A Thermobifida fusca cutinase mutant and method for its soluble expression
By performing amino acid mutation on Thermobifida fusca cutinase and co-expressing with DsbC, the problem of poor thermal stability of cutinase at the glass transition temperature of PET is solved, and efficient PET fiber modification and enzymatic decomposition effects are achieved.
Patent Information
- Application Number
- CN202080101956.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2020-06-10
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2040-06-10
AI Technical Summary
Thermobifida fusca cutinase has poor thermal stability at the glass transition temperature of PET, affecting its catalytic efficiency.
Mutations of amino acids at positions 61, 89, 204 and 253 of the cutinase are introduced, and co-expressed with periplasmin disulfide bond oxidoreductase DsbC, which stabilizes the catalytic triangle and N-terminal domains and improves thermal stability.
The mutant maintains high catalytic activity at the glass transition temperature of PET, achieving effective modification of PET fibers, and improving the hydrophilicity and enzymatic efficiency of the fibers.
Smart Images
Figure CN116171323B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a Thermobifida fusca cutinase mutant and a method for its soluble expression, belonging to the technical field of enzyme engineering. Background Art
[0002] Thermobifida fusca cutinase belongs to the α / β hydrolase family. The β-sheet is located in the center and surrounded by α-helices and loop regions on all sides, forming a sandwich structure. The active center consists of a catalytic triad of Ser-His-Asp and it is a multifunctional enzyme that can hydrolyze macromolecular polyesters, insoluble triglycerides and small molecule soluble esters. In addition, T. fusca cutinase can also catalyze the esterification reactions of various acids and alcohols, as well as the transesterification reactions of esters and alcohols. The characteristic difference between cutinase and lipase is that there is no "lid" structure covering the active center of cutinase, and the catalytic key amino acid Ser is exposed to the solvent. Therefore, some cutinases can also hydrolyze high molecular weight polyester PET (Polyethylene terephthalate). However, PET is highly crystalline, which reduces the accessibility of cutinase to the polyester chains in PET and seriously affects the catalytic efficiency of cutinase. After reaching the glass transition temperature (69 - 80 °C), the molecular chain movement of PET intensifies, forming many voids, increasing the accessibility between the enzyme molecule and the active center, and the catalytic effect becomes more obvious.
[0003] The existing T. fusca cutinase in the prior art cannot maintain its activity under the conditions of the glass transition temperature of PET. Therefore, improving the thermal stability of T. fusca cutinase is an urgent problem to be solved for industrial production. Summary of the Invention
[0004] An object of the present invention is to provide a cutinase mutant with strong thermal stability. Based on the cutinase shown in SEQ ID NO.1, the amino acids at at least one of the following sites are mutated: position 61, position 89, position 204, position 253.
[0005] In one embodiment, the cutinase mutant is (a) or (b):
[0006] (a) Based on the cutinase shown in SEQ ID NO.1, the 61st and 89th positions are mutated into cysteine, and the amino acid sequence of the obtained mutant is as shown in SEQ ID NO.2;
[0007] (b) Based on the cutinase shown in SEQ ID NO.1, the 204th glutamate and the 253rd aspartic acid are mutated into cysteine, and the amino acid sequence of the obtained mutant is as shown in SEQ ID NO.3.
[0008] The second object of the present invention is to provide a gene encoding the cutinase mutant.
[0009] In one embodiment, the gene encoding the mutant D204C / E253C contains the nucleotide sequence shown in SEQ ID NO.4.
[0010] The third object of the present invention is to provide an expression vector carrying the said gene.
[0011] In one embodiment, the expression vector is a plasmid of the pET series.
[0012] In one embodiment, the expression vector is pSCDsbC, and its nucleotide sequence is as shown in SEQ ID NO.5.
[0013] The fourth object of the present invention is to provide a microbial cell expressing the cutinase mutant.
[0014] In one embodiment, the microbial cell is Escherichia coli.
[0015] In one embodiment, the Escherichia coli is E.coli BL21, E.coli BL21(DE3), E.coli JM109, E.coli DH5α or E.coli TOP10.
[0016] The fifth object of the present invention is to provide a method for soluble expression of the cutinase mutant, which is to co-express the cutinase mutant with the periplasmic protein disulfide oxidoreductase DsbC.
[0017] In one embodiment, the amino acid sequence of the periplasmic protein disulfide oxidoreductase DsbC is as shown in SEQ ID NO.6.
[0018] In one embodiment, the method is to separately ligate the gene encoding the cutinase mutant and the gene encoding the periplasmic protein disulfide oxidoreductase to a vector and transform them into a microbial cell for expression.
[0019] In one embodiment, the method further adds an RBS sequence of a ribosome binding site upstream of the gene.
[0020] In one embodiment, the method uses the plasmid pSC as an expression vector and E.coli Origami B(DE3) as a host to co-express the cutinase mutant and the periplasmic protein disulfide oxidoreductase.
[0021] In one embodiment, the nucleotide sequence of the plasmid pSC is as shown in SEQ ID NO.7.
[0022] The sixth object of the present invention is to provide the application of the cutinase mutant in the chemical industry or textile field.
[0023] In one embodiment, the application is to modify PET fibers or their fabrics.
[0024] In one embodiment, the modification is to carry out an enzymatic hydrolysis reaction on PET fibers with the cutinase mutant at a dose of 10 U / g substrate, and the bath ratio is 1:40; the enzymatic hydrolysis reaction is carried out at 80 °C.
[0025] In one embodiment, Triton X-100 with a final concentration of 0.5-2% is further added to the enzymatic hydrolysis reaction.
[0026] Beneficial effects:
[0027] 1. In the present invention, glutamate at position 204 and aspartic acid at position 253 near the catalytic triangle are selected to be mutated into cysteine to introduce a pair of disulfide bonds to stabilize the catalytic triangle; positions 61 and 89 are mutated into cysteine to form a pair of disulfide bonds to stabilize the N-terminal domain of cutinase, so that the cutinase mutant has high thermal stability. The mutant can catalyze the hydrolysis of the ester bond of PET fibers under the reaction conditions of the glass transition temperature (Tg) of PET to achieve the purpose of hydrophilic modification.
[0028] 2. In view of the defect that due to the introduction of disulfide bonds, the mutant D204C / E253C is prone to misfold and form a large number of inclusion bodies during expression, and the soluble expression ratio is extremely low, the present invention provides a method for soluble expression of the mutant D204C / E253C. By co-expressing the mutant D204C / E253C and the periplasmic protein disulfide oxidoreductase DsbC in the Escherichia coli mutant strain E. coli Origami B(DE3), the abnormal disulfide bonds are isomerized to achieve high-efficiency soluble expression. Description of the drawings
[0029] Figure 1 It is the SDS-PAGE diagram of different proteins; among them, M is the protein molecular weight standard; lanes 1-3 in (A) are respectively the extracellular supernatant, cell wall lysate supernatant, and cell wall lysate precipitate of the recombinant bacterium E. coli BL21(DE3) / pET-20b(+)-cut, and lanes 4-6 are respectively the extracellular supernatant, cell wall lysate supernatant, and cell wall lysate precipitate of the recombinant bacterium E. coli BL21(DE3) / pET-20b(+)-T61C / T89C; lanes 1-3 in (B) are respectively the extracellular supernatant, cell wall lysate supernatant, and cell wall lysate precipitate of the recombinant bacterium E. coli BL21(DE3) / pET-20b(+)-D204C / E253C.
[0030] Figure 2SDS-PAGE patterns of purified wild-type cutinase and mutants; where M is the protein molecular weight standard; lane 2 is wild-type T. fusca cutinase, lanes 3 and 4 are both mutants T61C / T89C, and lanes 5 and 6 are both mutants D204C / E253C.
[0031] Figure 3 Cutinase and mutant enzyme activities at different temperatures; where WT is the wild enzyme.
[0032] Figure 4 Thermal stabilities of mutant D204C / E253C at 80 °C (A) and 90 °C (B) respectively.
[0033] Figure 5 Absorbance values at 240 nm of the residual solutions treated with wild-type cutinase and mutant D204C / E253C.
[0034] Figure 6 Differences in the wettability of PET fibers treated with different cutinases.
[0035] Figure 7 Electron micrographs of PET fibers under different treatment conditions; where (A) and (B) are electron micrographs of PET fibers treated with buffer at 50 °C; (C) and (D) are electron micrographs of PET fibers treated with wild-type cutinase at 50 °C; figures (E) and (F) are electron micrographs of PET fibers treated with buffer at 80 °C; (H) and (G) are electron micrographs of PET fibers treated with mutant D204C / E253C at 80 °C.
[0036] Figure 8 Construction process of recombinant plasmid pSCDsbC-D204C / E253C.
[0037] Figure 9 Double digestion verification of recombinant plasmid pSCDsbC-D204C / E253C; M: 5000 bp DNA marker; 1: sample.
[0038] Figure 10Expression of recombinant strains E. coli BL21(DE3) / pET20b-D204C / E253C and E. coli Origami B(DE3) / pSCDsbC-D204C / E253C; (A) Expression of pET20b-D204C / E253C in host E. coli BL21(DE3); (B) Expression of pSCDsbC-D204C / E253C in host E. coli Origami B(DE3); M: Protein Marker molecular weight standard (10 - 200 kDa); Lanes 1, 2, and 3 represent extracellular supernatant, cell wall lysate supernatant, and cell wall lysate precipitate, respectively. Detailed implementation mode
[0039] Enzyme activity assay method: The activity of cutinase was determined by continuous spectrophotometry. The reaction system was 1.5 mL, including 30 μL of appropriately diluted enzyme solution and 1470 μL of 10 mmol·L -1 sodium deoxycholate and 50 mmol·L -1 pNPB in 10 mmol·L -1 Tris-HCl buffer (pH 8.0), and the generation rate of p-nitrophenol was recorded at 405 nm.
[0040] Enzyme activity definition: At 37 °C, the amount of enzyme required to hydrolyze p-nitrophenyl butyrate to generate 1 μmol of p-nitrophenol per minute is defined as one enzyme activity unit.
[0041] Thermal stability analysis method: The enzyme solution was appropriately diluted with 10 mmol·L -1 Tris-HCl (pH 8.0) buffer, and then incubated at 90 °C for 10 min. The enzyme activity of the enzyme solution before and after incubation was accurately measured. During the analysis, the cutinase enzyme activity before incubation was expressed as 100%, and based on this standard, the residual enzyme activity of cutinase after incubation was calculated to determine the thermal stability of cutinase at 90 °C.
[0042] Example 1 Preparation of mutant enzymes and wild enzymes.
[0043] (1) Site-directed mutagenesis: Using the rapid PCR technique, based on the gene sequence of cutinase from Thermobifida fusca (NCBI database accession number: AAZ54921.1), and using plasmids pET20b(+)-cut and pET24a(+)-cut carrying the cutinase gene as templates (the plasmids are disclosed in the paper "Gene Identification, High-Level Expression, and Molecular Modification of Cutinase from Thermobifida fusca"), primers were designed and synthesized respectively for site-directed mutagenesis of the cutinase gene (underlined bases are the mutated bases).
[0044] (a) Using the plasmid pET20b / cut carrying the cutinase gene as a template:
[0045] The site-directed mutagenesis primers introducing the T61C mutation in the sequence are:
[0046] Forward primer: GCGGTGGCGATCTCCCCCGGCTACTGTGGCACTGAGGCT
[0047] Reverse primer: CCAGGCGATGGAAGCCTCAGTGCCACAGTAGCCGGGGGA
[0048] The site-directed mutagenesis primers introducing the T89C mutation in the sequence are:
[0049] Forward primer: GTCATCACCATCGACACCATCACCTGTCTCGACCAGCCG
[0050] Reverse primer: TGCCCGGCTGTCCGGCTGGTCGAGACAGGTGATGGTGTC
[0051] The site-directed mutagenesis primers introducing the D204C mutation in the sequence are:
[0052] Forward primer: ATCAGCAAGGCCTACCTGGAGCTG TGT GGCGCAACCCAC
[0053] Reverse primer: GTTCGGGGCGAAGTGGGTTGCGCC ACA CAGCTCCAGGTA
[0054] The site-directed mutagenesis primers introducing the E253C mutation in the sequence are:
[0055] Forward primer: CGCGACGGACTCTTCGGCGAGGTC TGT GAGTACCGCTCC
[0056] Reverse primer: GAACGGGCAGGTGGAGCGGTACTC ACA GACCTCGCCGAA
[0057] (b) Using the plasmid pET24a / cut carrying the cutinase gene as a template:
[0058] The site-directed mutagenesis primers introducing the D204C mutation in the sequence are:
[0059] Forward primer: GCCTATCTGGAACTGTGTGGTGCCACCCATTTTGCCCCG
[0060] Reverse primer: CGGGGCAAAATGGGTGGCACCACACAGTTCCAGATAGGC
[0061] The site-directed mutagenesis primer for introducing the E253C mutation of sequence E is as follows:
[0062] Forward primer: CTGTTCGGCGAAGTGTGTGAATACCGCAGC
[0063] Reverse primer: GCTGCGGTATTCACACACTTCGCCGAACAG
[0064] The PCR reaction system is as follows: 10 μL of 5×PS buffer, 4 μL of dNTPs Mix (2.5 mM), 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 1 μL of template DNA, 0.5 μL of Prime STAR HS DNA polymerase (5 U / μL), and double-distilled water is added to make up to 50 μL. The PCR amplification conditions are as follows: pre-denaturation at 94°C for 4 min; then 30 cycles (98°C for 10 s, 58°C for 5 s, 72°C for 6 min); continued extension at 72°C for 10 min. The PCR product is digested with Dpn I (Fermentas), transformed into competent Escherichia coli JM109 cells. After the competent cells are cultured overnight on LB solid medium (containing 100 μg / mL ampicillin / carbenicillin), single colonies are picked and cultured in LB liquid medium (containing 100 μg / mL ampicillin / carbenicillin), and then the plasmid is extracted and sequenced.
[0065] (2) Expression and purification of mutant enzyme and wild enzyme: The plasmid with correct sequencing of the mutation (for the wild enzyme, the template plasmid is directly used) is transformed into competent cells of the expression host Escherichia coli BL21(DE3). Single colonies transformed into the expression host Escherichia coli BL21(DE3) are picked and grown in LB liquid medium (containing 100 μg / mL ampicillin) for 8 - 10 h. The seed fermentation broth is inoculated into TB liquid medium (containing 100 μg / mL ampicillin) at an inoculation amount of 4%. Escherichia coli is cultured in a shaker at 37°C until OD 600 = 0.6 - 0.8, IPTG with a final concentration of 0.01 mM is added to induce extracellular expression, and the fermentation is continued in a shaker at 25°C for 48 h. Then, the fermentation broth is centrifuged at 4°C and 10,000 rpm for 15 min to remove the bacteria, and the supernatant is collected.
[0066] To the supernatant obtained by the above method, 70% (w / v) solid ammonium sulfate was added, and after salting out overnight at 4°C, it was centrifuged at 10,000 rpm for 20 min. The precipitate was taken and dissolved in an appropriate amount of buffer A (20 mmol / L Tris-HCl, pH 8.0), and dialyzed overnight in buffer A. The dialyzed sample was centrifuged at 12,000 rpm for 20 min, and then filtered through a 0.45 μm membrane to prepare a sample for loading. After pre-equilibrating the DEAE-Sepharose FF anion exchange column with buffer A, the sample was loaded, and then the unbound components were washed away with buffer A. Then, a linear gradient elution was performed with a mixture of buffer A and buffer B (buffer A containing 1 M NaCl) at a flow rate of 1 mL / min throughout the process. The detection wavelength was 280 nm, and the eluate with an absorption peak was collected for cutinase activity and protein electrophoresis detection. The enzyme activity fraction was further separated and purified through a monoQ pre-packed anion exchange column under similar conditions as above, and finally a purified product was obtained through cutinase activity and protein electrophoresis detection (as Figure 2 shown).
[0067] Example 2 Thermal stability analysis of wild-type cutinase and its mutants
[0068] Using 10 mmol / L Tris-HCl (pH 8.0) buffer, the cutinase activity was measured at intervals of 10°C in the range of 20 - 90°C to determine the optimal temperature of the enzyme. The highest enzyme activity was counted as 100%, and the relative enzyme activity at each temperature was calculated. The results are as Figure 3 shown. At 70°C, the enzyme activities of the wild enzyme and the mutant enzyme were both the highest, reaching 56 U·mL -1 and 9 U·mL -1 respectively; at 90°C, the relative enzyme activity of the mutant enzyme was 92.2%, and that of the wild enzyme was 8.7%.
[0069] In 10 mmol / L Tris-HCl (pH 8.0) buffer, the mutant D204C / E253C was incubated at 80°C and 90°C respectively, and samples were taken regularly to measure the residual enzyme activity to determine the thermal stability of the enzyme. The results showed that the wild-type cutinase was inactivated after incubation at 80°C and 90°C for 10 min, and the residual enzyme activity was 10.7% after incubation at 70°C for 10 min.
[0070] The half-life of the mutant D204C / E253C could reach 16 h at 80°C, and even had 55.6% activity after incubation at 90°C for 10 min ( Figure 4 ). This indicates that the mutant D204C / E253C has good thermal stability at 80°C and 90°C.
[0071] Example 3 Modification treatment of PET fibers with cutinase
[0072] (1) Enzyme modification: After washing 1 g of polyester fabric (PET fiber) in a 60 °C water bath with shaking for 30 min, place it in a phosphate buffer solution (pH 7.0) according to a bath ratio of 1:40. Take the supernatant of the fermentation culture solution of the cutinase or cutinase mutant prepared in Example 1 with an enzyme content of 400 U and add it to the above-mentioned treatment solution to make the final enzyme concentration of cutinase 10 U / mL. Optionally, a fiber penetrant Triton X-100 with a final concentration of 1% is also added to the enzymatic hydrolysis system. Seal the entire system and place it in a water bath thermostatic oscillator for 24 h. After the treatment is completed, take out the fabric and wash it thoroughly with distilled water at 60 °C.
[0073] (2) UV absorbance test for the hydrolysis products of polyester and PET film: Dilute the residual solutions treated with wild-type cutinase and mutants by 10 times. Use a UV spectrophotometer to measure the UV absorbance values of the residual solutions treated with cutinase at 240 nm at different treatment times. The blank sample is the cutinase treatment solution without adding polyester fiber under the same conditions.
[0074] Under the condition of 80 °C, the absorbance value of the residual solution treated with mutant D204C-E253C at 240 nm is 3.13 times that of mutant D204C-E253C under the condition of 50 °C and 3.24 times that of the wild type under the condition of 50 °C ( Figure 5 ).
[0075] (3) Wettability: After washing the PET fibers treated with cutinase clean, put them into an oven for drying. Lay the dried PET fibers flat and open, and then equilibrate the PET fibers for 24 h under constant temperature and humidity conditions of 25 °C and 65% relative humidity. Then use a pipette to suck 20 μL of deionized water droplets onto the PET fibers. Nine different areas need to be continuously dropped on the same piece of PET fiber. During this process, record the time from when the water droplet just touches the PET fiber to when the water droplet completely immerses into the PET fiber, and then take the average value of these data. The results are as Figure 6 shown. In the presence of Triton X-100, the wettability of the PET fibers treated with mutant D204C / E253C is increased by 1.62 times compared with that of the wild-type T. fusca cutinase.
[0076] (4) SEM analysis of the surface microscopic morphological changes of PET fibers caused by enzyme treatment: Enzyme treatment causes changes in the surface microscopic morphology of PET fibers. Take SEM pictures of the PET fibers treated with enzymes, and the surface morphology of the fibers is as Figure 7 shown. Figure 7 (A) and (B) are the electron microscope pictures of the PET fibers treated with the buffer solution at 50 °C. It can be seen from the figure that the surface of the PET fibers is clear and smooth. Figure 7(C) and (D) are electron micrographs of wild-type cutinase after treatment at 50 °C. It can be seen that there are obvious etching marks on the fiber surface. Figure 7 (E) and (F) are electron micrographs of PET fibers treated with 80 °C buffer. It can be seen from the figure that the surface of the PET fiber is clear and smooth. Figure 7 (H) and (G) are electron micrographs of the mutant D204C / E253C after treatment at 80 °C. It can be seen that there are obvious etching marks on the fiber surface, and the etching marks on the surface of the PET fiber treated with the mutant D204C / E253C are more and more obvious than those of the wild-type cutinase. This indicates that the mutant D204C / E253C is more effective in modifying PET fibers than the wild-type cutinase.
[0077] Example 4 Construction and high soluble expression of recombinant bacterium E. coli Origami B(DE3) / pSCDsbC-D204C / E253C.
[0078] (1) Construction of recombinant bacterium E. coli Origami B(DE3) / pSCDsbC-D204C / E253C
[0079] The plasmid pET-20b(+)-D204C / E253C was double digested and gel recovered. The recovered mutant D204C / E253C gene was ligated to the cloning vector pSCDsbC at 16 °C, and then transferred into E. coli JM109. After overnight culture on the plate, single colonies were picked and cultured for about 10 h. The two recombinant plasmids were extracted and verified by enzyme digestion respectively. The detailed construction process is as Figure 8 .
[0080] After enzyme digestion verification, two bands appeared in the electrophoresis. One band was about 783 bp, which was the mutant D204C / E253C gene, and the other band was about 6001 bp, which was the pSCDsbC vector ( Figure 9 ). The plasmid with correct enzyme digestion verification was sent for sequencing, and the sequencing result was correct. Therefore, the construction was successful.
[0081] (2) Expression of recombinant bacterium E. coli Origami B(DE3) / pSCDsbC-D204C / E253C
[0082] The plasmid pSCDsbC-D204C / E253C was extracted and transformed into E. coli Origami B(DE3) competent cells. Then the above-mentioned competent cells were spread on an LB plate with ampicillin resistance. Single colonies were picked and inoculated into 10 mL of LB liquid medium. After 8 - 10 h of culture, they were transferred to 50 mL of TB medium with ampicillin resistance at an inoculation amount of 5%. Cultured at 37 °C until OD600 When it reached 1 to 1.5 hours, IPTG with a final concentration of 0.4 mmol·L -1 was added while the temperature was lowered to 25 °C for induction expression for 24 h. Identified by SDS-PAGE, the results were as Figure 10 shown.
[0083] By electrophoresis analysis, compared with the expression of wild-type cutinase pET20b-cut in the host E.coli BL21(DE3) ( Figure 1 (A)), a large number of inclusion bodies were formed during the expression of the mutant pET20b-D204C / E253C in the host E.coli BL21(DE3) ( Figure 1 (B)). This was due to the abnormal folding of the mutant D204C / E253C, which led to the formation of intermolecular disulfide bonds, and the mutant aggregated in large amounts in the form of dimers to form inclusion bodies. In addition, the expression of the mutant pET20b-D204C / E253C in the host E.coli Origami B(DE3) was the same as that in the host E.coli BL21(DE3). The soluble expression of the mutant pSCDsbC-D204C / E253C in the host E.coli Origami B(DE3) was greatly improved ( Figure 10 ). There were two obvious bands between 25 - 35 kD in lane 1, which were the cutinase mutant D204C / E253C with a molecular weight of 28.2 kD and DsbC with a molecular weight of 25 kD respectively. The presence of DsbC could isomerize the intermolecular disulfide bonds formed by misoxidation. The results proved that the co-expression of the mutant D204C / E253C and the molecular chaperone protein DsbC in the Escherichia coli mutant strain E.coli Origami B(DE3) enabled the correct folding and expression of the mutant D204C / E253C.
[0084] The recombinant bacterium E.coli Origami B(DE3) / pSCDsbC-D204C / E253C was fermented in TB medium at 25 °C for 24 h. The cutinase mutant in the fermentation broth was collected, and the thermal stability of the extracellular enzyme obtained by expression was measured according to the method of Example 3. The results are shown in Table 1.
[0085] Table 1 Enzyme activity of the extracellular enzyme of the recombinant bacterium E.coli Origami B(DE3) / pSCDsbC-D204C / E253C after flask fermentation at 25 °C for 24 h and its thermal stability at 90 °C
[0086]
[0087] By comparing the enzyme activity of wild-type T. fusca cutinase in E. coli BL21(DE3) with that of mutants D204C / E253C in two expression systems (E. coli BL21(DE3), E. coli Origami B(DE3)) (Table 1), the enzyme activity of E. coli Origami B(DE3) / pSCDsbC-D204C / E253C is 6.8 times that of E. coli BL21(DE3) / pET20b-D204C / E253C, and its thermal stability at 90 °C is basically the same as that of E. coli BL21(DE3) / pET20b-D204C / E253C. Construction of cutinase mutants at different sites in the comparative examples
[0088] According to the same strategy as in Example 1, mutations were made at different sites respectively, and the mutated cutinase was expressed according to the method of Example 1. The primers are as follows:
[0089] Table 2 Different mutation sites and primers
[0090]
[0091]
[0092] After cell disruption, the enzyme activity was measured, and the residual enzyme activity after incubation at 70 °C for 10 min was measured. The results are shown in Table 3.
[0093] Table 3 Enzyme activity and thermal stability of different mutant enzymes
[0094]
[0095] Note: a, The activity of the mutant against pNPB was not detected; b, There was no residual enzyme activity.
[0096] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various modifications and decorations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.
Claims
1. A cutinase mutant with strong thermal stability, characterized in that, The amino acid sequence is as shown in SEQ ID NO.
3.
2. A gene encoding the cutinase mutant according to claim 1.
3. The gene according to claim 2, wherein The nucleotide sequence of the gene encoding mutant D204C / E253C is as shown in SEQ ID NO.
4.
4. An expression vector carrying the gene according to claim 2 or 3.
5. The expression vector according to claim 4, characterized in that, The expression vector is a plasmid of the pET series.
6. The expression vector according to claim 4, characterized in that, The expression vector is pSCDsbC, and its nucleotide sequence is as shown in SEQ ID NO.
5.
7. A microbial cell expressing the cutinase mutant according to claim 1.
8. The microbial cell according to claim 7, wherein The microbial cell is Escherichia coli.
9. The microbial cell according to claim 8, wherein The Escherichia coli is E. coli BL21, E. coli BL21(DE3), E. coli JM109, E. coli DH5α or E. coli TOP10.
10. A method for soluble expression of the cutinase mutant according to claim 1, characterized in that, Co-express the cutinase mutant according to claim 1 with the periplasmic protein disulfide oxidoreductase DsbC; the amino acid sequence of the periplasmic protein disulfide oxidoreductase DsbC is as shown in SEQ ID NO.
6.
11. The method according to claim 10, wherein The method is to separately ligate the gene encoding the cutinase mutant and the gene encoding the periplasmic protein disulfide oxidoreductase to a vector and transform them into a microbial cell for expression.
12. The method according to claim 10, characterized in that The method also adds an RBS sequence of a ribosome binding site upstream of the gene.
13. The method according to claim 10, wherein Using plasmid pSC as the expression vector and E.coli Origami B (DE3) as the host, co-express the cutinase mutant and the periplasmic protein disulfide oxidoreductase.
14. The method according to claim 13, characterized in that The nucleotide sequence of the plasmid pSC is as shown in SEQ IDNO.
7.
15. Use of the cutinase mutant according to claim 1 in the chemical industry or textile field.
16. A method for modifying PET fibers or their fabrics, characterized in that, Perform enzymatic hydrolysis on PET fibers at 50 - 80 °C with the cutinase mutant according to claim 1 at a dose of ≥10 U / g substrate.