironment after knockout is dramatically reduced, this embodiment further verifies whether CD300LD knockout affects the migration process of PMN-MDSC. At the same time, as an immune suppressor cell, the significant role of PMN-MDSC is to inhibit the activity of T cells, so this embodiment will also analyze whether CD300LD knockout affects the immune suppression function of PMN-MDSC.

[0148] Materials and methods:

[0149] 5-1) RNAseq: Isolate the spleen of WT and CD300LD-KO B16 tumor-bearing mice, prepare a single cell suspension and perform antibody labeling, flow sort PMN-MDSC cells (CD45+ / CD11b+ / Ly6G+), extract total RNA from the cells, reverse transcribe into cDNA, and then perform transcriptome sequencing and analysis.

[0150] 5-2) PMN-MDSC in vitro cell migration experiment (Transwell): Isolate tumor-bearing mouse spleen to prepare a single cell suspension and perform antibody labeling, flow sort PMN-MDSC cells (CD45+ / CD11b+ / Ly6G+). Use Transwell wells, add 10 5 PMN-MDSC cells to the upper layer and place in a 37°C incubator for 2 hr, flow cytometry to analyze the number of PMN-MDSC cells in the lower layer, and calculate the migration ratio of the cells.

[0151] 5-3) PMN-MDSC in vivo cell migration experiment: Isolation of B16 tumor-bearing mouse spleen to prepare single cell suspension and antibody labeling, flow sorting of PMN-MDSC cells (CD45+ / CD11b+ / Ly6G+). Using CTV staining, WT PMN-MDSC and CD300LD-KO PMN-MDSC were stained as high CTV and low CTV markers, respectively. Mix WT / KO PMN-MDSC at a ratio of 1:1, and intravenously inject into tumor-bearing WT mice. After 24 hours, isolate mouse bone marrow, spleen and tumor, and analyze the proportion of WT and CD300LD-KO PMN-MDSC by flow cytometry.

[0152] 5-4) T cell proliferation experiment: Isolation of OT-1 mouse spleen, preparation of single cell suspension in PBS (5x10 7 Cells / ml), addition of CTV dye at a final concentration of 5μM, incubation in a 37°C water bath for 20 minutes, addition of 5 times the volume of ice-precooled RPMI medium (RPMI-1640+10% FBS), inversion and mixing, followed by room temperature standing for 5 minutes, 400g centrifugation for 5 minutes, and resuspension of the cells in RPMI medium (1x10 6 Cells / ml). Take 80μl of CTV-labeled cells, add 40μl of OVA peptide segment at a concentration of 100ng / ml, and supplement with 80ul of RPMI medium, and add to 96-well U-bottom plate wells, and incubate in a 37°C carbon dioxide incubator. After 48-72 hours, antibody labeling and flow cytometry analysis are performed

[0153] 5-5) PMN-MDSC inhibits T cell proliferation experiment: Isolation of B16 tumor-bearing mouse spleen to prepare single cell suspension and antibody labeling, flow sorting to obtain PMN-MDSC cells (CD45 + / CD11b + / Lying6G + ), resuspension in RPMI medium (1x10 6 Cells / ml). Take 80μl of CTV-labeled cells in 8-1), add 40ul of OVA peptide segment at a concentration of 100ng / ml, and PMN-MDSC cells, medium, and add to 96-well U-bottom plate wells, and incubate in a 37°C carbon dioxide incubator. After 48-72 hours, antibody labeling and flow cytometry analysis are performed. In the above T cell proliferation experiment, different proportions of PMN-MDSC cells are added, and after 48-72 hours, antibody labeling and flow cytometry analysis are performed

[0154] Results:

[0155] This embodiment performed RNA-seq analysis on PMN-MDSCs of CD300LD WT and KO. The results showed that CD300LD knockout significantly downregulated neutrophil migration-related signaling pathways. Figure 6 A and B). In vitro cell migration experiments demonstrated that the migration ability of CD300LD-KO PMN-MDSC was significantly lower than that of WT PMN-MDSC. Figure 6 C). CD300LD WT and KO PMN-MDSC were mixed at a 1:1 ratio and injected into tumor-bearing mice for migration competition experiments. The results showed that WT PMN-MDSC recruited from tumors was significantly higher than CD300LD-KO PMN-MDSC. Figure 6 The above results indicate that CD300LD knockout inhibits the migration ability of PMN-MDSCs, leading to a significant reduction in tumor recruitment of PMN-MDSCs.

[0156] Further analysis was conducted on the effect of CD300LD on PMN-MDSC function. T cell proliferation assays showed that WT PMN-MDSC effectively inhibited T cell proliferation, a capacity significantly reduced in CD300LD-KO PMN-MDSC. Figure 6 The results (G and H) indicate that the T-cell suppressive function of PMN-MDSCs is positively regulated by CD300LD. These results also suggest that CD300LD knockout simultaneously inhibits the T-cell suppressive function of PMN-MDSCs.

[0157] Example 6: CD300LD regulates the migration and function of PMN-MDSC via S100A8 / A9

[0158] To investigate the molecular mechanism by which CD300LD regulates PMN-MDSCs, this study performed transcriptome sequencing on WT and KO PMN-MDSCs and analyzed significantly differentially expressed genes to investigate which downstream genes CD300LD regulates the cell migration and function of PMN-MDSCs.

[0159] Materials and Methods:

[0160] 6-1) PMN-MDSC in vitro cell migration assay (Transwell): Single-cell suspensions were prepared from the spleens of B16 tumor-bearing mice and labeled with antibodies. PMN-MDSC cells (CD45+ / CD11b+ / Lying6G+) were sorted by flow cytometry. Using Transwell wells, 10 μL of 10 ... 5PMN-MDSC cells were then cultured in a 37°C incubator with a final concentration of 1 μg / ml of S100A8 / A9 inhibitor (Tasquinimod) or DMSO control added to the culture medium. After 2 hours, the number of PMN-MDSC cells in the lower layer was analyzed by flow cytometry, and the cell migration rate was calculated.

[0161] 6-2) Tumor model: B16 cells (at a ratio of 1.5 × 10⁻⁶) 5 Tumor cells (cells / mouse) were subcutaneously inoculated into mice, and 20 μg Tasquinimod per mouse was injected intraperitoneally on day 2. Tumor size was measured every 2-3 days, and tumor growth curves were plotted. On day 19, mouse tumors were harvested, and the proportion of lost immune cells was analyzed.

[0162] result:

[0163] To further explore the molecular mechanism by which CD300LD regulates PMN-MDSCs, RNA-seq differential analysis was performed on PMN-MDSCs isolated from WT and KO mice. S100A8 / A9 was the most significantly downregulated gene in KO PMN-MDSCs. Figure 7 A), and has been reported to be associated with the function of PMN-MDSC. Serum S100A8 / A9 levels in WT tumor-bearing mice were significantly higher than in normal mice, while S100A8 / A9 levels in KO tumor-bearing mice were not significantly different from those in normal mice. Figure 7 B). Meanwhile, the expression levels of S100A8 and S100A9 in CD300LD-KO PMN-MDSC were significantly lower than those in WT PMN-MDSC. Figure 7 C). In vitro migration experiments demonstrated that the S100A8 / A9 protein can compensate for the weakened migration ability of KO PMN-MDSCs. Figure 7 D). T-cell suppression experiments showed that the S100A8 / A9 inhibitor significantly reduced the inhibitory effect on WT PMN-MDSCs, but had no significant effect on KO PMN-MDSCs. Figure 7 E). Further testing using tumor models showed that in vivo injection of the S100A8 / A9 inhibitor Tasquinimod inhibited tumor growth in WT mice, but could not further inhibit tumor growth in KO mice. The proportion of PMN-MDSCs within the tumor was also consistent with changes in the tumor. Figure 7 (F and G). The above results demonstrate that CD300LD regulates the migration and function of PMN-MDSCs through S100A8 / A9, and S100A8 / A9 are important downstream effector molecules of CD300LD.

[0164] Example 7: CD300LD knockout and PD1 antibody exhibit significant anti-tumor synergistic effect.

[0165] Since CD300LD is mainly expressed on myeloid PMN-MDSC cells, while PD1 is mainly expressed on T cells, theoretically these two targets should have a synergistic effect in anti-tumor efficacy. Therefore, this embodiment analyzes the anti-tumor effect of CD300LD knockout combined with PD1 antibody.

[0166] Materials and Methods:

[0167] 7-1) Expression analysis of PD1 and its ligand PD-L1: Single-cell suspensions were prepared by isolating tumor cells from B16 mice, and PD1 and PD-L1 antibodies were used for staining. The expression of PD1 and PD-L1 on the surface of tumor cells and immune cells was analyzed by flow cytometry.

[0168] 7-2) Tumor model: B16-F10 cells (at a ratio of 1.5 × 10⁻⁶) were used. 5 Cells / mouse were subcutaneously inoculated into WT and CD300LD KO mice. On day 7 post-inoculation, PD1 antibody, 200 μg / mouse, was intravenously injected three times. Tumor size was measured every 2-3 days to plot tumor growth curves.

[0169] result:

[0170] Flow cytometry analysis showed that, compared with WT mice, PD1 was found in the tumors of KO mice. + CD8 + The proportion of T cells increased, and the expression rate of PD-L1 was also increased in tumor cells and PMN-MDSC cells. Figure 8 A) further suggests that this target will have a synergistic effect with PD1. We tested the efficacy of PD1 antibody in B16-F10 tumor models in WT and CD300LD-KO mice. The results showed that PD-1 antibody treatment alone in WT mice was as effective as in CD300LD-KO mice, both significantly inhibiting tumor development. In the context of CD300LD-KO, PD-1 antibody could further inhibit tumor development and prolong the survival time of mice. Figure 8 (B and C). The above results demonstrate that CD300LD knockout and PD-1 immune checkpoint have a significant synergistic anti-tumor effect.

[0171] Example 8: CD300LD knockout does not affect normal development in mice.

[0172] To explore the potential systemic risks of targeting CD300LD, this embodiment analyzes the impact of CD300LD knockout on organismal development and conducts a preliminary assessment of the safety of the CD300LD target.

[0173] Materials and Methods:

[0174] 8-1) Immune cell population analysis: Isolation of mouse bone marrow, spleen and peripheral blood, preparation of single cell suspension, analysis of the proportion of different immune cell populations by flow cytometry antibody, including T cells (CD3 + ), B cells (B220 + ), myeloid cells (CD11b (Mac1) + ), granulocytes (CD11b + Gr1 + ); LSK hematopoietic precursor cells (Lin - Sca1 + cKit + ), LT-HSC (Lin - Sca1 + cKit + CD34 - Flt3 - ), MMP (Lin - Sca1 + cKit + CD34 + Flt3 + ), GMP (Lin - cKit + Sca1 - CD34 High FcyR High ), CMP (Lin - cKit + Sca1 - CD34 High FcyR Mid ), MEP (Lin - cKit + Sca1 - CD34 Low FcyR Low ), CLP (Lin - cKit Mid Sca1 Mid Flt3 High IL7R High ). Preparation of single cell suspension of tumor, staining with PD1 antibody and PD-L1 antibody, flow cytometry analysis of PD1 and PD-L1 expression on tumor cells and immune cells.

[0175] 8-2) CFU experiment: Isolation of mouse bone marrow, preparation of single cell suspension, taking 10 5Cell culture in cellulose semi-solid medium (MethoCult GF M3434, Stem Cell Company), after 7 days of culture, BFU-E, CFU-GM, CFU-GEMM clones were counted under microscope; or bone marrow cells were cultured in cellulose semi-solid medium (MethoCult GF M3630, Stem Cell Company), after 7 days of culture, Pre-B clones were counted under microscope.

[0176] Results:

[0177] CD300LD KO and WT mice grow normally, and no visible behavioral abnormalities. Flow cytometry results show that the proportion of T cells, B cells and myeloid cells in the immune and hematopoietic organs of KO and WT mice is not significantly different (A); there is no significant difference in long-term and short-term hematopoietic stem cells (LT-HSC, ST-HSC), multipotent hematopoietic progenitor cells (MPP) (B, C); other precursor cells, including myeloid precursor cells CMP, GMP, MEP, and lymphoid precursor cells CLP, are also not significantly different (B, C). Further analysis of the clonogenic ability of hematopoietic stem cells in KO and WT mice showed no significant difference (D). The above results show that the knockout of CD300LD does not affect the normal development of mice and the development of the hematopoietic / immune system, and targeting CD300LD will have certain safety. Figure 9 Figure 9 Figure 9

[0178] Example 9 CD300LD knockout inhibits the development of established tumors

[0179] This example further analyzes whether the induction of CD300LD knockout can inhibit the development of tumors in the case of established tumors.

[0180] Materials and methods:

[0181] Tumor model for inducing CD300LD knockout: CD300LD fl / fl Mx1CRE mice were inoculated with B16 cells (1.5 x 10 5 cells / mouse) subcutaneously, and on the 7th day after inoculation, PolyIC was injected to induce gene knockout, once every 2 days, a total of 4 times. The size of the tumor was measured every 2-3 days, and the tumor growth curve was drawn.

[0182] Results:

[0183] Tumor model for inducing CD300LD knockout: CD300LD fl / fl Mice were mated with Mx1CRE mice to obtain CD300LD fl / fl ​​​Mx1CRE mice were used to knock out CD300LD under PolyIC induction. These mice were then used to inoculate B16-F10 cells subcutaneously to induce tumor formation, which was achieved when the tumors reached approximately 100 mm in size. 3 PolyIC treatment was performed. Results showed that induced knockout of CD300LD significantly inhibited the development of established tumors. Figure 9 A), while there was no difference in tumor growth between the two groups of mice that did not receive the drug ( Figure 9 B). The above results indicate that inducing CD300LD knockout can significantly inhibit tumor development in the established tumor stage, which further suggests that CD300LD can serve as an effective target for tumor immunotherapy.

[0184] The above embodiments are for illustrating the implementation schemes disclosed in this invention and should not be construed as limiting the invention. Furthermore, various modifications and variations of the methods listed herein will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been specifically described in conjunction with various specific preferred embodiments, it should be understood that the invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of this invention. sequence list <110> Fudan University Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences <120> Use of CD300LD inhibitors in the preparation of products for the prevention, diagnosis, or treatment of cancer. <160> 13 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> Artificial Sequence <400> 1 acattgacca agccccaaaa a 21 <210> 2 <211> twenty one <212> DNA <213> Artificial Sequence <400> 2 agcaggggta actccacaaa g 21 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <400> 3 gtctacatgt tccagtatga ctcc 24 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <400> 4 agtgagttgt catatttctc gtggt 25 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 tcccaggtta ctccattgcc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 gcctgagcca taagcacact 20 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <400> 7 tgtgggcatc aatggatttg g 21 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <400> 8 acaccatgta ttccgggtca at 22 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <400> 9 actgctggaa tgaccaatag 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <400> 10 gtttctgcat atggtacacc 20 <210> 11 <211> 342 <212> DNA <213> Artificial Sequence <400> 11 gctgctgcac ggctcaggat tcagtcacag gtccagagga ggtgagcggt caggagcagg 60 gctccttgac agtgcagtgc agatattcct catactggaa gggttacaag aagtactggt 120 gccgaggagt tcctcagaga tcatgtgata ttcttgttga aaccgataaa tcagagcagc 180 tggtgaagaa gaaccgtgtg tccatcaggg acaaccagag agacttcatc ttcacagtga 240 ccatggagga tctgaggatg agcgatgctg gcatttactg gtgtggaatt acgaaaggtg 300 gacctgatcc catgtttaaa gttaatgtga acattgacca ag 342 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <400> 12 ctcagattcc acggatctga 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <400> 13 ctgtggcatt cgtgtcactt 20

Claims

1. The use of CD300LD inhibitors in the preparation of drugs for treating tumors, characterized in that, The tumor is a tumor that overexpresses CD300LD, and the CD300LD inhibitor is a reagent used to inhibit CD300LD in PMN-MDSC myeloid cells; the tumor is melanoma, cervical cancer, colon cancer, or lung cancer; the CD300LD inhibitor treats the tumor by regulating the activity and / or migration of myeloid cells, wherein the myeloid cells are PMN-MDSC; or by regulating T cell activity; or by regulating downstream signaling pathways of CD300LD; the CD300LD inhibitor is a nucleic acid molecule, the sequence of which is shown in SEQ ID NO. 9 and SEQ ID NO. 10; or, the sequence of which is shown in SEQ ID NO. 12 and SEQ ID NO.

13.

2. The use according to claim 1, characterized in that, The target of the CD300LD inhibitor is CD300LDExon2.

3. The use according to claim 1, characterized in that, The regulation of myeloid cell activity is selected from reducing the number of myeloid cells or decreasing the expression of immunosuppressive genes on myeloid cells.

4. The use according to claim 1, characterized in that, Regulation of T cell activity is selected from one or more of the following: Add CD4 + and CD8 + The number of T cells; the number of Treg cells; the expression of genes related to T cell killing function; and the expression of genes related to T cell recruitment.

5. The use according to claim 1, characterized in that, Regulation of downstream signaling pathways of CD300LD includes regulation of the S100A8 / A9 gene in the CD300LD downstream signaling pathway.

6. The use of the CD300LD inhibitor and PD1 inhibitor as described in claim 1 in the preparation of a tumor therapeutic drug, wherein the tumor is a CD300LD overexpressing tumor, the tumor is melanoma, cervical cancer, colon cancer, or lung cancer, and the target of the tumor therapeutic drug is PD1 and the CD300LD gene in myeloid PMN-MDSC cells.

Citation Information

Patent Citations

  • Methods for selecting antibodies that specifically bind glycosylated immune checkpoint proteins

    CN109071636A

  • Activity modulator, medicinal agent comprising same, use of CD300a gene-deficient mouse, and Anti-CD300a antibody

    US20150047059A1