A biological factor and its application in drugs for protecting auditory hair cells from damage

By expressing PLCβ3 biological factors in inner ear support cells, it promotes its differentiation into hair cells, solving the problem of auditory hair cell damage, achieving the protective effect of various damage factors, and providing a scientific basis for the recovery of auditory function.

CN116144627BActive Publication Date: 2025-08-19NANTONG UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310155486.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-23
Publication Date
2025-08-19
Estimated Expiration
2043-02-23

AI Technical Summary

Technical Problem

The prior art is difficult to effectively protect auditory hair cells from damage caused by factors such as noise, platinum compounds and aminoglycoside antibiotics, resulting in irreversible hearing impairment.

Method used

The phospholipase C (PLC) family subtype PLCβ3 biological factor is used to promote its differentiation into hair cells by expressing it in inner ear support cells, protecting hair cells from damage.

Benefits of technology

In damage models such as noise, cisplatin and neomycin, PLCβ3 can effectively promote the differentiation of inner ear support cells into hair cells, protect hair cells, and provide a scientific basis for auditory function recovery.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116144627B_ABST
    Figure CN116144627B_ABST
Patent Text Reader

Abstract

This application discloses a biological factor and its use in a drug for protecting auditory hair cells from damage, belonging to the field of biological inner ear research. The biological factor is a phospholipase C (PLC) family subtype PLCβ3, which has the effect of protecting auditory hair cells from damage by noise, platinum-based chemotherapy drugs, and aminoglycoside antibiotics. The amino acid sequence of the biological factor PLCβ3 in humans, mice, and zebrafish is shown as SEQ NOs.1, 2, and 3, and the nucleotide sequence in humans, mice, and zebrafish is shown as SEQ NOs.4, 5, and 6. This is the first time that the biological factor PLCβ3 has been discovered in the inner ear to have a protective effect on hair cells. This invention lays an important foundation for subsequent research on hair cell pre-protection and hair cell regeneration in mammals.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biological inner ear technology, and particularly relates to a biological factor and its application in a drug for protecting auditory hair cells from damage. Background Art

[0002] Hearing impairment, a common disease, is primarily caused by damage to auditory hair cells. The irreversibility of damaged hair cells in mammals also makes hearing impairment irreversible. Currently, the main treatment for hearing impairment is to use hearing aids or cochlear implants to help patients regain some hearing function. However, this only treats the symptoms, not the root cause. Furthermore, cochlear implant surgery is difficult and expensive, and the effectiveness varies from person to person. Therefore, research on how to promote the regeneration of inner ear hair cells plays an important role in treating hearing impairment caused by hair cell damage and holds great scientific promise. Many researchers have studied hair cell regeneration, but the results have been suboptimal. Furthermore, determining whether regenerated hair cells retain normal hearing function is even more challenging. The regeneration process of inner ear hair cells is extremely complex, likely the result of the interaction of multiple genes and signaling pathways. This complex process is highly unknown and requires a high level of research depth, requiring a long time to fully explore.

[0003] PLCβ3 is a subtype of phospholipase C and a key enzyme in the phosphatidylinositol signaling pathway, which uses G proteins as transmitters. However, the role of this biological factor in the inner ear has not been reported. Summary of the Invention

[0004] Technical issues solved:

[0005] This application addresses the deficiencies of the existing technology and solves technical problems such as the current deficiencies in the treatment of auditory hair cell damage. It provides a biological factor and its application in drugs to protect auditory hair cells from damage, protecting hair cells from damage caused by noise, platinum compounds, and aminoglycoside antibiotics, and has good market prospects.

[0006] Technical solution:

[0007] To achieve the above objectives, this application is implemented through the following technical solutions:

[0008] A biological factor, which is phospholipase C (PLC) family subtype PLCβ3, and the amino acid sequence is shown in SEQ NO.1, NO.2 or NO.3.

[0009] Furthermore, the SEQ NO.1, NO.2, and NO.3 are the amino acid sequences of the biological factor in humans, mice, and zebrafish, respectively; wherein the protein amino acid sequence of the biological factor PLCβ3 in humans is SEQ NO.1:

[0010]

[0011] The amino acid sequence of the biological factor PLCβ3 protein in mice is SEQ NO.2:

[0012]

[0013] The amino acid sequence of the biological factor PLCβ3 in zebrafish is SEQ NO.3:

[0014]

[0015] Furthermore, the biological factor has the activity of promoting the proliferation and differentiation of inner ear stem cells into hair cells, and can protect hair cells from damage caused by noise, platinum compounds, and aminoglycoside antibiotics.

[0016] Furthermore, the platinum compound is cisplatin.

[0017] Furthermore, the aminoglycoside antibiotic is neomycin.

[0018] A nucleic acid molecule encoding a nucleotide sequence of phospholipase C (PLC) family subtype PLCβ3, the nucleotide sequence of which is as shown in SEQ NO.4,

[0019] As shown in NO.5 or NO.6.

[0020] Furthermore, the nucleotide sequence encoding human PLCβ3 protein is SEQ NO.4:

[0021]

[0022] CCAAGCTGCTGGCCCAGCTGGCCC

[0023] AGGAGTGTCAGGAGCAGCGGGCGAGGCTCCCCCAGGAGATCCGCCGGAGCCTGCTGGGCGAGATGCCGGAGGGGCTGGGGGACGGGCCTCTGGTGGCCTGTGCCAGCAACGGTCACGCACCCGGGAGCAGCGGGCACCTGTCGGGCGCTGACTCGGAGAGCCAGGAGGAGAACACGCAGCTCTGA

[0024] Nucleotide sequence encoding mouse PLCβ3 protein SEQ NO.5:

[0025]

[0026] Nucleotide sequence encoding zebrafish PLCβ3 protein SEQ NO.6

[0027]

[0028] The present application also discloses the use of biological factors in drugs for protecting auditory hair cells from damage.

[0029] A pharmaceutical composition containing the above-mentioned biological factor.

[0030] The principle of the above-mentioned biological factor and its application in drugs for protecting auditory hair cells from damage is that PLCβ3 is expressed in inner ear supporting cells and can promote the transdifferentiation of supporting cells into hair cells, thereby protecting hair cells from damage.

[0031] Beneficial effects:

[0032] This application provides a biological factor and its use in a drug for protecting auditory hair cells from damage. Compared with the existing technology, it has the following beneficial effects:

[0033] 1. By injecting PLCβ3 mRNA into zebrafish embryos and using noise, cisplatin, and neomycin to simulate zebrafish lateral line hair cell damage, it was finally found that under these hair cell damage models, PLCβ3 could promote the differentiation of inner ear supporting cells into hair cells and effectively protect inner ear hair cells from damage, which is something that conventional drug regulation cannot do.

[0034] 2. Currently, most international research on inner ear hair cell damage is limited to the regulation of damage caused by a certain factor. This application integrates multiple factors on the basis of existing research, including noise, platinum compounds such as cisplatin, and aminoglycoside compounds such as neomycin. It has both academic and theoretical innovation and depth, and provides a scientific theoretical basis for further promoting the regeneration of functional hair cells by inner ear stem cells.

[0035] 3. The research results obtained through in vivo animal experiments have great clinical application value and will lay an experimental foundation for the application of inner ear stem cells in clinical treatment to promote the regeneration of hair cells and thus restore auditory function. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of the zebrafish lateral line system structure; Figure A shows the distribution of neuromasts in the lateral line system of zebrafish larvae, with black dots representing neuromasts in the lateral line system of zebrafish larvae; Figure B shows the distribution of neuromasts in the lateral line system of adult zebrafish, with black dots representing neuromasts in the lateral line system of adult zebrafish; Figure C shows the structure of a single neuromast in the zebrafish lateral line system; Figure D shows two ways of hair cell regeneration in the zebrafish lateral line system;

[0037] Figure 2Figure 1 shows the immunofluorescence results of PLCβ3 protecting zebrafish lateral line hair cells from noise-induced damage. Figure A shows the experimental flow chart of noise-damaged zebrafish lateral line hair cells. Figure B shows the immunofluorescence results of GFP-labeled hair cells and SOX2-labeled supporting cells. Scale Bar = 10 μm. Figure C shows the statistical analysis of lateral line hair cells, and Figure D shows the number of supporting cells. ***P < 0.001, ****P < 0.0001.

[0038] Figure 3 Figure 1 shows the immunofluorescence results of PLCβ3 protecting zebrafish lateral line hair cells from cisplatin-induced damage. Figure A shows the experimental flow chart of cisplatin-induced damage to zebrafish lateral line hair cells. Figure B shows the immunofluorescence results of GFP-labeled hair cells and SOX2-labeled supporting cells. Scale Bar = 10 μm. Figure C shows the statistical results of lateral line hair cells, and Figure D shows the number of supporting cells. **P < 0.00, ****P < 0.0001.

[0039] Figure 4 Figure 1 shows the immunofluorescence results of PLCβ3 protecting zebrafish lateral line hair cells from neomycin-induced damage. Figure A shows the experimental flow chart of neomycin-induced damage to lateral line hair cells. Figure B shows the immunofluorescence results of GFP-labeled hair cells and SOX2-labeled supporting cells. Scale Bar = 10 μm. Figure C shows the statistical analysis of lateral line hair cells, and Figure D shows the number of supporting cells. ***P < 0.05, ****P < 0.0001.

[0040] Figure 5 Diagram of the PCR procedure for in vitro amplification of plcb3 mRNA.

[0041] Figure 6 Diagram of the single-cell injection model for this application. DETAILED DESCRIPTION

[0042] The following examples are provided to illustrate the present invention but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention.

[0043] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0044] In order to better study the role of PLCβ3 in protecting hair cells from damage, the present invention adopted the following experimental steps for verification.

[0045] Example 1:

[0046] A biological factor, the biological factor is phospholipase C (PLC) family subtype PLCβ3, and the amino acid sequence is shown in SEQ NO.1, NO.2 or NO.3; SEQ NO.1, NO.2, and NO.3 are the amino acid sequences of the biological factor in humans, mice, and zebrafish, respectively; the biological factor has the activity of promoting the proliferation and differentiation of inner ear stem cells into hair cells, and can protect hair cells from damage by noise, platinum compounds, and aminoglycoside antibiotics; the platinum compound is cisplatin; and the aminoglycoside antibiotic is neomycin.

[0047] A nucleic acid molecule encoding the nucleotide sequence of PLCβ3, the nucleotide sequence being shown as SEQ NO.4, NO.5 or NO.6; the nucleotide sequence SEQ NO.4, NO.5 or NO.6 are respectively the nucleotide sequence SEQ NO.4 encoding human PLCβ3 protein, the nucleotide sequence SEQ NO.5 encoding mouse PLCβ3 protein, and the nucleotide sequence SEQ NO.6 encoding zebrafish PLCβ3 protein.

[0048] The use of the biological factors in drugs to protect auditory hair cells from damage, the experimental reagent names and company product numbers are as described in Table 1, and the specific experimental verification includes the following steps:

[0049] Step 1: Synthesize plcb3 mRNA in vitro;

[0050] Step 2: Use microinjection technology to inject plcb3 mRNA at the one-cell stage;

[0051] Step 3: Use noise to construct a zebrafish lateral line system hair cell damage model;

[0052] Step 4: Use cisplatin to establish a zebrafish lateral line system hair cell injury model;

[0053] Step 5: Use neomycin to establish a zebrafish lateral line system hair cell damage model;

[0054] Step 6: Use immunofluorescence technology to explore the protective effect of plcb3 expression on hair cell damage in the lateral line system of zebrafish.

[0055] Table 1 Experimental reagent names and company product numbers

[0056]

[0057]

[0058] The specific steps of synthesizing plcb3 mRNA in vitro in the first step are as follows:

[0059] 1.1 RNA extraction from zebrafish embryos

[0060] 1) Zebrafish embryos at different times (24 hpf, 48 hpf, 72 hpf, 96 hpf, and 120 hpf) were collected into 1.5 mL EP tubes, with 15 embryos placed in each tube. 300 μL Trizol was added and the tubes were stored in a -80°C refrigerator.

[0061] 2) Remove the embryos from the refrigerator and thaw on ice. Use a handheld electric grinder to fully dissolve the embryonic tissue until no flocs are visible to the naked eye. Add 700 μL of Trizol and 200 μL of chloroform to each tube. Vortex thoroughly for 15 seconds and let stand at room temperature for 2 minutes.

[0062] 3) Centrifuge in a refrigerated centrifuge at 4°C, 12,000 rpm for 15 minutes. After centrifugation, carefully pipette 400 μL of the clear, transparent liquid into a new 1.5 mL centrifuge tube. Add an equal volume of isopropanol, mix thoroughly, and let stand for 5 minutes. Continue centrifugation at 4°C, 12,000 rpm for 10 minutes.

[0063] 4) After centrifugation, discard the supernatant, add 500 μL of 75% ethanol, and continue centrifugation at 4°C and 7500 rpm for 5 minutes. Repeat this step once.

[0064] 5) After centrifugation, discard the supernatant and allow the white precipitate to dry naturally until it becomes a white gel. Add 10 μL of ddH2O to each tube to fully dissolve the precipitate and then measure the concentration.

[0065] 1.2 Reverse transcription to obtain cDNA template

[0066] 1.2.1 Removal of genomic DNA template

[0067] The reaction system is as described in Table 2:

[0068] Table 2 Reaction system for removing genomic DNA template

[0069]

[0070] The reaction conditions are described in Table 3:

[0071] Table 3 Reaction conditions for removing genomic DNA template

[0072]

[0073]

[0074] 1.2.2 Reverse transcription

[0075] The reaction system is as described in Table 4:

[0076] Table 4 Reverse transcription reaction system

[0077]

[0078] The reaction conditions are described in Table 5:

[0079] Table 5 Reverse transcription reaction conditions

[0080]

[0081] 1.2.3 Determine the concentration of cDNA obtained by reverse transcription;

[0082] 1.3 In vitro synthesis of plcb3 mRNA

[0083] 1.3.1 Design of plcb3 mRNA primers

[0084] The primer design principle should include the entire coding region of the gene. The upstream primer should be in the 5' UTR region of plcb3, and the downstream primer should be in the 3' UTR region. At the same time, the 5' end of the upstream and downstream primers should be added with PCS2. + Corresponding restriction sites and corresponding protection bases;

[0085] Table 6 Primers for in vitro synthesis of plcb3 mRNA

[0086]

[0087] 1.3.2 In vitro PCR amplification

[0088] The PCR system and procedure are described in Table 7:

[0089] Table 7 In vitro amplification of plcb3 mRNA PCR program

[0090]

[0091]

[0092] In vitro amplification of plcb3 mRNA PCR procedure, as Figure 5 After amplification, the PCR product was used for the next experiment.

[0093] 1.3.3 PCR products and PCS2 + Plasmid double enzyme digestion

[0094] The enzyme digestion system is described in Table 8.

[0095] Table 8 Enzyme Digestion System

[0096]

[0097] 7℃ reaction for 2h; after enzyme digestion, PCS2 +The plasmid needs to be dephosphorylated. The dephosphorylation system is described in Table 9.

[0098] Table 9 Dephosphorylation System

[0099]

[0100] Incubate at 4°C for 30 min.

[0101] 1.3.4 Gel recovery of enzyme digestion products

[0102] After the enzyme digestion is completed, the target fragment is cut out by agarose gel electrophoresis under a UV gel excision instrument, and the target band is placed in a 1.5mL EP tube and weighed; 3 times the weight of the gel is added to the gel melting agent (Buffer DE-A) and dissolved at 75°C. After the gel is fully dissolved, half the volume of Buffer DE-A binding solution (Buffer DE-B) is added and mixed thoroughly; the mixture is transferred to a DNA preparation tube (placed in a 2mL centrifuge tube), centrifuged at 12000r / min for 1min, and the filtrate is discarded; the preparation tube is returned to the 2mL centrifuge tube, 500μL Buffer W1 is added, and the centrifuge is carried out at 12000r / min for 30s. The filtrate is discarded; the preparation tube is returned to the 2mL centrifuge tube, 700μL Buffer W2 is added, and the centrifuge is carried out at 12000r / min for 30s. The filtrate is discarded; the preparation tube is returned to the 2mL centrifuge tube again, and 700μL Buffer is added. W2, centrifuge at 12000 rpm for 30 seconds, discard the filtrate; return the preparation tube to the 2 mL centrifuge tube, without adding any liquid, centrifuge at 12000 rpm for 30 seconds, discard the filtrate; place the preparation tube in a new 1.5 mL centrifuge tube, add 20 μL of preheated ddH2O (preheated to 65°C), let it stand at room temperature for 3 minutes; centrifuge at 12000 rpm for 1 minute, and measure the concentration of the recovered target band;

[0103] 1.3.5 PCR digestion products and PCS2 + Connection, connection system as described in Table 10

[0104] Table 10 Connection system

[0105]

[0106] Ligation was carried out at 16°C overnight to obtain the ligation product used in the next step;

[0107] 1.3.6 Conversion and coating

[0108] Transformation: Remove E. coli from the -80°C freezer, add 5 μL of the ligation product to 50 μL of competent E. coli, incubate on ice for 30 minutes, heat shock in a 42°C water bath for 45 seconds, and then incubate on ice for another 2 minutes. Then, add 500 μL of LB medium to each tube and incubate at 37°C for 1.5 hours.

[0109] Spreading: Prepare LB solid medium plates containing AMP in advance, take out the bacterial solution after 37℃ incubation, aspirate 200μL of bacterial solution, and spread it evenly on the plate. Place it upright in a 37℃ incubator for 30 minutes, then turn it over and incubate it for 12-14 hours;

[0110] 1.3.7 Spot selection and testing:

[0111] The next day, white colonies were picked with a white pipette tip and placed in LB liquid medium containing AMP. Five colonies were picked from each plate and cultured at 37°C for 2 hours. Then 500 μL of the bacterial solution was aspirated and sent to the company for sequencing. Positive colonies were selected and amplified.

[0112] 1.3.8 Plasmid extraction

[0113] Take a 10ml EP tube, add 8ml LB, add 8μL ampicillin, then add 100μL of the selected bacterial solution, shake gently and shake at 37℃ overnight; after 12-16 hours, take 2mL of bacterial solution cultured overnight in LB medium, centrifuge at 12000r / min for 1min, and discard the supernatant; add 250μL Buffer S1, throw in a white pipette tip, and shake thoroughly until no bacteria precipitated at the bottom of the centrifuge tube can be seen; discard the white pipette tip, add 250μL Buffer S2, mix by inverting 7-8 times; add 350μL Buffer S3, invert 5-6 times, and centrifuge at 13000r / min for 10min; after centrifugation, aspirate the supernatant and transfer it to the preparation tube, put the preparation tube into a 2mL centrifuge tube, and centrifuge at 13000r / min for 1min; discard the filtrate and add 500μL Buffer Prepare the tube with W1 and centrifuge at 13,000 rpm for 1 minute. Discard the filtrate, add 700 μL of Buffer W2 to the tube, and centrifuge at 13,000 rpm for 1 minute. Discard the filtrate, add 700 μL of Buffer W2 to the tube again, and centrifuge at 13,000 rpm for 1 minute. Discard the filtrate. Finally, add no liquid to the tube and centrifuge at 13,000 rpm for 1 minute. Transfer the tube to a new 1.5 mL centrifuge tube, add 20 μL of preheated ddH2O (preheated to 65°C), let it stand at room temperature for 3 minutes, and centrifuge at 13,000 rpm for 1 minute before measuring the concentration.

[0114] 1.3.9 Plasmid single enzyme digestion

[0115] The NCBI online tool Blast sequence alignment was used, and ApaI was selected for linearization enzyme digestion. The enzyme digestion system is described in Table 11:

[0116] Table 11 Enzyme digestion system

[0117]

[0118] React at 25°C for 2 hours;

[0119] 1.3.10 In vitro transcription of plcb3 mRNA, the transcription system is as described in Table 12

[0120] Table 12 Transcription system

[0121]

[0122] Transcribe at 37°C for 2 h; add 2 μL DNase I and treat at 37°C for 15 min to degrade the DNA template; then purify;

[0123] 1.3.11 plcb3 mRNA purification

[0124] After transcription is completed, add 20 μL of LiCl and 100 μL of isopropanol to each tube and transfer to an RNase-free 1.5 mL centrifuge tube. Incubate at -20°C overnight. Pre-cool the tube in a low-temperature high-speed centrifuge. After incubation, centrifuge at 13,000 rpm for 30 min at 4°C. Discard the supernatant and a white precipitate will be visible to the naked eye. Add 1 mL of 80% ethanol and mix carefully by pipetting. Centrifuge at 13,000 rpm for 15 min at 4°C. Discard the supernatant and air dry until the white precipitate becomes a gel. Dissolve the precipitate in 20 μL of ddH2O and determine its concentration. Aspirate 0.5 μL for electrophoresis to detect the presence of bands. Store the remaining precipitate at -80°C.

[0125] 2. The second step uses microinjection technology to inject plcb3 mRNA at the one-cell stage, specifically injecting plcb3 mRNA into zebrafish embryos at the one-cell stage

[0126] 2.1 Microinjection Plate Preparation

[0127] Weigh 0.8 g of agar powder and add it to 50 mL of ddH2O. Heat in a microwave oven until fully dissolved, then cool to 60°C. Pour the mixture into a Petri dish and add a microinjection plate mold. Wait for it to solidify, carefully remove the mold, add ddH2O until the agar plate is submerged, and store.

[0128] 2.2 Microinjection

[0129] At 5:00 PM the day before microinjection, place the male and female fish separately in the hybridization tank, separate them with a baffle, add system water, and cover the lid. On the morning of the injection, remove the baffle in advance; wait 15 minutes until transparent embryos are visible at the bottom of the hybridization tank. Collect the embryos and observe their development under a stereomicroscope. When the embryos develop to the single-cell stage, use a pipette to aspirate them onto the injection plate. Use a needle to align the embryos under the microscope and then proceed with the injection. Figure 6 Diagram of the single-cell injection pattern shown;

[0130] 3. The third step uses noise to construct a zebrafish lateral line system hair cell noise damage model

[0131] Zebrafish embryos were injected with plcb3 mRNA (mRNA) at the one-cell stage and allowed to develop to 5 dpf. 5 dpf zebrafish larvae were collected and divided into four groups, including a control group, an mRNA group, a noise damage (ND) group, and an mRNA & ND group. Each group of zebrafish embryos was placed in a 24-well plate, with one larvae per well. The 24-well plate was suspended in a 22-cm stainless steel container, with approximately 1 cm of the bottom of the 24-well plate immersed in water. The plate was exposed to 40 kHz acoustic stimulation for 60 minutes. After the stimulation, the embryos were collected and fixed with 4% PFA for the next experiment.

[0132] 4. The fourth step uses cisplatin to establish a zebrafish lateral line system hair cell cisplatin injury model

[0133] Zebrafish embryos were injected with plcb3 mRNA (mRNA) at the one-cell stage and allowed to develop to 5 dpf. 5 dpf zebrafish larvae were collected and divided into four groups, including a control group, an mRNA group, a cisplatin (Cis) group, and an mRNA & Cis group, with 15 fish in each group. The larvae in the Cis and mRNA & Cis groups were treated with 500 μM cisplatin for 4 hours, while the other groups were treated with an equal volume of PTU culture medium. After 4 hours, Cis was removed and the larvae in each group were washed with PTU three times for 5 minutes each time. The larvae in each group were collected and fixed with 4% PFA for the next experiment.

[0134] 5. The fifth step uses neomycin to establish a zebrafish lateral line system hair cell neomycin injury model

[0135] Zebrafish embryos were injected with plcb3 mRNA (mRNA) at the one-cell stage and allowed to develop to 5 dpf. 5-dpf zebrafish larvae were collected and divided into four groups: a control group, an mRNA group, a neomycin (Neo) group, and an mRNA & Neo group, with 15 zebrafish in each group. The Neo and mRNA & Neo groups were treated with 300 μM Neo for 1 hour, while the other groups were treated with an equal volume of PTU. After 1 hour, Neo was removed and the larvae were washed with PTU three times for 5 minutes each time. The larvae in each group were collected and fixed with 4% PFA for the next experiment.

[0136] 6. The sixth step uses immunofluorescence technology to explore the protective effect of plcb3 expression on zebrafish lateral line system hair cell damage

[0137] 6.1 Detection of supporting cells in the lateral line system of zebrafish embryos

[0138] 1) Zebrafish larvae of the corresponding developmental stage were collected and fixed with 4% PFA at room temperature for 2 h or at 4°C overnight. After fixation, the PFA was discarded and the cells were washed three times with 0.5% PBST (Triton X-100), each for 10 min.

[0139] 2) Block with PBST containing 10% donkey serum at room temperature for 1 h;

[0140] 3) Add blocking solution containing SOX2 antibody and incubate overnight at 4°C;

[0141] 4) The next day, recover the primary antibody, which can be reused, and wash three times with PBST, each for 10 minutes.

[0142] 5) Add fluorescent secondary antibody, diluted in PBST, incubate at 37°C for 2 h, and wash three times with PBST, each time for 10 min;

[0143] 6) Confocal microscopy;

[0144] 6.2 Zebrafish lateral line hair cell detection

[0145] The experimental steps are the same as 6.1. The lateral line hair cells are detected by incubation with GFP antibody.

[0146] The above experimental results show that the injection of plcb3 mRNA alone will cause an increase in the number of hair cells in the zebrafish lateral line system, a decrease in the number of supporting cells, and promote the differentiation of supporting cells into hair cells; after the zebrafish larvae are treated with noise, cisplatin, and neomycin, the number of zebrafish lateral line hair cells and supporting cells will decrease; after the injection of plcb3 mRNA, the hair cell damage is induced by noise, cisplatin, and neomycin, and it is found that the number of hair cells in the zebrafish lateral line system does not decrease, which indicates that the injection of plcb3 mRNA can prevent the reduction in hair cell number caused by noise, cisplatin, and neomycin.

[0147] In summary, the biological factor of the present invention, namely the phospholipase C family subtype PLCβ3, has the activity of promoting the differentiation of inner ear supporting cells into hair cells, protecting the entire inner ear hair cells from damage caused by noise, platinum compounds such as cisplatin, and aminoglycoside compounds such as neomycin. This advantage is that the goal of promoting hair cell regeneration can be achieved by simply regulating the expression level of PLCβ3 in vivo without the need for additional drugs, which is beyond the reach of conventional drug regulation.

[0148] The above description is only a preferred specific embodiment of the present invention, and the protection scope of the present invention is not limited thereto. Any simple change or equivalent replacement of the technical solution that can be obviously obtained by any technician familiar with the technical field within the technical scope disclosed in the present invention falls within the protection scope of the present invention.

Claims

1. Use of a biological factor in the preparation of a drug for protecting auditory hair cells from damage by noise, cisplatin or neomycin, characterized in that: The biological factor is phospholipase C (PLC) family subtype PLCβ3, and the amino acid sequence is shown in SEQ NO.

3.

2. Use of the biological factor according to claim 1 in the preparation of a drug for protecting auditory hair cells from noise damage, cisplatin damage or neomycin damage, characterized in that: The SEQ NO. 3 is the amino acid sequence of the biological factor in zebrafish.

Citation Information

Patent Citations

  • Neuromodulating compositions and related therapeutic methods for the treatment of cancer by modulating an Anti-cancer immune response

    US20190240293A1