Cladosporium subuliforme wz-1 and its cultivation method and application

Abstract

The present invention relates to a Cladosporium subuliformewz‑1 and a cultivation method and application thereof, specifically a Cladosporium subuliformewz‑1 and a cultivation method thereof and an application thereof in the prevention and control of citrus psyllids. In the present invention, Cladosporium subuliformewz‑1 is separated from citrus psyllid dead insects that died naturally in the wild, and was deposited in the Guangdong Provincial Microbiological Culture Collection Center on March 17, 2022, with a preservation address of 5th Floor, Building 59, No. 100, Xianlie Middle Road, Guangzhou, and a preservation number of GDMCC No. 62319. Cladosporium subuliformewz‑1 can be cultured through PDA culture medium, and the spores produced by its growth can be used to prevent and control citrus psyllids, which is environmentally friendly and reduces pesticide residues.

Description

[Technical field]

[0001] The invention belongs to the technical field of biological control, and relates to a Cladosporium subuliforme wz-1 and a cultivation method and application thereof, and more specifically to a Cladosporium subuliforme wz-1 and a cultivation method thereof and application thereof in the control of citrus psyllids. [Background technology]

[0002] Citrus Huanglongbing (HLB) is the most serious and destructive disease in the citrus industry. As early as the 18th century, there were records of suspected symptoms of Huanglongbing in central and northeastern India, which was called "tip dieback". At present, citrus Huanglongbing has been found in 11 provinces and regions in my country. Because of its rapid spread, incurable and destructive characteristics, it seriously threatens the development of my country's citrus industry. At present, the prevention and control of citrus Huanglongbing mainly adopts the "three-axe" comprehensive prevention and control technology, namely planting non-toxic seedlings, controlling citrus psyllids, and promptly cutting down diseased plants. Among them, the prevention and control of citrus psyllids can effectively control the spread of citrus Huanglongbing among plants.

[0003] The Asian citrus psyllid (Diaphorina citri kuwayama, hereinafter referred to as citrus psyllid) belongs to the order Hemiptera, family Psyllidae, and is the main vector insect that spreads citrus Huanglongbing in nature. At present, the main method for controlling citrus psyllid is chemical control. Due to the strong reproductive capacity and serious generation overlap of citrus psyllid, unscientific use of pesticides has led to increased resistance to pesticides and increased control costs. In the context of the national reduction of pesticides and fertilizers, biological control methods for citrus psyllid are very important.

[0004] A common method of biological control of pests is to use the pathogens of pests to control them. There are many microorganisms that are pathogenic to insects in nature, most of which are insect pathogenic fungi. It is reported that the fungi that are lethal to citrus psyllids include: Hirsutella citriformis, Paecilomyces varioti, Paecilomyces fumosoroseus, Beauveria bassiana, Acrostalagmus aphidium, Hirsutella citriformis, Paecilomyces varioti, Paecilomyces fumosoroseus, Fusarium culmorum and Lecanicillium lecanii, but most of them have limited control effects on citrus psyllids, and it is necessary to find and screen more highly effective biocontrol fungi for citrus psyllids. [Summary of the invention]

[0005] In view of the deficiencies in the prior art, the present invention provides a Cladosporium subuliforme wz-1 and a cultivation method and application thereof, and more specifically, provides a Cladosporium subuliforme wz-1 and a cultivation method thereof and application thereof in the control of citrus psyllids.

[0006] The technical solution of the present invention is as follows:

[0007] A biocontrol fungus used to control citrus psyllids is a Cladosporium strain, specifically the Cladosporium subuliforme wz-1 strain, which was deposited in the Guangdong Provincial Microbiological Culture Collection on March 17, 2022. The collection address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and the collection number is GDMCC No. 62319.

[0008] The above Cladosporium subuliforme wz-1 strain was isolated from a citrus psyllid dead insect that died naturally in the wild. When observed on solid culture medium, the colony was gray-olive, flocculent, fluffy, with regular or slightly undulating white edges, and the aerial hyphae were abundant, sparse, fluffy, and free of exudates; the back was dark olive-gray, with grooves and folds in the center that penetrated deep into the agar, and the edges were narrow and white; under transmission electron microscopy, the hyphae were slightly branched, 1-4 μm wide, with septa, usually forming branched spores, and cylindrical; the conidia were light-colored, chain-shaped, and lemon-shaped;

[0009] The ITS gene sequence of the above Cladosporium subuliforme wz-1 strain is shown in SEQ ID NO.1;

[0010] The TEF gene sequence is shown in SEQ ID NO.2;

[0011] The Actin gene sequence is shown in SEQ ID NO.3.

[0012] The method for culturing the above Cladosporium subuliforme wz-1 strain comprises the following steps:

[0013] (1) Preparation of PDA culture medium: PDA culture medium Difco TM According to the configuration method in the manual, add 39g of dry powder per liter of ultrapure water and sterilize in an autoclave at 121℃;

[0014] (2) A bacterial cake of Cladosporium subuliforme wz-1 was inoculated on PDA medium and incubated upside down at 26°C for 5-8 days with alternating light and dark conditions of 14 h light and 10 h dark until the colonies covered the entire surface of the medium.

[0015] The application of the Cladosporium subuliforme wz-1 strain in the control of citrus psyllids is as follows:

[0016] (1) Preparation of Cladosporium subuliforme wz-1 spore suspension: Scrape spores from the cultured Cladosporium subuliforme wz-1 colonies and place them in 0.05% (v / v) Tween-80, stir well and filter out the hyphae with filter paper to prepare a conidia suspension, and confirm its concentration using a hemocytometer;

[0017] (2) Dilute the conidia suspension with water to a concentration of 1×10 7 spores / mL, loaded into a spray device and sprayed directly on citrus plants, can effectively control citrus psyllids on citrus plants.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] 1. The Cladosporium subuliforme wz-1 strain described in the present invention is an insect pathogenic fungus, which is used to control citrus psyllids, has little impact on the environment, and reduces pesticide residues.

[0020] 2. So far, there is no report on Cladosporium subuliforme as a pathogenic fungus for controlling insects. Therefore, Cladosporium subuliforme wz-1 is a novel insecticidal fungus.

[0021] 3. The Cladosporium subuliforme wz-1 strain described in the present invention is an insecticidal fungus with strong toxicity to citrus psyllids and good insecticidal effect, as shown by toxicity experiments. Therefore, Cladosporium subuliforme wz-1 is an efficient biocontrol fungus for citrus psyllids with promotion potential.

Brief Description of the Drawings

[0022] Figure 1 This is a photo of the morphological observation of Cladosporium subuliforme wz-1 in the embodiment of the present invention;

[0023] Figure 2 A diagram of the BI phylogenetic tree of the strain Cladosporium subuliforme wz-1 and other related species of Cladosporium constructed based on the three DNA fragment sequences of ITS, TEF and Actin in the embodiment of the present invention;

[0024] Figure 3 The figure is a comparison of the mortality rates of Cladosporium subuliforme wz-1 in the examples of the present invention and other reported biocontrol bacteria against citrus psyllids. [Specific implementation method]

[0025] The specific implementation modes of the present invention are further described below in conjunction with examples.

[0026] Embodiment 1:

[0027] Isolation and identification of strains

[0028] The specific steps are as follows:

[0029] 1. Isolation and purification of entomogenous fungi

[0030] The entomogenous fungus is derived from the dead citrus psyllids collected by the inventor from the unmanaged citrus orchard in Gaotian Town, Yanshan District, Guilin City, and separated and purified indoors. The specific steps are as follows:

[0031] (1) Preparation of PDA culture medium: PDA culture medium Difco TM According to the configuration method in the manual, add 39g of dry powder per liter of ultrapure water and sterilize in an autoclave at 121℃;

[0032] (2) Isolation and purification of entomogenous fungi: The dead insects of citrus psyllids collected from the field were placed in a disinfected clean bench, and the fungal spores and hyphae on the dead insects were picked up and cultured on PDA solid culture medium. The culture dish was inverted and placed in an incubator at 26°C, 80% humidity, and 12:12 light:dark ratio for 3 days. After the colonies were formed, the edges of the uncontaminated colonies were picked up and re-inoculated on the PDA culture medium until there were no foreign bacteria, thereby obtaining purified citrus psyllid pathogenic fungi.

[0033] 2. Koch's postulates verify entomogenous fungi

[0034] The isolated entomogenous fungi were inoculated onto healthy citrus psyllid adults by using a spray tower spray method, and then the dead insects were placed in a sterile culture dish containing moist filter paper and cultured in an incubator at a temperature of 26°C and a humidity of 80% for 5 to 8 days, during which hyphae and spores grew on the insect bodies. The fungi grown on the test insect corpses were separated and purified, and a conidia suspension was made and sprayed on healthy test insects. After the test insects died, the above-mentioned moisturizing method was repeated, and the test insects grew similar fungi, which were separated and purified to obtain entomogenous fungi that were completely consistent with those of the test insects.

[0035] 3. Identification of Cladosporium subuliforme wz-1

[0036] (1) Morphological observation of entomogenous fungi

[0037] Macroscopic morphological observation: In a clean bench, the conidia of the isolated and purified entomogenous fungi were inoculated onto the PDA medium in a single point form, placed upside down in a 26°C incubator for 3 days, and photographed with a camera (see Figure 1 );

[0038] Microscopic morphological observation: a small amount of hyphae was placed in a 1.5 mL centrifuge tube containing 0.05% (v / v) Tween-80, and the spores on the sporangium were washed off by vortexing; the washed hyphae and spores were prepared on a glass slide and examined by a super-depth three-dimensional microscope system;

[0039] (2) Molecular Biological Identification

[0040] Fungal DNA extraction: Take about 0.5g of entomogenous fungal hyphae and place them in a 1.5mL sterile centrifuge tube and grind them thoroughly at low temperature. Use the Fungal Genomic DNA Rapid Extraction Kit produced by Beijing Huayueyang Biotechnology Co., Ltd. to extract the entomogenous fungal hyphae DNA and amplify the extracted DNA; the PCR reaction system is shown in Table 1:

[0041] Table 1 PCR reaction system

[0042]

[0043] PCR amplification of the proposed DNA: The primers used are universal amplification primers for ITS rDNA nucleic acid fragments, TEF nucleic acid fragments and Actin nucleic acid fragments, wherein the primer pair for amplifying the TEF nucleic acid fragment is:

[0044] EF1-526F: 5-GTCGTYGTYATYGGHCAYGT-3,

[0045] EF1-1567R: 5-ACHGTRCCRATACCACCRATCTT-3, annealing temperature 56°C;

[0046] The primer pair for amplifying ITSrDNA nucleic acid fragment is:

[0047] ITS1:5-TCCGTAGGTGAACCTGCGG-3,

[0048] ITS4: 5-TCCTCCGCTTATTGATATGC-3, annealing temperature 52°C;

[0049] The primer pair for amplifying the actin nucleic acid fragment is:

[0050] ACT-512F: 5-ATGTGCAAGGCCGGTTTCGC-3,

[0051] ACT-783R: 5-TACGAGTCCTTCTGGCCCAT-3, annealing temperature 58°C;

[0052] PCR amplification system (25 μL): ddH 2 O18.3μL, 10×Buffer2.5μL, TaqTMmix1μL, dNTP2μL, upstream primer0.5μL, downstream primer0.5μL, DNA1μL;

[0053] PCR amplification program: 94°C, 5 min; 94°C, 40 s; specific primer pair annealing temperature, 40 s; 72°C, 1 min; 35 cycles; 72°C, 10 min; 4°C, storage; after amplification, 1.5% agarose gel electrophoresis was performed and the electrophoresis results were detected using a gel imager; PCR product recovery and purification were referred to the instructions of the QIAquick Gel Extraction Kit; finally, the purified recovered DNA was stored at -20°C for future use;

[0054] DNA sequencing and phylogenetic tree construction: The purified and recovered DNA was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing, see Table 2; the sequenced sequences were Blast aligned on the NCBI website, and the phylogenetic tree was constructed using the software Phylosuite Bayesian method (see Figure 2).

[0055] Through morphological identification, the characteristics of the entomogenous fungi isolated from the dead citrus psyllids in the wild are as follows: on PDA solid culture medium, the colonies are gray-olive, flocculent, fluffy, with white edges, regular or slightly undulating, and the aerial hyphae are abundant, sparse, fluffy, and without exudates; the back is dark olive gray, with grooves and wrinkles in the center, deep into the agar, and narrow white edges; through transmission electron microscopy, the hyphae are slightly branched, 1-4μm wide, with septa, usually forming branched spores, cylindrical; conidia are light-colored, chain-shaped, and lemon-shaped. Through gene sequence cluster analysis, it was found that this entomogenous fungus and Cladosporium are clustered into one branch. Therefore, through morphological identification and molecular identification, it was determined that this entomogenous fungus is Cladosporium subuliforme, named and numbered wz-1, and preserved in Guangdong Microbial Culture Collection Center, with the preservation address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and the preservation number is GDMCC No.61081.

[0056] Embodiment 2:

[0057] Cultivation of strains and their application in the control of citrus psyllids

[0058] The specific steps are as follows:

[0059] 1. Cultivation of Cladosporium subuliforme wz-1 strain

[0060] (1) Preparation of PDA culture medium: PDA culture medium Difco TM According to the configuration method in the manual, add 39g of dry powder per liter of ultrapure water and sterilize in an autoclave at 121℃;

[0061] (2) A bacterial cake of Cladosporium subuliforme wz-1 was inoculated on PDA medium and incubated upside down at 26°C for 5-8 days with alternating light and dark conditions of 14 h light and 10 h dark until the colonies covered the entire surface of the medium.

[0062] 2. Application of Cladosporium subuliforme wz-1 strain in the control of citrus psyllids

[0063] (1) Preparation of conidial fluid of Cladosporium subuliforme wz-1

[0064] The conidia of cultured Cladosporium subuliforme wz-1 were scraped off the PDA culture medium with a sterile spore scraper and refrigerated at 4°C for future use; before use, they were dissolved in 0.05% (v / v) Tween-80, stirred with a magnetic stirrer for 30 minutes and then filtered to remove mycelium and agar residue to prepare conidia mother solution; the concentration of the mother solution was determined with a hemocytometer; the spore solutions used in the test were obtained by diluting the mother solution step by step with 0.05% Tween-80; the activity of the fungus was tested before each use.

[0065] Detection method: Take 10 μL of conidia mother liquid and drop it on PDA culture medium, spread it evenly with a sterilized triangular stick, place it in an incubator (temperature 26°C, relative humidity 80%, light L12:D12) for 12 hours, and then detect the germination of spores under a microscope; a total of three locations were detected, with 100 spores detected in each location, and those with obvious germ tubes were considered to have germinated; the germination rates of the spores used in the test were all higher than 90%.

[0066] 3. Toxicity determination of Cladosporium subuliforme wz-1 against citrus psyllid

[0067] The prepared conidia stock solution was diluted to a concentration of 1×10 7 / mL, 5×10 6 / mL, 1×10 6 / mL, 5×10 5 / mL and 1×10 5 The test insects were kept in disposable plastic cups filled with fresh citrus leaves and placed in a constant temperature incubator (temperature 26°C, relative humidity 80%, light:darkness 12:12); 30 test insects were used in each treatment and control group; the number of dead insects was recorded every 12 hours for 5 consecutive days, and the number of surviving insects was finally recorded; after the investigation, the dead insects were picked out and placed in a culture dish with wet filter paper, and the number of dead insects was observed and recorded after 8 days; each treatment was repeated 3 times, with 0.05% Tween-80 solution as the control; the fungal toxicity was calculated using PoloPlus software.

[0068] Comparison was made with three known biocontrol bacteria, and it was found that Cladosporium subuliforme wz-1 had a good biological control effect. After 5 days of treatment, LC 50 is 3.215×10 6 Pieces / mL.

[0069] 1×10 7After 5 days of treatment with a spore suspension of Cladosporium subuliforme wz-1, the corrected mortality of citrus psyllids was 73.1% (see Figure 3 ), and its biological control effect is better than that of Verticillium lecanii and Aspergillus aculeatus.

[0070] 4. ITS, TEF, and Actin sequences of Cladosporium subuliforme wz-1:

[0071] ITS (552 bp), as shown in SEQ ID NO.1:

[0072] TCCGTAGGTGAACCTGCGGAGGGATCATTACAAGTGACCCCGGTCTAACCACCGGGATGTTCATAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTTCGGGCGGGGGCTCCGGGTGGACACTTCA AACTCTTGCGTAACTTTGCAGTCTGAGTAAACTTAATTAATAAATTAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATC ATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCAACGCGGTCCGCCGCGTGCCTCAAATCGACCGGCTGGGTCTT CTGTCCCCTAAGCGTTGTGGAAACTATTCGCTAAAGGGTGTTCGGGAGGCTACCGCCGTAAAACAACCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

[0073] TEF (1058 bp), as shown in SEQ ID NO. 2:

[0074] ACAGTGCCGATACCACCAATCTTGTAGACATCCTGGAGGGGAAGACGGAGGGGCTTGTCGGTGGGACGGGTGGGGGGGTCGATGGCGTCAATGGCCTCAAGGAGGGTCTTGCCGGTGGCCTTGGCCTTGGTCTCCTTCTCCCAACCCTTGTACCAGGGGCAGTTGGTGGAGACGTCGATCATGTTGTCACCGTTGAAACCGGAGATGGGCACGAAGGGAACGTGCTTGGGGTTGAAGCCGACCTTCTTGATGAAACCGGAGGTCTCCTTGATGATCTCCTGGTAACGGGCCCCAGACCACTTGGTGGTGTCCATCTTGTTGATGGCAACGATGAGCTGCTTGACACCGAGGGTGTAGGCGAGAAGAGCGTGCTCACGGGTCTGACCGTCCTTGGAGATACCGGCCTCGAACTCACCAGTACCGGCGGCAATGATGAGAATGGCGCAGTCAGCCTGGGAGGTACCAGTGATCATGTTCTTGATGAAATCACGGTGACCGGGGGCGTCAATGACGGTGACGTTGTACCTGTAGTGGGTGAGGTTAGCTGGTGTGCTTCTGCTTGTCGTGTCTGTTAAACTTACTTGGGAGTCTCGAACTTCCAGAGGGCGATATCGATGGTGATACCACGCTCACGCTCGGACTTCAGCTTGTCGAGGACCCATGCGTACTTGAAGGAACCCTTGCCGAGTTCGGCGGCTTCCTGTTGTGGTTGTCAGTGATTTGTTTCGCGGTGTGGTGATGGTGGCAATGCTGTCTTGTCG

[0075] ACT (232 bp), as shown in SEQ ID NO.3:

[0076] ATGTGCAAGGCCGGTTTCGCCGGTGACGATGCGCCCAGAGCCGTTTTCCGTAAGTCTGAAGACACCTGTTTCGCCCATCCCGCAATTCCCAGCTGACACCCATCCCAGCTTCCATCGTCGGCAGACCCCGTCACCATGGGTATGCATTTTCCCTGCGATCCCCTCTATCGCGCGCAGCCAATTCTAACCCCTCCGCAGTATCATGATCGGTATGGGCCAGAAGGACTCGTAA

[0077] The above description is only a preferred embodiment of the present invention. It should be pointed out that it is possible for a person skilled in the art to make several improvements and changes without departing from the creative concept of the present invention, and these all fall within the protection scope of the present invention.

Claims

1. One plant Cladosporium subuliforme wz-1 strain, characterized in that: It is a strain of Cladosporium, isolated from a citrus psyllid that died naturally in the wild. It was deposited in the Guangdong Provincial Microbiological Culture Collection Center on March 17, 2022. The collection address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, and the collection number is GDMCC No. 62319.

2. A plant according to claim 1 Cladosporium subuliforme The method for culturing the wz-1 strain is characterized in that: Here are the steps: (1) Preparation of PDA culture medium: Use PDA culture medium Difco from BD Company, USA TM According to the configuration method, add 39g of dry powder per liter of ultrapure water and sterilize in an autoclave at 121℃; (2) Take Cladosporium subuliforme The bacterial cake of wz-1 strain was inoculated on PDA medium, inverted and cultured at 26℃ for 5-8 days. The light and dark conditions were set to alternate between 14 hours of light and 10 hours of darkness until the colonies covered the entire surface of the medium.

3. A plant according to claim 1 Cladosporium subuliforme The application of wz-1 strain in the control of citrus psyllid is characterized by: Here are the steps: (1) Preparation Cladosporium subuliforme wz-1 spore suspension: put the cultured Cladosporium subuliforme Spores of the wz-1 colony were scraped and placed in 0.05% v / v Tween-80, stirred and the hyphae were filtered out with filter paper to prepare a conidial suspension, and its concentration was confirmed using a hemocytometer; (2) Dilute the conidia suspension with water to a concentration of 1×10 7 spores / mL, loaded into a spray device, and sprayed directly on citrus plants to control citrus psyllids on citrus plants.

Images