sgRNA specifically targeting the safe site H11 of cashmere goats and its application

Abstract

The present invention provides an sgRNA specifically targeting a cashmere goat safety site H11 and an application of site-directed knockout and site-directed integration of an EGFP gene mediated by a CRISPR / Cas9 system. The present invention first predicts the complete sequence of the H11 site (SEQIDNO.1) using a bioinformatics method, and then designs two sgRNAs (SEQIDNO.2 and 3) for the H11 site, and the DNA sequence of the sgRNA sequence transcribed is shown in SEQIDNO.4 or 5. A targeting vector based on the CRISPR / Cas9 system is constructed, and then the guiding efficiency of the sgRNA is verified by TA cloning sequencing, and a homologous integration EGFP gene vector is constructed at the same time, and finally the screened sgRNA (Cas9 / gRNA co-expression vector) and the homologous integration vector (H11-EGFP) are simultaneously transfected into cashmere goat fetal fibroblasts to obtain a cell line of the H11 site site-directed integration of the EGFP gene. The sgRNA of the present invention can specifically recognize the H11 site of cashmere goats, guide the Cas9 endonuclease to efficiently cut the site, and the targeting efficiency is above 50%, which can effectively reduce the off-target phenomenon in the CRISPR / Cas9 system, thereby reducing the mutation of non-target gene sequences caused by non-specific cutting. By constructing a Cas9 / gRNA expression vector, the specific modification (knockout or knock-in) of the H11 site can be achieved at the cell, embryo, or even individual level, thereby studying the expression of specific genes and providing technical support for the breeding of new breeds of goats.

Description

Technical Field

[0001] The present invention focuses on "sgRNA specifically targeting the cashmere goat safety site H11 and its application" and mainly involves the fields of bioinformatics and genetic engineering, including the prediction of the H11 site, the design of sgRNA, the construction of CRISPR / Cas9 vectors, cell transfection, TA cloning sequencing to detect the efficiency of sgRNA, the construction of homologous integration vectors, and the screening of positive cells.

[0002] H11 site, the H11 site is located on mouse chromosome 11 and was discovered by Simon Hippenmeyer in 2010. It is located between the EIF4ENIF1 and DRG1 genes and does not contain a promoter. Therefore, exogenous genes can be efficiently expressed using a specific promoter without affecting endogenous genes. The researchers found that homozygous knock-in mice at this site can develop and reproduce normally. Subsequently, the H11 site was identified and safety verified in pigs. The results showed that, like mice, inserting exogenous genes at this site does not affect the healthy growth of pigs.

[0003] Gene editing technology is a technology that performs sequence-specific modification on DNA in cells, mainly including the insertion, deletion, and replacement of DNA fragments. Precise genome editing based on programmed nucleases opens up the possibility of achieving the desired genome editing results in vitro and in vivo, and ensures its safe and rapid use in cross-biological genome engineering applications. Gene editing technologies mainly include zinc finger nucleases (ZFNs), TALENs, and CRISPR / Cas9. Studies have found that gene editing technology has great potential in improving animal production performance, disease resistance, and in treating human diseases and building disease models. ZFNs and TALENs need to be assembled through a series of cloning and subcloning steps, while CRISPR / Cas9 can be easily assembled in one cloning step. This difference makes the assembly of ZFNs and TALENs more time-consuming. Therefore, CRISPR / Cas9 technology as a means of gene editing makes the CRISPR / Cas system a powerful genome editing tool, whose structure includes the Cas9 gene, 3 functional genes, a leader sequence, and an intervening repeat sequence.

[0004] If we can identify the H11 site in the cashmere goat genome as a "safe site" for inserting exogenous genes during gene editing, and screen out an sgRNA sequence that can specifically target the H11 site and efficiently guide the Cas9 nuclease to perform targeted editing on the site, we can provide strong technical support for the preparation of gene-edited cashmere goats with site-specific integration of exogenous genes at the H11 site, promote the research and application of gene editing in cashmere goats, and promote the healthy development of the cashmere goat industry. Summary of the invention

[0005] The purpose of the present invention is to provide a sgRNA that specifically targets the cashmere goat safety site H11 with high targeting efficiency and low off-target rate and an application thereof.

[0006] The present invention firstly determines that the safety site H11 is located on chromosome 17 of goats, and retrieves its nucleotide sequence from NCBI, as shown in SEQ ID NO.1.

[0007] The present invention provides a sgRNA specifically targeting the cashmere goat safety site H11, and its RNA sequence is shown in SEQ ID NO.2 or SEQ ID NO.3. Specifically, the DNA sequence of the sgRNA is shown in SEQ ID NO.4 (transcription SEQ ID NO.2) or SEQ ID NO.5 (transcription SEQ ID NO.3).

[0008] The present invention provides a CRISPR / Cas9 targeting vector, which contains a fluorescent screening marker EGFP and a drug screening marker Puro. With the help of these two screening markers, more positive cells can be enriched in a short time.

[0009] The present invention has found through a large number of preliminary experiments that the electrotransfection has the highest transfection efficiency when the condition of 250V-2.5ms is used. Therefore, this transfection condition is used for the experiment.

[0010] In the present invention, in order to avoid the false positive results that may occur when using T7E1 and Surveyor enzyme digestion, a direct TA cloning sequencing method is used when detecting the targeting efficiency.

[0011] The present invention provides the use of the sgRNA or a CRISPR / Cas9 targeting vector containing the sgRNA and a homologous integration vector in specific identification and targeted modification of a cashmere goat safety site H11, wherein the targeted modification includes gene knockout, site-specific integration of exogenous genes, or site-specific overexpression of endogenous genes.

[0012] The present invention provides the use of the sgRNA or a CRISPR / Cas9 targeting vector and a homologous integration vector containing the sgRNA in preparing transgenic animals or improving the production performance and disease resistance of livestock.

[0013] The present invention provides the use of the sgRNA or a CRISPR / Cas9 targeting vector and a homologous integration vector containing the sgRNA in breeding a new variety of gene-edited cashmere goats.

[0014] This invention application screened out sgRNA sequences that can specifically target the H11 site and efficiently guide the Cas9 nuclease to target and cut the site. The targeting efficiency is above 50%, which can effectively reduce the off-target situation caused by the low specificity of sgRNA. While improving the safety of gene editing, it also reduces the gene mutations at non-target sites caused by non-specific cutting, which provides a new and safe option for the insertion of exogenous genes. CRISPR / Cas9 gene editing technology can efficiently produce gene-edited cashmere goats, but the insertion of exogenous genes may directly affect the structure or function of endogenous genes. If a site can be found in the genome, it can efficiently express exogenous genes without affecting the normal expression of endogenous genes. It will be a perfect way to overcome the risks brought by gene editing. Such sites are also called "safe sites". The sgRNA specifically targeting the cashmere goat safety site H11 provided in this application combined with the CRISPR / Cas9 system can be used to knock out the target gene at a fixed point, and can also be used to overexpress exogenous or endogenous genes at a fixed point, providing a feasible method and approach for the study of important gene functions of livestock, and promoting the research and development of the livestock industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 The location of the H11 locus in chromosomes of different species. A, B, C, D, E, and F represent mice, humans, pigs, sheep, rabbits, and goats, respectively.

[0016] Figure 2 Homology comparison results of “H11 locus and surrounding sequences” of various species and “H11 locus and surrounding sequences” of goat.

[0017] Figure 3 The specific location of the predicted goat H11 locus.

[0018] Figure 4 Schematic diagram of Cas9 / gRNA co-expression vector.

[0019] Figure 5 Cell electroporation effect diagram.

[0020] Figure 6 Semi-quantitative analysis results of fluorescence intensity (ImageJ).

[0021] Figure 7 Positive cell enrichment effect diagram.

[0022] Figure 8 Electrophoresis results of target PCR amplification products.

[0023] Fig. 9 H11-sgRNA1 / 2 mutation efficiency results.

[0024] Figure 10 Sequencing comparison results of PCR products of five potential off-target sites and wild-type PCR products. A, B, C, D, and E represent the comparison results of Chr7-1, Chr7-2, Chr15, Chr18, and Chr20 sites, respectively.

[0025] Fig.11 Electrophoresis of the homology arms of the H11 site homologous integration vector.

[0026] Fig.12 Schematic diagram of homologous integration vector.

[0027] Fig.13 Target shooting diagram.

[0028] Fig.14 Electrophoresis diagram of positive monoclonal cell identification.

[0029] Fig.15 Positive monoclonal cell image.

[0030] Figure 1 6 Schematic diagram of the composition and working principle of the CRISPR / Cas9 system. DETAILED DESCRIPTION

[0031] The screening process of the present invention will be described in detail below in conjunction with experiments. The following experiments that need to be explained are only for the purpose of explanation and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0032] Unless otherwise specified, the experimental methods used in the experiments are conventional methods. Unless otherwise specified, the materials and reagents used can be obtained from commercial channels.

[0033] Example 1 Identification of Cashmere Goat H11 Locus

[0034] Name: H11 locus; Location: Chr 17 (1139483-1140482); According to NCBI and literature, the H11 locus of each species is located between the DRG1 gene and the EIF4ENIF1 gene. Figure 1A -F. The comparison of the "H11 site and surrounding sequences" of mice, humans, pigs, sheep, and rabbits with the "H11 site and surrounding sequences" of goats revealed that the homology between them was 31.92%, 3.15%, 49.19%, 38.64%, and 37.76%, respectively, reflecting the lack of highly conserved sequences in this region. The comparison results are shown in Figure 2Combined with the location of the H11 site in various species and the comparison results, we predicted the most conserved gene sequence in the goat "H11 site and surrounding sequence" as the goat's H11 site, that is, the DNA sequence 3.1kb-4.1kb downstream of the DRG1 gene, as shown in Figure 3 As shown, and this sequence was retrieved in Genebank, and its nucleotide sequence is shown in sequence SEQ ID NO.1.

[0035] Example 2 Construction of sgRNA expression vector

[0036] According to the design principles of sgRNA, two sgRNA target sites and corresponding PAM sequences (NGG) were screened for the H11 locus based on three design websites [HTTP: / / CRISPOR.TEFOR.NET / CRISPOR.PY; CRISPRDIRECT (DBCLS.JP); HTTPS: / / CCTOP.COS.UNIHE-IDELBERG.DE:8043 / ].

[0037] SgRNA target site 1 (named SH H11-sgRNA1): GGTTAATAGGCTGCACCCCG; the nucleotide sequence that recognizes the target site in the corresponding sgRNA sequence is shown in sequence SEQ ID NO.2 in the sequence list; the DNA sequence encoding the above sequence is shown in sequence SEQ ID NO.4.

[0038] SgRNA target site 2 (named SH H11-sgRNA2): GTGGGCAGCTCCAGGTTAA-TAGG; the nucleotide sequence that recognizes the target site in the corresponding sgRNA sequence is shown in sequence SEQ ID NO.3 in the sequence list; the DNA sequence encoding the above sequence is shown in sequence SEQ ID NO.5.

[0039] The gRNA primer oligo was designed according to the following format, synthesized by BGI, and purified by PAGE.

[0040] Primer formats: Target-Sense: 5'-AAACACCG-gRNAsense, Target-Anti: 5'-CTCTAAAAC-gRNAanti, specific sequences are shown in Table 1.

[0041] Table 1 gRNA primer oligo

[0042]

[0043] Oligo dimer formation: dilute the above primers and perform annealing hybridization. System: Target-Sense 1μL, Target-Anti 1μL, Solution I 5μL, H2O 3μL, total volume 10μL. Program: 95℃3min, 85℃1min, 75℃1min, 65℃1min, 55℃1min, 45℃1min, 35℃1min, 25℃1min, 4℃5min, cooling from 95℃-25℃ at a rate of 0.1℃.

[0044] The oligo dimer obtained in the previous step was connected to the Cas9 / gRNA co-expression vector (named Cas9 / gRNA-H11-1, Cas9 / gRNA-H11-2), the system: Cas9 / gRNA Vector 1μL, the oligo dimer obtained in the previous step 2μL, H2O 7μL, the total system 10μL. Program: 25℃10min.

[0045] Transformation: The Cas9 / gRNA co-expression vector constructed in the previous step was transferred into competent cells (Trans1-T1Phage Resistant Chemically Competent Cell) using the heat shock method: the Cas9 / gRNA co-expression vector was mixed with 50 μL competent cells and placed in an ice bath for 30 min; heat shock at 42°C for 30 s and then placed in an ice bath for 2 min; then 500 μL of sterile, non-resistant LB culture medium was added and activated at 37°C and 200 rpm for 60 min; then the culture was applied to LB solid culture medium containing ampicillin resistance and cultured at 37°C for 6-8 hours.

[0046] Pick single clones and sequence: After a single colony grows, pick 5 colonies each of Cas9 / gRNA-H11-1 and Cas9 / gRNA-H11-2, shake and propagate at 37°C, preserve the colonies and send them for sequencing. Sequencing primer: TGAGCGTCGATTTTTGTGATGCTCGTCAG. The correctly sequenced Cas9 / gRNA-H11-1 and Cas9 / gRNA-H11-2 strains are extracted with the PureYield Plasmid Midiprep System for later use. The schematic diagram of the Cas9 / gRNA co-expression vector is shown in the figure. Figure 4 shown.

[0047] Plasmid extraction: (1) Inoculate 10 μL of E. coli containing the Cas9 / gRNA co-expression vector into 50 ml of LB culture medium containing ampicillin resistance and shake for 18 hours; (2) Centrifuge at 4500 rpm for 15 minutes and collect the precipitate; (3) Resuspend with 2 ml of Cell Resuspension solutin; (4) Add 2 ml of Cell lysis solution and gently invert 5-7 times, and leave at room temperature for 3 minutes; (5) Add 3.3 ml of Neutralization The solution was gently inverted 3-5 times, left at room temperature for 2-3 minutes, centrifuged at 5000 rpm for 15 minutes, the precipitate was discarded, and the liquid was retained; (6) the blue adsorption column was placed in a new centrifuge tube, and the liquid obtained in step (5) was poured into the blue adsorption column, incubated for 2 minutes to allow the residual cell debris to float to the surface, and then centrifuged at 1500 rpm for 5 minutes, and the liquid was retained; (7) the white adsorption column was placed in a centrifuge tube, and the liquid obtained in step (6) was poured into the white adsorption column, centrifuged at 4000 rpm for 3 minutes, and the filtrate was discarded; (8) 5 ml of Endotixion Reneral Wash Solution was added to the white centrifuge tube, centrifuged at 1500 rpm for 3 minutes, and the filtrate was discarded; (9) 20 ml of Endotixion Reneral Wash Solution was added to the white centrifuge tube, and the filtrate was discarded. ColumWash, centrifuge at 1500rpm for 15min, discard the filtrate, and then centrifuge at 1500rpm for 10min; (10) Take out the white adsorption column and place it at room temperature for 10min to ensure that there is no ethanol residue, then add 600μL of enzyme-free water to the white adsorption column, incubate at room temperature for 2min, and centrifuge at 4500rpm for 2min; (11) After measuring the DNA concentration, store it at -20℃.

[0048] Example 3 Cell transfection

[0049] (1) Cell preparation

[0050] Goat fetal fibroblasts (GFF) were revived with cell culture medium containing 10% FBS and passaged once before transfection to keep the cells in logarithmic growth phase. When the cells grew to 70%-80% of the 100 mm dish, the cell pellets were collected for plasmid transfection.

[0051] (2) Comparison of the effects of different cell transfection conditions

[0052] The present invention uses electroporation to transfect cells, and the instrument used is: "NEPAGENE, NEPA21 TYPEII". A total of four groups of transfection conditions are set, and the specific conditions are shown in Table 2. Transfection process: After collecting the cell precipitate, use opti-MEM to wash it three times, then add 20μg of Cas9 / gRNA co-expression vector plasmid to the cell precipitate, and use opti-MEM to make the volume to 100μL. After mixing, transfer them to the electroporation cup respectively, and use the electroporator to perform electroporation using the four transfection conditions set above. After the electroporation is completed, transfer them to a 100m dish and culture them normally. After 48 hours of cell transfection, the electroporation effect and cell survival rate were observed by randomly selecting the field of view under an inverted fluorescence microscope, and the fluorescence intensity was analyzed by ImageJ. It was found that the transfection efficiency of 250V-2.5ms was better than other conditions. Therefore, it is recommended to use the conditions of 250V-2.5ms to transfect large molecular weight plasmid vectors (>10000bp). The transfection effect and fluorescence intensity are shown in Figure 2. Figure 5 and Figure 6 shown.

[0053] Table 2 Transfection conditions

[0054]

[0055] (3) Acquisition of positive cells

[0056] After collecting the cell pellet, wash it three times with opti-MEM, then add 20 μg of Cas9 / gRNA-H11-1 and Cas9 / gRNA-H11-2 plasmids to the cell pellet, dilute to 100 μL with opti-MEM, mix well and transfer to the electroporation cups respectively, use the electroporator to perform electroporation under the transfection conditions of 250V-2.5ms, and after the completion of electroporation, transfer to a 100 mm dish for normal culture. After 48 hours, use the flow sorter to enrich the positive cells with the help of fluorescent screening markers. The results are as follows Figure 7 shown.

[0057] Example 4 sgRNA targeting efficiency verification

[0058] The targeting efficiency of the two sgRNAs (sgRNA1 and sgRNA2) of the present invention was verified, and the target amplification primers were designed using NCBI-primer and synthesized by BGI. The specific primer sequences are shown in Table 3.

[0059] Table 3 Mutation detection primers

[0060]

[0061] The positive cells and untransfected wild-type cells enriched previously were treated with trypsin, and the cell pellets were collected after washing with PBS. The genomic DNA was then extracted using the Tiangen DNA extraction kit, and PCR amplification was performed using the mutation detection primers (Table 3). The PCR system included 0.5 μL PrimeSTAR HS DNA Polymerase, 4.0 μL dNTP Mixture (2.5 μM), 2× PrimeSTAR GC Buffer (Mg 2 O), and 1.5 μL dNTPs. 2+ plus) 25μL, Primer-F 2.0μL, Primer-R 2.0μL, DNA 1.5μL, H2O 15.0μL, total system 50μL. Amplification program: 94℃2min, 98℃10S, 55℃15S, 68℃42S, 30 cycles, 68℃10min, 4℃60min. PCR products were detected by 1% agarose gel electrophoresis. The results are shown in Figure 8 shown.

[0062] PCR purification: (1) Use a portable gel cutter to collect the gel strip containing the target DNA and place it in a clean 1.5ml centrifuge tube; (2) Weigh; (3) Add an equal proportion (1g:1ml) of Binding Buffer and heat at 50-60℃ for 10min until completely melted; (3) Place the adsorption column in a clean centrifuge tube, then transfer the melted liquid into the adsorption column, centrifuge at 10000rpm for 1min, and discard the filtrate; (4) Add 700ml Wash Buffer to the adsorption column, centrifuge at 10000rpm for 1min, discard the filtrate, and repeat this step once; (5) Centrifuge at 10000rpm for 1min; (6) Take out the adsorption column and leave it at room temperature for 3-5min to allow the ethanol to evaporate completely; (7) Place the adsorption column in a new centrifuge tube, add 30μL enzyme-free water, leave it for 2min, and centrifuge at 12000rpm for 2min; (8) After measuring the concentration, store it at -20℃.

[0063] DNA hybridization: 1:1 annealing hybridization of positive cell PCR products and wild-type cell PCR products, system: 2.5μL of positive cell PCR products, 2.5μL of wild-type cell PCR products, 1.1μL of SolutionI, 4.4μL of H2O, 10.5μL of total system. Program: 95℃5min, 94℃2S, 75℃1S, 16℃2min, cooling from 95℃-16℃ at a rate of 0.1℃. Connect the hybridized DNA fragments to PMD19-T, plate after transformation, pick single clones, shake bacteria and send for sequencing, and determine the editing efficiency of Cas9 / gRNA-H11-1 and Cas9 / gRNA-H11-2 by sequence alignment analysis.

[0064] The results showed that for Cas9 / gRNA-H11-1, 15 clones were selected. By comparing the sequencing results with the reference genome and the wild type, it was shown that a total of 8 clones had sequence mutations in the Cas9 / gRNA-H11-1 cleavage region, and the targeting efficiency of H11-sgRNA1 was 53.33%; for Cas9 / gRNA-H11-2, 15 clones were selected, and a total of 5 clones had sequence mutations in the Cas9 / gRNA-H11-2 cleavage region, and the targeting efficiency of H11-sgRNA2 was 33.33%. The specific results are as follows Fig. 9 The above results show that the two sgRNAs (RNA sequences such as SEQ ID NO.2 and SEQ ID NO.3) provided by the present invention can effectively recognize the H11 site of cashmere goats and perform efficient site-specific cutting of the site with the help of Cas9 enzyme, especially sgRNA1 has a higher cutting efficiency of 53.33%.

[0065] Off-target effect analysis: Although the cutting efficiency of sgRNA1 is greater than 50%, there is still the possibility of off-target cutting. Therefore, we used the off-target site prediction website (HTTP: / / CRISPOR.TEFOR.NET / ) to select 5 potential off-target sites for off-target effect detection. These five sites are: ①Chr7-1: NC_030814.1: 33893835-33893857; ②Chr7-2: NC_030814.1: 108272163-108272185; ③Chr15: NC_030822.1: 42881558-42881580; ④Chr18: NC_030825.1: 9169406-9169428; ⑤Chr20: NC_030827.1: 36956344-36956366. Detection primers are shown in Table 4.

[0066] Table 4 Primers for off-target effect detection

[0067]

[0068] The PCR products of each potential off-target site were sequenced and compared with the wild-type PCR products. Fig. 10A -E, the sequence homology is 100%, and no off-target phenomenon occurs at the 5 potential off-target sites. The above results show that sgRNA1 is not only highly efficient, but also has a low off-target rate, and is a good choice for site-specific integration of exogenous genes.

[0069] Example 5: Integrate the exogenous gene EGFP into the H11 site using the CRISPR / Cas9 system.

[0070] Construction of homologous integration vector: (1) According to the results of TA cloning mutation detection, the H11 site selected the bases about 1000 bp upstream and downstream of the sgRNA-1 target site as the upstream and downstream homology arms, and PCR was used to amplify the upstream and downstream homology arms. The primer sequences are shown in Table 5. The electrophoresis results are shown in Fig.11 As shown; (2) The upstream and downstream homology arms recovered from the gel were stored in PMD19-T and sent for sequencing. Through sequence alignment analysis, the homology was as high as 99.0%, and they were named PMD-H11-ZT and PMD-H11-YT respectively; (3) PciI and AseI were used to double-digest pEGFP-C1 and PMD-H11-ZT respectively, and T4 ligase was used to connect the vector backbone with H11-ZT, named H11-EGFP-ZT. H11-EGFP-ZT and PMD-H11-YT were single-digested with MluI, and H11-EGFP-ZT was connected with H11-YT using T4 ligase to obtain a complete H11 site EGFP targeting vector, named H11-EGFP. The vector map and targeting schematic diagram are shown in Fig.12 and Fig.13 shown.

[0071] Table 5 Homology arm primers

[0072]

[0073] Cell transfection: Cas9 / gRNA-H11-1 and H11-EGFP plasmid vectors were extracted using the PureYield Plasmid Midiprep System, and goat fetal fibroblasts were revived with cell culture medium containing 10% FBS. The electroporator was set to transfection conditions of 250V / 2.5ms, and 20μg Cas9 / gRNA-H11-1 and 10μg H11-EGFP were transfected into the cells simultaneously. After transfection, the cells were carefully transferred to a 100mm dish for normal culture. In order to increase the integration efficiency, 6μM RS-1 was added to the cell culture medium after transfection.

[0074] Screening of positive monoclonal cells: 48 hours after transfection, treat the cells with trypsin, collect the cell pellets, wash three times with PBS, and finally resuspend with 500μL PBS; use a flow cytometry sorter to inoculate single cells with green fluorescence after transfection into a 96-well plate for culture. The 96-well plate should be added with culture medium containing 20% ​​FBS in advance. On the eighth day of culture, the cells in the 96-well plate with a cell confluence greater than 50% and emitting green fluorescence are subcultured to a 24-well plate for continued culture. When the cell confluence in the 24-well plate reaches about 90%, the cells are collected, half of the cells are subcultured for continued culture, and the genomes of the other half of the cells are extracted for identification. Using the extracted monoclonal cell genome as a template, primers across the target site are designed for PCR identification, and then the PCR products are analyzed by 1.5% agarose gel electrophoresis. The identification primer sequences are shown in Table 6, and the electrophoresis results are shown in Fig.14 After two rounds of cell screening, a total of 54 monoclonal cells were obtained in this experiment. After PCR identification, 19 of the 28 monoclonal cells obtained at the H11 locus had site-specific integration of the EGFP gene, with a site-specific integration efficiency of 67.86%. Among them, 2 cell lines had only one 2157bp band, which was a double knockout cell line with a double knockout rate of 10.53%. Positive cells were as follows Fig.15 shown.

[0075] Table 6 Positive cell identification primers

[0076]

[0077] In summary, the DNA fragment encoding the sgRNA provided by the present invention can achieve specific modification (knockout or knock-in) at the H11 site at the cell, embryo or even individual level by constructing a Cas9 / gRNA expression vector and a homologous integration vector, thereby studying the expression of specific genes and providing technical support for the breeding of new breeds of goats. At the same time, the sgRNA provided by the present invention can effectively reduce the off-target phenomenon in the CRISPR / Cas9 system, thereby reducing the mutation of non-target gene sequences caused by nonspecific cutting.

[0078] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. An sgRNA specifically targeting the cashmere goat safety site H11, whose sgRNA sequence is as shown in SEQ ID NO.2; the cashmere goat safety site H11 is located on goat chromosome 17, and its nucleotide sequence is as shown in SEQ ID NO.

1.

2. The sgRNA according to claim 1, characterized in that The DNA sequence for transcribing the sgRNA is shown in SEQ ID NO.4; the cashmere goats include Arbas cashmere goats.

3. A CRISPR / Cas9 targeting vector containing the sgRNA according to any one of claims 1 to 2, characterized in that: The targeting vector is constructed by using a Cas9 / gRNA co-expression vector; the targeting vector contains a fluorescent marker gene EGFP and a drug screening marker Puro.

4. Use of the sgRNA according to any one of claims 1 to 2 or the CRISPR / Cas9 targeting vector according to claim 3 in specific recognition and targeted modification of the cashmere goat safety site H11, characterized in that: According to the predicted H11 site sequence, the corresponding sgRNA is designed, and a Cas9 / gRNA co-expression vector and a homologous integration vector based on the CRISPR / Cas9 system are constructed. The high-efficiency Cas9 / gRNA co-expression vector and the homologous integration vector are transfected into cashmere goat fetal fibroblasts to obtain a cell line with the EGFP gene site-specifically integrated at the H11 site; the cashmere goats include Arbas cashmere goats.

5. The use according to claim 4, characterized in that: Site-directed knockout, site-directed integration of exogenous genes, or site-directed overexpression of endogenous genes.

6. Use of the sgRNA according to any one of claims 1 to 2 or the CRISPR / Cas9 targeting vector according to claim 3 in preparing transgenic cashmere goats or improving the production performance and disease resistance of cashmere goats.

7. Use of the sgRNA described in any one of claims 1-2 or the CRISPR / Cas9 targeting vector described in claim 3 in breeding a new variety of gene-edited cashmere goats; the cashmere goats include Arbas cashmere goats.

Images