Cordyceps militaris P trpc Overlapping promoter library and its application
By constructing the Cordyceps Ptrpc overlapping promoter library, the problem of few promoter species and difficult to quantify expression intensity is solved, and the precise regulation of gene expression in Cordyceps is achieved, ensuring that the growth of the strain is not affected.
Patent Information
- Application Number
- CN202111408176.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-11-19
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2041-11-19
AI Technical Summary
The existing Cordyceps sinensis has few promoter species and lacks quantitative analysis of gene expression intensity, making it difficult to achieve precise regulation of target gene expression levels.
Cordyceps Ptrpc overlapping promoter library was constructed, and 1 to 9 copies of Ptrpc promoter were connected in series by Biobrick method to form an overlapping promoter library with different starting strengths, so as to increase the number of promoters and linearly enhance the starting strength.
Quantitative control of different gene expression levels in Cordyceps sinensis is achieved, the precise regulation of gene expression is improved, and the growth and metabolism of the strain is not affected.
Smart Images

Figure CN116145266B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of synthetic biology of edible fungi, and specifically relates to a promoter library of different gene expression promoter strengths in Cordyceps militaris and a method for constructing the same, and particularly relates to a promoter library of 1 to 9 copies of Cordyceps militaris P in series based on the Biobrick method. trpc Overlapping promoter library. Background Art
[0002] Cordyceps militaris, also known as northern cordyceps, belongs to the Ascomycota, Clavicipitaceae, and Cordyceps genus. It is a common edible and medicinal fungus in my country. Cordyceps militaris is rich in cordycepin. [1] , polysaccharides [2] Anti-cancer and anti-tumor [3] , bioactive substances with anti-photoaging effects [4,5] , and is the only species among the more than 350 species of Cordyceps that can produce a large amount of cordycepin. In the past, due to the limited number of parasitic hosts and the particularity of the growth environment, it was difficult to obtain natural Cordyceps militaris fruiting bodies. In the late 1980s, artificial cultivation of Cordyceps militaris was successful. [6] After more than 40 years of development, parameters such as culture medium composition and culture conditions have been improved. [7,8] Various artificial cultivation technologies of Cordyceps militaris, such as static mycelium fermentation, oscillating mycelium fermentation, and solid fruiting body culture, have become mature. [9,10] By 2015, the output of large-scale factory cultivation of Cordyceps militaris in my country had reached 74,000 tons.
[11] , and has formed 75% of the world's Cordyceps militaris-related patents.
[0003] With the advancement of metabolic engineering and synthetic biology, top-down strain engineering based on natural metabolic networks has become a hot topic. In recent years, progress has been made in DNA element mining, gene editing technologies, and the development of genomic metabolic models using Cordyceps militaris as a raw material. This has enabled metabolic engineering studies centered on Cordyceps militaris and cordycepin. However, due to the complexity of their genetic background and growth morphology, research on metabolic engineering and synthetic biology in edible fungi has been relatively slow compared to model microorganisms such as Escherichia coli, Saccharomyces cerevisiae, and Aspergillus oryzae.
[0004] The diversity of DNA elements is the core of metabolic engineering and synthetic biology research. A promoter is a sequence upstream of the transcription start site of gene expression. Its own strength and quantity can significantly affect the expression level of downstream genes. Currently, the commonly used promoters of Cordyceps militaris include the constitutive promoter P found from the U6 small nuclear ribonucleoprotein gene. cmlsm3
[12] , constitutive promoter P derived from 35S RNA CaMV [13,14] , the constitutive promoter P found from the glyceraldehyde-3-phosphate dehydrogenase gene gpd
[15] and the constitutive promoter P of the 3-indole-3-phosphoglycerate synthase gene trpC
[16] In terms of expression intensity, P cmlsm3 、P CaMV and P trpC The other three promoters are medium strength promoters, while P gpd It is a high-strength promoter. In terms of size, P trpC The length is 369 bp, P cmlsm3 The length is 547 bp, P CaMV The length is 678 bp, and the sizes of the three are much smaller than P gpd (1035bp). When constructing gene vectors, smaller promoters are more convenient and easier to be connected to the target vector. Currently, there are few types of promoters discovered in Cordyceps militaris, they are large in size, and there is a lack of quantitative analysis of gene expression intensity, making it difficult to accurately regulate the expression level of the target gene.
[17] It has been reported that by cascading multiple constitutive promoters in E. coli, a promoter library with linearly increasing promoter strength as copy number increased was constructed. Therefore, constructing overlapping constitutive promoters in Cordyceps militaris is expected to achieve precise regulation of target gene expression levels in Cordyceps militaris. Summary of the Invention
[0005] In order to overcome the shortcomings and deficiencies of the prior art, the present invention aims to provide a Cordyceps militaris P trpc Overlapping promoter library.
[0006] Another object of the present invention is to provide the above-mentioned Cordyceps militaris P trpc Application of overlapping promoter libraries.
[0007] The purpose of the present invention is achieved through the following technical solutions:
[0008] The present invention provides a Cordyceps militaris P trpc Overlapping promoter library, consisting of 1 copy of P trpc promoter, 2 copies of P trpc promoter, 3 copies of P trpc promoter, 4 copies of P trpc promoter, 5 copies of P trpc promoter, 6 copies of P trpc promoter, 7 copies of P trpc promoter, 8 copies of P trpcpromoter, 9 copies of P trpc Promoter composition.
[0009] Preferably, the one copy of P trpc promoter, 2 copies of P trpc promoter, 3 copies of P trpc promoter, 4 copies of P trpc promoter, 5 copies of P trpc promoter, 6 copies of P trpc promoter, 7 copies of P trpc The promoter has a sequentially increasing strength for initiating expression of the target gene; the seven copies of P trpc promoter, 8 copies of P trpc promoter, 9 copies of P trpc The promoters have successively decreasing strengths for driving the expression of the target gene.
[0010] Furthermore, the two copies of P trpc The spacing between each copy in the promoter is less than or equal to 100 bp, preferably less than or equal to 50 bp, more preferably 6 to 50 bp, and even more preferably 6 bp; 3 to 9 copies of P trpc The same applies to promoters.
[0011] Further, it consists of a promoter consisting of the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9.
[0012] The present invention also provides a vector comprising one copy of P trpc promoter, 2 copies of P trpc promoter, 3 copies of P trpc promoter, 4 copies of P trpc promoter, 5 copies of P trpc promoter, 6 copies of P trpc promoter, 7 copies of P trpc promoter, 8 copies of P trpc promoter or 9 copies of P trpc Promoter, as a promoter element.
[0013] Preferably, the vector contains the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9 as a promoter element.
[0014] Preferably, the vector further comprises a target gene operably linked to the promoter element.
[0015] Furthermore, the target gene includes (but is not limited to): structural genes, genes encoding proteins with specific functions, reporter genes (such as green fluorescent protein, luciferase gene or galactosidase gene LacZ).
[0016] Furthermore, the target gene is located downstream of the promoter element, and the distance from the promoter is less than or equal to 2000bp; preferably less than or equal to 1000bp; more preferably less than or equal to 500bp, such as less than or equal to 200bp, less than or equal to 100bp, less than or equal to 50bp, 6-50bp.
[0017] The present invention also provides a genetically engineered recombinant strain, wherein the recombinant strain:
[0018] Containing the vector; or having one copy of P integrated into its genome trpc promoter, 2 copies of P trpc promoter, 3 copies of P trpc promoter, 4 copies of P trpc promoter, 5 copies of P trpc promoter, 6 copies of P trpc promoter, 7 copies of P trpc promoter, 8 copies of P trpc promoter or 9 copies of P trpc Promoter nucleic acid.
[0019] Preferably, or a nucleic acid having the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 or SEQ ID NO: 9 integrated into its genome.
[0020] The host bacteria of the recombinant strain is Cordyceps militaris.
[0021] The present invention also provides a kind of Cordyceps militaris P trpcApplication of overlapping promoter library to provide P trpc Overlapping promoters, the P trpc The overlapping promoter can be operably linked to the target gene to regulate the expression of the target gene.
[0022] The present invention also provides a strong promoter, which is 4 copies of P trpc promoter, 5 copies of P trpc promoter, 6 copies of P trpc promoter or 7 copies of P trpc promoter.
[0023] Preferably, the strong promoter is the nucleotide sequence described in SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7.
[0024] Application of the above strong promoter in expressing proteins in Cordyceps militaris.
[0025] Application of the above-mentioned vector or recombinant strain in expressing protein in Cordyceps militaris.
[0026] The present invention has the following advantages and effects compared to the prior art:
[0027] The present invention uses P trpC This promoter, which has moderate strength and small size (369 bp), was constructed by the Biobrick method to contain 1 to 9 copies of P trpc The overlapping promoter library composed of promoters with different promoter strengths realizes a promoter library in which the promoter strength linearly increases with the increase of promoter copy number, laying the foundation for quantitatively controlling the expression level ratio of different genes in Cordyceps militaris. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 pMD19T(simple)-1-9P trpc -gfp-T nos Enzyme digestion identification; Among them, plasmid pMD19T (simple) -1-9P trpc -gfp-T nos Double enzyme digestion (M: DNA marker; 1-9: pMD19T (simple)-1P trpc -gfp-T nos to pMD19T(simple)-9P trpc -gfp-T nos ).
[0029] Figure 2 pCambia0390-blpR-1-9Ptrpc -gfp-T nos Enzyme digestion identification; Among them, plasmid pCambia0390-blpR-1-9P trpc -gfp-T nos Double enzyme digestion (M: DNA marker; 1-9: pCambia0390-blpR-1P trpc -gfp-T nos to pCambia0390-blpR-9P trpc -gfp-T nos ).
[0030] Figure 3 pCambia0390-blpR-1-6P trpc -gfp-T nos Plasmid map.
[0031] Figure 4 pCambia0390-blpR-7-9P trpc -gfp-T nos Plasmid map.
[0032] Figure 5 It is a recombinant transformant colony of Cordyceps militaris.
[0033] Figure 6 These are the PCR identification results of the recombinant transformants of Cordyceps militaris; wherein, a is the PCR verification result of the third-generation mycelium of the Cm1-6, 8trpc pseudo-transformants; M: Marker3; 1: Cm1trpc; 2: Cm2trpc; 3, 4: Cm3trpc; 5: Cm4trpc; 6, 7: Cm5trpc; 8: Cm6trpc; 9: Cm8trpc; b is the PCR verification result of the third-generation mycelium of the Cm6-9trpc pseudo-transformants; M: Marker3; 1, 2: Cm6trpc; 3-5: Cm7trpc; 6: Cm8trpc; 7, 8: Cm9trpc.
[0034] Figure 7 qRT-PCR verification of GFP gene expression in recombinant Cordyceps militaris strains. Data are the means of three experiments, and error bars indicate standard errors. Statistical analysis was performed using the t-test (P < 0.05).
[0035] Figure 8 Biomass determination of wild-type and recombinant strains of Cordyceps militaris. Data are the average of three experiments, and error bars indicate standard error. * indicates significant difference in biomass between the recombinant strain and the wild-type strain, *p < 0.05, **p < 0.01. DETAILED DESCRIPTION
[0036] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.
[0037] In the following examples, experimental methods without specific experimental conditions were generally performed under conventional experimental conditions or those recommended by the manufacturer. Materials and reagents used were commercially available unless otherwise specified.
[0038] Example 1
[0039] 1 Materials and Methods
[0040] 1.1 Strains and plasmids
[0041] pMD19T (simple) plasmid was purchased from Takara Biotechnology (Beijing) Co., Ltd. (China). rstA The -GFP plasmid was a kind gift from Professor Liu Jianzhong of Sun Yat-sen University. The pAg1-H3 plasmid was a kind gift from Researcher Liu Gang and Teacher Pan Yuanyuan of the Institute of Microbiology, Chinese Academy of Sciences. Escherichia coli DH5α was purchased from Shanghai Weidi Biotechnology Co., Ltd. for gene cloning. The plasmid pCambia0390 was purchased from Cambia, Queensland, Australia. AGL-1 was purchased from Shanghai Weidi Biotechnology Co., Ltd. Both AGL-1 and plasmid pCambia0390 were used to mediate fungal transformation. The Cordyceps militaris CM-10 strain was purchased from Haixin Biotechnology Co., Ltd. in Ningyang County, Shandong Province, as a gene host. The Cordyceps militaris CM-10 strain was also published in the literature "Study on the Solid Fermentation System of Cordyceps militaris with High Carotenoid Yield and Its Products [D]. South China Agricultural University, 2016". The pAg1-H3 plasmid was also published in the literature "Cloning of the ben gene and its functional identification in Cordyceps militaris [J]. Scientia Horticulturae, 2020". pP rstA -GFP plasmid and disclosed in the document "Dynamic control of the mevalonate pathway expression for improved zeaxanthin production in Escherichia coli and comparative proteome analysis [J]. Metabolic Engineering, 2016".
[0042] 1.2 Preparation of culture medium and reagents
[0043] PDB medium: For Cordyceps militaris culture. 200 g potatoes (peeled), 20 g glucose, 1.5 g MgSO₄·7H₂O, 3 g KH₂PO₄, dilute to 1 L with distilled water, natural pH, 20 g agar (for solid culture medium), sterilize by autoclaving at 121°C for 30 min.
[0044] LB medium: For culturing E. coli. Add 10 g of tryptone, 5 g of yeast extract, 10 g of NaCl, and distilled water to 1 L, pH 7.4. Sterilize by autoclaving at 121°C for 30 min.
[0045] IM medium: For Agrobacterium tumefaciens culture. 1.45 g / L KH2PO4, 2.05 g / L K2HPO4, 0.15 g / L NaCl, 0.5 g / L MgSO4·7H2O, 66 mg / L CaCl2·2H2O, 2.48 mg / L FeSO4·7H2O, 0.5 g / L (NH4)2SO4, 1.8 g / L glucose, 5 mL / L glycerin, pH 5.5. Autoclave at 121°C for 30 min.
[0046] IMA medium: For co-cultivation of Agrobacterium tumefaciens and Cordyceps militaris spores. Contents: 1.45 g / L KH2PO4, 2.05 g / L K2HPO4, 0.15 g / L NaCl, 0.5 g / L MgSO4·7H2O, 66 mg / L CaCl2·2H2O, 2.48 mg / L FeSO4·7H2O, 0.5 g / L (NH4)2SO4, 0.9 g / L glucose, 5 mL / L glycerin, 15 g / L agar, pH 5.5, autoclave at 121°C for 30 min.
[0047] 100 mM Acetosyringone, AS: Weigh 196.2 mg of powder (McLean), dissolve in 10 mL of DMSO, and filter sterilize.
[0048] 100 g / L carbenicillin (Carb): Dissolve 1 g carbenicillin in ultrapure water, dilute to 10 mL, and filter sterilize.
[0049] 100 g / L cephalosporin (Cef): Dissolve 1 g of cephalosporin in ultrapure water, dilute to 10 mL, and filter sterilize.
[0050] 100 g / L Kanamycin (Kan): Dissolve 1 g of kanamycin in ultrapure water, dilute to 10 mL, and filter sterilize.
[0051] 100 g / L Ampicillin (Amp): Dissolve 1 g of Ampicillin in ultrapure water, dilute to 10 mL, and filter sterilize.
[0052] 1.3 Enzymes and kits
[0053] PrimeSTAR Max (R045A) DNA polymerase, used for amplifying the target gene, was purchased from Takara. 2× TaqMix DNA polymerase, used for adding A bases, was purchased from Nanjing Novozymes Biotechnology Co., Ltd. KOD Fx (KFX-101) DNA polymerase, used for identifying Cordyceps militaris transformants, was purchased from Toyobo. Restriction endonucleases BamHI, EcoRI, BglⅡ, and ScaI were purchased from Thermo Fisher Scientific. T4 DNA ligase was purchased from Takara. The HiPure Plasmid Mini Kit for plasmid extraction and the HiPure Gel Pure DNA Mini Kit for nucleic acid purification and recovery were purchased from Meiji Biotechnology.
[0054] 1.4 Primer sequences
[0055] Primer name Primer sequence (5'-3') Tnos-F <![CDATA[CC GAATTC TT GGATCC GATCGTTCAAACATTTGGCA]]> Tnos-R <![CDATA[CCC AGATCT GATCTAGTAACATAGATGAC]]> GFP-F <![CDATA[CC GAATTC TT GGATCC AGTAAAGGAGAAGAACTTTT]]> GFP-R <![CDATA[CCC AGATCT CTATTTGTATAGTTCATCC]]> trpc-F <![CDATA[CC GAATTC TT GGATCC TCGACAGAAGATGATATTGAA]]> trpc-R <![CDATA[CCC AGATCT ATCGATGCTTGGGTAGAATA]]> Tu3-F CATTCGCATCGTCATTGTTGGCTC 18S rRNA-F GAGCCCAAGCACTTTGATTTCT 18S rRNA-R GCATTTGCCAAGGATGTTTTC qPCR-GFP-F AGTTGTCCCAATTCTTGTTG qPCR-GFP-R TGTCTTGTAGTTCCCGTCA
[0056] Note: The underline " GAATTC " indicates EcoRⅠ restriction site," GGATCC " indicates BamHI restriction site," AGATCT ” indicates the BglⅡ restriction site.
[0057] 2. Vector Construction
[0058] 2.1pMD19T(simple)-1-9P trpc -gfp-T nos Vector construction
[0059] The terminator T was obtained by PCR amplification using the forward primer Tnos-F with EcoRⅠ and BamHI restriction sites and the reverse primer Tnos-R with BglⅡ restriction site as primer combination and the pCambia0390 plasmid as template. nos . The terminator T was cloned by TA cloning. nos Ligated into pMD19T (simple) vector.
[0060] The target DNA sequence amplified by PrimeSTAR Max has blunt ends. To ligate it with pMD19T(simple), a poly A tail is added to the 3' end of the target fragment using DNA polymerase 2×TaqMix. The reaction system and reaction parameters are as follows:
[0061] Add A base system:
[0062] Element Volume (μL) <![CDATA[T nos ]]> 25 2×TaqMix 25 Total 50
[0063] Reaction parameters for adding base A: incubate at 70°C for 30 min.
[0064] The A-added fragments were recovered using the HiPure Gel Pure DNA Mini Kit. See the instructions for detailed steps. The A-added fragments were ligated with pMD19T (simple). The specific reaction system and reaction parameters are as follows:
[0065] Element Volume (μL) pMD19T(simple) 1 Add A base fragment 4 Solution I 5 Total 10
[0066] Ligation reaction parameters: incubate at 16°C for 2 h.
[0067] The ligated product was transformed into competent cells of E. coli DH5α engineered bacteria prepared in 0.1M CaCl2, and the transformants were identified by colony PCR and sequenced. The successfully constructed plasmid was used for the next step of the experiment.
[0068] pP rstA -GFP vector DNA was used as template and GFP-F / R as primer combination to amplify green fluorescent protein gene gfp using PrimeSTAR Max. Since the forward primer added EcoRI and BamHI restriction sites and protective bases, and the reverse primer added BglII restriction site and protective bases, the gfp gene fragment was amplified with the vector pMD19T (simple)-T using the principle that BamHI and BglII are homologous enzymes. nos After enzyme digestion and purification, the fragments were ligated using T4 DNA ligase. The enzyme digestion system is as follows:
[0069] Element Volume (μL) 10×FastDigest Buffer 2 Fragment / Vector 1 μg EcoRI 1 BglII / BamHI 1 <![CDATA[dd H2O]]> Replenish to 20 Total 20
[0070] Enzyme digestion reaction parameters: incubate at 37°C for 5 min.
[0071] T4 DNA ligation reaction system:
[0072] Element Volume (μL) 10×T4 DNA Ligase Buffer 1 T4 DNA Ligase 1 snippet 6 carrier 2 Total 10
[0073] Ligation reaction conditions: incubate at 16°C for 2 h.
[0074] The ligated product was transformed into competent cells of E. coli DH5α engineered bacteria prepared in 0.1M CaCl2, and the transformants were identified by colony PCR and sequenced. The successfully constructed plasmid was used for the next step of the experiment.
[0075] Using pAg1-H3 vector DNA as template and trpc-F / R as primer combination, PrimeSTAR Max was used to amplify P trpc In the amplification reaction, the forward primer was used to add EcoRI and BamHI restriction sites, and the reverse primer was used to add BglII restriction site. BamHI and BglII were used as the same tail enzymes to amplify the promoter fragment. trpc with pMD19T(simple)-gfp-T nos Ligation was performed to construct pMD19T(simple)-P trpc -gfp-T nos , and performed colony PCR identification and sequencing. Similarly, the Biobrick method was used to construct pMD19T (simple)-NP trpc -gfp-T nos The N in the vector name refers to 8 types of P from 2 to 9. trpc Vectors with different promoter copy numbers. trpc The nine vectors with promoter copy numbers ranging from 1 to 9 were tested by enzyme digestion to confirm that the complete overlapping P trpc Promoter library.
[0076] 2.2 1-9P trpc -gfp-T nos Module connected to pCambia0390-blpR
[0077] Since Cordyceps militaris is a fungus, common Escherichia coli plasmids cannot infect it and it needs the help of Ti plasmid for infection. Therefore, the promoter module needs to be connected to the Agrobacterium vector pCambia0390-blpR with a glufosinate selection marker. First, the glufosinate selection marker expression cassette Pcmlsm3-blpR-Tcmura3 is connected to the AvrII restriction site of the pCambia0390 vector by enzyme ligation to form the pCambia0390-blpR vector; wherein, the expression cassette Pcmlsm3-blpR-Tcmura3 is disclosed in the literature "Efficient crispr-cas9 gene disruption system in edible-medicinal mushroom cordyceps militaris[J].Frontiers in Microbiology, 2018". pMD19T(simple)-1-9P trpC -gfp-T nos and pCambia0390-blpR were digested with EcoRI and BglII and then ligated for transformation. trpC-gfp-T nos 、pMD19T(simple)-5P trpC -gfp-T nos and pMD19T(simple)-6P trpC -gfp-T nos The fragments after digestion with EcoRⅠ and BglⅡ were slightly different in size and difficult to distinguish. Therefore, the three vectors were digested with EcoRⅠ, BglⅡ and ScaⅠ to obtain NP trpC -gfp-T nos module, so that it can be connected with the pCambia0390-blpR vector for the next step of transformation.
[0078] Double enzyme digestion reaction system:
[0079] Element Volume (μL) 10×FastDigest Buffer 2 Fragment / Vector 1 μg EcoRI 1 BglⅡ 1 <![CDATA[dd H2O]]> Replenish to 20 Total 20
[0080] Three-enzyme digestion reaction system:
[0081] Element Volume (μL) 10×FastDigest Buffer 3 Fragment / Vector 1 μg EcoRI 1 ScaI 1 BglⅡ 1 <![CDATA[ddH2O]]> Replenish to 30 Total 30
[0082] Enzyme digestion reaction parameters: incubate at 37°C for 5 min.
[0083] After enzyme digestion, ligation and transformation were performed according to the above-mentioned ligation system, and the simulated transformants were obtained and then verified by enzyme digestion.
[0084] 2.3 pCambia0390-blpR-1-9P trpc -gfp-T nos Electrotransformed into Agrobacterium tumefaciens AGL-1
[0085] 1) Cool the sterile electroporation cuvette on ice for at least 5 minutes.
[0086] 2) Place the -80°C frozen Agrobacterium tumefaciens AGL-1 competent cells on ice and let them stand for 5 minutes to thaw. Immediately add 1-5 μg of plasmid DNA, gently pipette to mix, and transfer to a frozen electroporation cuvette.
[0087] 3) Start the Biored electroporator, place the electroporation cup in the electroporation tank, use the preset electroporation program (Ec1 1.8 kV, 1 pulse), and press Pulse (the pulse time should be approximately 5 ms);
[0088] 4) After the electroporation, quickly add 1 mL of antibiotic-free LB liquid medium and transfer to a sterile centrifuge tube. Incubate with shaking at 30°C for 2-3 hours.
[0089] 5) Centrifuge at 6000 rpm for 2 minutes, discard most of the supernatant, and retain approximately 100 μL of the bacterial suspension. Mix thoroughly by pipetting, then spread evenly on LB solid medium containing 50 μg / mL Kan and 50 μg / mL Carb. Incubate at 30°C for 2-3 days until colonies emerge, then perform colony PCR analysis.
[0090] 2.4 Agrobacterium tumefaciens infects Cordyceps militaris spores
[0091] (1) Obtaining Agrobacterium
[0092] 1) A single colony of the Agrobacterium tumefaciens AGL-1 transformant carrying the shuttle vector was inoculated into 10 mL of LB (containing 50 mg / L Kan and 50 mg / L Carb) and cultured with shaking at 30°C for 2-3 days to obtain a seed solution.
[0093] 2) Inoculate fresh seed solution into IM medium (containing 200 μM AS) to make the initial OD of the bacteria 600 The value was 0.15, and then the culture was shaken at 30 °C until the OD 600 The value is 0.8.
[0094] (2) Obtaining Cordyceps militaris conidia
[0095] 1) Inoculate Cordyceps militaris strain CM-10 on PDA medium and culture in the dark at 25°C for 14-21 days, followed by light exposure for 5-7 days.
[0096] 2) Rinse the plate in a clean hood with 3-5 mL of sterile 0.05% Tween 80 (filter sterilized). Collect the wash solution and continue rinsing the next plate. Collect 3-5 plates to obtain approximately 1-2 mL of spore suspension.
[0097] 3) After sterilizing and drying the filter head with six layers of lens cleaning paper, add 2 mL of 0.05% Tween 80 to the laminar flow hood to rinse the lens cleaning paper vertically. Then inject the spore suspension to filter out large particles. Finally, add 1 mL of 0.05% Tween 80 to rinse the filter to remove the remaining spores.
[0098] 4) Count the number of conidia in the collected suspension using a hemocytometer and dilute the suspension to a spore concentration of 1×10 4 -10 6 pieces / mL.
[0099] (3) Co-culture of Agrobacterium cells and fungal conidia
[0100] 1) Preheat OD 600 =0.80 Agrobacterium cells and Cordyceps militaris spore suspension (1×10 4 -10 6spores / mL) were mixed in a certain ratio (volume ratio 1:100, 1:1, 100:1).
[0101] 2) The mixed bacterial solution was spread on a piece of IMA + 200 μM AS culture medium (pH = 5.5) covered with a glass paper sheet (diameter = 90 mm) and cultured at 25°C in the dark for 2-3 days.
[0102] (IV) Screening of proposed transformants
[0103] 1) Co-cultivate at 25°C until spores begin to germinate and produce white dot-like mycelial masses. Transfer the cellophane sheets to selective PDA plates containing cephalosporin (300 μg / mL) and glufosinate (400 μg / mL) and incubate for 5-7 days.
[0104] 2) When a single mycelial mass is clearly visible, a single transformant is picked with a sterilized toothpick and transferred to PDA medium containing glufosinate (400 μg / mL) for further culture.
[0105] 3) When a single hypha grows to a diameter of 2 cm, a hyphae block with a diameter of 0.5 cm is cut for direct PCR verification.
[0106] 4) Verify that the correct transformants are cultured and expanded. At the third generation, genomic DNA is extracted and verified by PCR using primers Tu3-F / GFP-R and sequenced.
[0107] 2.5 Quantitative Real-Time PCR (qPCR) verification of gfp gene expression levels driven by multiple promoters
[0108] The corresponding transformant mycelial block was inoculated into PDB liquid culture medium and cultured at 25°C and 150 rpm for about 7 days. After filtering out the culture medium, the mycelium was washed 2-3 times with sterile water. After grinding the mycelium into powder with liquid nitrogen, 100 mg of powder was taken and total RNA was extracted using EZNAFungal RNA Miniprep kit (OMEGA Bio-Tek). After gel electrophoresis confirmed that the total RNA extraction was successful, the RNA concentration was determined using nanodrop. 1 μg of RNA was taken for RNA reverse transcription, and the RNA was reverse transcribed into cDNA using HiScriptⅢRTSuperMix for qPCR (Vazyme). The reaction system for fluorescence quantitative PCR was 20 μL, containing 50 ng RNA, 0.2 μM forward primer, 0.2 μM reverse primer and SYBR qPCR Master Mix (Vazyme). Fluorescence quantitative PCR detection and analysis used ABI 7500 Real-Time PCR System. The internal reference gene was 18S rRNA of Cordyceps militaris, and the relative expression level of mRNA was determined by 2 -ΔΔ CT (Livak)
[18] It can be calculated by method.
[0109] 2.6 Determination of Cordyceps militaris biomass by shake flask fermentation
[0110] Punch two holes of the corresponding transformant mycelium blocks and inoculate them into 100 mL of PDB liquid culture medium. Cultivate them at 25°C and 150 rpm for 8 days. After they grow to maturity, collect the mycelium, freeze-dry, and weigh it.
[0111] 3 Results and Analysis
[0112] 3.1 Recombinant vector pMD19T(simple)-1-9P trpc -gfp-T nos Vector construction and transformation
[0113] Recombinant plasmid pMD19T(simple)-1-9P trpc -gfp-T nos After double enzyme digestion with EcoRⅠ and BglⅡ, a vector frame of 2705 bp and fragments of 1362, 1737, 2112, 2487, 2862, 3237, 3612, 3987, and 4362 bp were obtained. Figure 1 ) was determined, which was consistent with expectations, indicating that the recombinant plasmid pMD19T(simple)-1-9P trpc -gfp-T nos All were built successfully.
[0114] 3.2 pCambia0390-blpR-1-9P trpc -GFP vector construction and transformation
[0115] The pCambia0390-blpR plasmid was treated with double enzyme digestion and the 8109 bp linear vector was recovered by gel cutting. trpc -gfp-T nos The plasmid was double-digested or triple-digested, and the 1-9P fragments with sizes of 1362, 1737, 2112, 2487, 2862, 3237, 3612, 3987, and 4362 bp were recovered from the gel. trpc The promoter module was ligated with the pCambia0390-blpR linear vector for transformation. After colony PCR identification, pseudo-transformants were obtained. The recombinant plasmid pCambia0390-blpR-1-9P was extracted. trpc -gfp-T nos After double enzyme digestion test, the vector with a size of 8109 bp was obtained, and the sizes of the vectors were 1362, 1737, 2112, 2487, 2862, 3237, 3612, 3987, and 4362 bp. Figure 2 ) was determined, which was consistent with expectations, indicating that the recombinant plasmid pCambia0390-blpR-1-9P trpc -gfp-T nos All were successfully constructed, and the plasmid maps are shown in Figure 3 、 4 The vector was transformed into Agrobacterium tumefaciens AGL-1 by electroporation, and the transformants were identified by colony PCR. The results showed that the Agrobacterium tumefaciens AGL_pCambia0390-blpR-1-9P trpc -gfp-T nos was built successfully.
[0116] 3.3 Testing of Cordyceps militaris recombinant transformants
[0117] Agrobacterium tumefaciens AGL_pCambia0390-blpR-1-9P trpc -gfp-T nos Infect Cordyceps militaris CM-10 spores. After incubating the infected Cordyceps militaris spores on a non-antibiotic plate for 3 days, transfer the infected spores together with the cellophane underneath to a plate containing the corresponding antibiotic and continue incubation in the dark. When the mycelium begins to germinate and white spots form, the proposed transformants are picked and cultured on a plate containing Basta antibiotic. After the colony is formed ( Figure 5 ), and the hyphae of the proposed transformants were scraped for PCR identification. The resistant transformed strains obtained were serially passaged and PCR identified ( Figure 6), the stable strains were those with target bands at 1325, 1700, 2075, 2450, 2825, 3200, 3575, 3950, and 4325 bp, respectively. Three generations of stable strains were selected for subsequent experiments, and the correct Cordyceps militaris transformants were named CmNtrpc.
[0118] 3.4 qRT-PCR detection of relative gene expression
[0119] qRT-PCR amplification was performed using cDNAs of CM-10 and Cm1-9trpc as templates and 18s rRNA-F / R and qPCR-GFP-F / R as primers, respectively. The wild-type Cordyceps militaris CM-10 was used as a negative control, and the gfp gene expression level of Cordyceps militaris Cm1trpc was used as a control to calculate the relative expression levels of the gfp gene in the other 8 strains ( Figure 7 Real-time fluorescence quantitative PCR analysis showed that gfp gene expression gradually increased with increasing promoter number; expression intensity reached its peak when the promoter number reached 7; expression then gradually decreased with increasing promoter number. These results demonstrate the construction of a Cordyceps militaris promoter library in which promoter intensity changes linearly with increasing copy number.
[0120] 3.5 Determination of Cordyceps militaris biomass by shake flask fermentation
[0121] Due to the poor robustness of Cordyceps militaris, we were concerned that introducing multiple promoters would burden the growth and metabolism of Cordyceps militaris. To verify this issue, we measured the biomass of the correct transformants. The biomass results showed ( Figure 8 ), compared with the wild-type strain CM-10, the biomass of the transformed strain did not decrease, which indicates that the introduction of multiple overlapping promoters does not impose a burden on the growth of Cordyceps militaris.
[0122] References:
[0123] [1]Bentley HR, Cunningham KG, Spring FS.509. Cordycepin, a metabolic product from cultures of Cordyceps militaris(linn.)link.Part ii.The structure of cordycepin[J].Journal of the Chemical Society, 1951:2301-2305.
[0124] [2]Huang Zf,Zhang ML,Zhang S et al.Structural characterization ofpolysaccharides from Cordyceps militaris and their hypolipidemic effects inhigh fat diet fed mice[J].RSC Advances,2018,8(71):41012-41022.
[0125] [3]Dong J,Li Y,Xiao H et al.Cordycepin sensitizes breast cancer cellstoward irradiation through elevating ros production involving nrf2[J].ToxicolAppl Pharmacol,2018,364:12-21.
[0126] [4]Das SK,Masuda M,Hatashita M,et al.A new approach for improvingcordycepin productivity in surface liquid culture of Cordyceps militarisusing high-energy ion beam irradiation[J].Letters in Applied Microbiology,2008,47(6):534-538.
[0127] [5]Jin ML,Park SY,Kim YH,et al.Suppression ofα-msh and ibmx-inducedmelanogenesis by cordycepin via inhibition of creb and mitf,and activation ofpi3k / akt and erk-dependent mechanisms[J].International Journal of MolecularMedicine,2012,29(1):119-24.
[0128] [6] Yang Jie, Chen Shunzhi. Research progress of cordycepin[J]. Chinese Journal of Biochemical Pharmacology, 2008, 29(06): 414-417.
[0129] [7] Tang Jiapeng. Study on two-step fermentation culture to improve the content of cordycepin in edible Cordyceps militaris fruiting bodies[J]. Light Industry Science and Technology, 2020, 36(10): 9-11+20.
[0130] [8] Wang Jufeng. Research on the cultivation of Cordyceps militaris and its physiologically active substances[D]. Changsha: Central South University of Forestry and Technology, 2006.
[0131] [9] Liu Ran, Qu Liangfan, Wang Xianghe, et al. Optimization of liquid fermentation conditions of Cordyceps militaris mycelium[J]. Food Engineering, 2019, (03): 31-34+42.
[0132]
[10] Zhu Lina, Gao Xinhua, Liu Yanfang, et al. Comparison of active ingredients in liquid fermentation mycelium and solid culture fruiting bodies of Cordyceps militaris [J]. Shanghai Journal of Agriculture, 2019, 35(04): 57-62.
[0133]
[11] Bao Dapeng, Liu Minxiang, Wang Ying, et al. Using mating type gene molecular markers to assist in the affinity pairing of Cordyceps militaris[J]. Journal of Nuclear Agricultural Sciences, 2017, 31(11): 2113-2120.
[0134]
[12] Chen BX, Tao W, Ye ZW et al. Efficient crispr-cas9 gene disruptionsystem in edible-medicinal mushroom cordyceps militaris[J]. Frontiers inMicrobiology, 2018, 9:1157-.
[0135]
[13] PN B, Science CN J. The cauliflower mosaic virus 35s promoter: Combinatorial regulation of transcription in plants [J]. Science, 1990, 250(4983):959-966.
[0136]
[14] Zhang H,Wang Y,Tong X et al.Overexpression of ribonucleotidereductase small subunit,rnrm,increases cordycepin biosynthesis in transformedcordyceps militaris[J].Chinese Journal of Natural Medicines,2020,18(5):393-400.
[0137]
[15] Gong Z,Ying S,Lei H et al.Cloning and analysis of glyceraldehyde-3-phosphate dehydrogenase gene from cordyceps militaris[J].African Journal ofAgricultural Research,2009,4(4):402-408.
[0138]
[16] Zheng Z,Huang C,Li C et al.Agrobacterium tumefaciens-mediatedtransformation as a tool for insertional mutagenesis in medicinal funguscordyceps militaris[J].Fungal Biology,2011,115(3):0-274.
[0139]
[17] Li M,Wang J,Geng Y et al.A strategy of gene overexpression basedon tandem repetitive promoters in escherichia coli[J].Microbial CellFactories,,2012,11:19.
[0140]
[18] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2-δδct method[J]. Methods, 2001, 25(4):402-408.
[0141] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention. <110> Guangdong Shaohe Biotechnology Co., Ltd. <120> Cordyceps militaris Ptrpc overlapping promoter library and its application <160> 20 <170> SIPOSequenceListing 1.0 <210> 1 <211> 369 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of one copy of the Ptrpc promoter <400> 1 tcgacagaag atgatattga aggagcactttttgggcttg gctggagcta gtggaggtca 60 acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120 gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180 cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240 tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300 tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360 agcatcgat 369 <210> 2 <211> 744 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of two copies of the Ptrpc promoter <400> 2 tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60 acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120 gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180 cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240 tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300 tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360 agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420 agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480 aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540 tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600 ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660 gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720 tacctattct acccaagcat cgat 744 <210> 3 <211> 1119 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of 3 copies of the Ptrpc promoter <400> 3 tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60 acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120 gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180 cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240 tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300 tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360 agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420 agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480 aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540 tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600 ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660 gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720 tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 780 tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 840 caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 900 gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 960 ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 1020 gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 1080 agattcaatc tgacttacct attctaccca agcatcgat 1119 <210> 4 <211> 1494 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of 4 copies of the Ptrpc promoter <400> 4 tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60 acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120 gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180 cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240 tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300 tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360 agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420 agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480 aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540 tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600 ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660 gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720 tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 780 tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 840 caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 900 gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 960 ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 1020 gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 1080 agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 1140 attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 1200 tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 1260 ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 1320 tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 1380 tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 1440 tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgat 1494 <210> 5 <211> 1869 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of 5 copies of the Ptrpc promoter <400> 5 tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60 acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120 gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180 cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240 tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300 tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360 agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420 agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480 aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540 tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600 ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660 gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720 tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 780 tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 840 caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 900 gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 960 ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 1020 gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 1080 agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 1140 attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 1200 tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 1260 ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 1320 tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 1380 tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 1440 tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgatagatcc 1500 tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 1560 acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 1620 gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 1680 cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 1740 tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 1800 tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 1860 agcatcgat 1869 <210> 6 <211> 2244 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of 6 copies of the Ptrpc promoter <400> 6 tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60 acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120 gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180 cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240 tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300 tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360 agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420 agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480 aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540 tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600 ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660 gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720 tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 780 tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 840 caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 900 gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 960 ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 1020 gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 1080 agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 1140 attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 1200 tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 1260 ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 1320 tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 1380 tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 1440 tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgatagatcc 1500 tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 1560 acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 1620 gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 1680 cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 1740 tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 1800 tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 1860 agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 1920 agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 1980 aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 2040 tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 2100 ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 2160 gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 2220 tacctattct acccaagcat cgat 2244 <210> 7 <211> 2619 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of 7 copies of the Ptrpc promoter <400> 7 tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60 acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120 gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180 cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240 tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300 tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360 agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420 agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480 aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540 tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600 ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660 gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720 tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 780 tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 840 caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 900 gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 960 ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 1020 gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 1080 agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 1140 attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 1200 tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 1260 ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 1320 tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 1380 tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 1440 tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgatagatcc 1500 tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 1560 acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 1620 gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 1680 cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 1740 tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 1800 tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 1860 agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 1920 agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 1980 aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 2040 tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 2100 ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 2160 gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 2220 tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 2280 tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 2340 caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 2400 gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 2460 ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 2520 gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 2580 agattcaatc tgacttacct attctaccca agcatcgat 2619 <210> 8 <211> 2994 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of 8 copies of the Ptrpc promoter <400> 8 tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60 acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120 gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180 cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240 tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300 tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360 agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420 agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480 aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540 tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600 ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660 gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720 tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 780 tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 840 caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 900 gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 960 ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 1020 gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 1080 agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 1140 attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 1200 tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 1260 ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 1320 tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 1380 tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 1440 tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgatagatcc 1500 tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 1560 acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 1620 gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 1680 cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 1740 tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 1800 tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 1860 agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 1920 agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 1980 aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 2040 tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 2100 ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 2160 gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 2220 tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 2280 tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 2340 caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 2400 gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 2460 ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 2520 gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 2580 agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 2640 attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 2700 tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 2760 ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 2820 tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 2880 tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 2940 tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgat 2994 <210> 9 <211> 3369 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of 9 copies of the Ptrpc promoter <400> 9 tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 60 acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 120 gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 180 cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 240 tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 300 tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 360 agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 420 agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 480 aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 540 tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 600 ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 660 gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 720 tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 780 tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 840 caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 900 gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 960 ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 1020 gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 1080 agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 1140 attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 1200 tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 1260 ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 1320 tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 1380 tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 1440 tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgatagatcc 1500 tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 1560 acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 1620 gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 1680 cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 1740 tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 1800 tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 1860 agcatcgata gatcctcgac agaagatgat attgaaggag cactttttgg gcttggctgg 1920 agctagtgga ggtcaacaat gaatgcctat tttggtttag tcgtccaggc ggtgagcaca 1980 aaatttgtgt cgtttgacaa gatggttcat ttaggcaact ggtcagatca gccccacttg 2040 tagcagtagc ggcggcgctc gaagtgtgac tcttattagc agacaggaac gaggacatta 2100 ttatcatctg ctgcttggtg cacgataact tggtgcgttt gtcaagcaag gtaagtgaac 2160 gacccggtca taccttctta agttcgccct tcctcccttt atttcagatt caatctgact 2220 tacctattct acccaagcat cgatagatcc tcgacagaag atgatattga aggagcactt 2280 tttgggcttg gctggagcta gtggaggtca acaatgaatg cctattttgg tttagtcgtc 2340 caggcggtga gcacaaaatt tgtgtcgttt gacaagatgg ttcatttagg caactggtca 2400 gatcagcccc acttgtagca gtagcggcgg cgctcgaagt gtgactctta ttagcagaca 2460 ggaacgagga cattattatc atctgctgct tggtgcacga taacttggtg cgtttgtcaa 2520 gcaaggtaag tgaacgaccc ggtcatacct tcttaagttc gcccttcctc cctttatttc 2580 agattcaatc tgacttacct attctaccca agcatcgata gatcctcgac agaagatgat 2640 attgaaggag cactttttgg gcttggctgg agctagtgga ggtcaacaat gaatgcctat 2700 tttggtttag tcgtccaggc ggtgagcaca aaatttgtgt cgtttgacaa gatggttcat 2760 ttaggcaact ggtcagatca gccccacttg tagcagtagc ggcggcgctc gaagtgtgac 2820 tcttattagc agacaggaac gaggacatta ttatcatctg ctgcttggtg cacgataact 2880 tggtgcgttt gtcaagcaag gtaagtgaac gacccggtca taccttctta agttcgccct 2940 tcctcccttt atttcagatt caatctgact tacctattct acccaagcat cgatagatcc 3000 tcgacagaag atgatattga aggagcactt tttgggcttg gctggagcta gtggaggtca 3060 acaatgaatg cctattttgg tttagtcgtc caggcggtga gcacaaaatt tgtgtcgttt 3120 gacaagatgg ttcatttagg caactggtca gatcagcccc acttgtagca gtagcggcgg 3180 cgctcgaagt gtgactctta ttagcagaca ggaacgagga cattattatc atctgctgct 3240 tggtgcacga taacttggtg cgtttgtcaa gcaaggtaag tgaacgaccc ggtcatacct 3300 tcttaagttc gcccttcctc cctttatttc agattcaatc tgacttacct attctaccca 3360 agcatcgat 3369 <210> 10 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Tnos-F <400> 10 ccgaattctt ggatccgatc gttcaaacat ttggca 36 <210> 11 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Tnos-R <400> 11 cccagatctg atctagtaac atagatgac 29 <210> 12 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> GFP-F <400> 12 ccgaattctt ggatccagta aaggagaaga actttt 36 <210> 13 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> GFP-R <400> 13 cccagatctctatttgtata gttcatcc 28 <210> 14 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> trpc-F <400> 14 ccgaattctt ggatcctcga cagaagatga tattgaa 37 <210> 15 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> trpc-R <400> 15 cccagatcta tcgatgcttg ggtagaata 29 <210> 16 <211> twenty four <212> DNA <213> Artificial Sequence <220> <223> Tu3-F <400> 16 cattcgcatc gtcattgttg gctc 24 <210> 17 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> 18S rRNA-F <400> 17 gagcccaagc actttgattt ct 22 <210> 18 <211> twenty one <212> DNA <213> Artificial Sequence <220> <223> 18S rRNA-R <400> 18 gcatttgcca aggatgtttt c 21 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> qPCR-GFP-F <400> 19 agttgtccca attcttgttg 20 <210> 20 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> qPCR-GFP-R <400> 20 tgtcttgtag ttcccgtca 19
Claims
1. A Cordyceps militaris P trpc An overlapping promoter library, characterized in that: The promoter library consists of promoters with nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO:
9.
2. Cordyceps militaris P according to claim 1 trpc An overlapping promoter library, characterized in that: The promoters of the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7 have successively increasing strengths in promoting the expression of the target gene; The promoters of the nucleotide sequences shown in SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9 have successively decreasing strengths for promoting the expression of the target gene.
3. A vector library, characterized in that: The vector library is composed of vectors containing the nucleotide sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9 as promoter elements.
4. A genetically engineered recombinant strain library, characterized in that: The recombinant strain library consists of recombinant strains whose genomes are integrated with nucleic acids having nucleotide sequences described in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO:
9.
5. The Cordyceps militaris P according to any one of claims 1 to 2 trpc Use of the overlapping promoter library, the vector library according to claim 3, or the recombinant strain library according to claim 4, characterized in that: To provide P trpc Overlapping promoters, the P trpc The overlapping promoter can be operably linked to the target gene to regulate the expression of the target gene.
6. A strong promoter, characterized in that: The strong promoter is 7 copies of P trpc promoter; The 7 copies of P trpc The promoter is the nucleotide sequence described in SEQ ID NO:
7.
7. A carrier, characterized in that: The vector contains the strong promoter according to claim 6.
8. A genetically engineered recombinant strain, characterized in that: The recombinant strain contains the vector according to claim 7, or a nucleic acid having the nucleotide sequence according to SEQ ID NO: 7 integrated into its genome.
9. Use of the strong promoter according to claim 6, the vector according to claim 7 or the recombinant strain according to claim 8 in expressing proteins in Cordyceps militaris.