A phosphorus-accumulating Acinetobacter strain SXO-5 and its application

Abstract

The invention discloses a phosphorus-accumulating acinetobacter strain SXO-5 and its application. The strain is a phosphorus-accumulating bacterium, and its taxonomic name is acinetobacter sp. SXO-5, and its preservation number is CGMCC No. 25518, and it has been preserved in the China General Microbiological Culture Collection Management Center. The acinetobacter strain SXO-5 is used as a phosphorus-accumulating bacterium in biological phosphorus removal from water. The strain is easy to culture and multiply; and has a good phosphorus removal rate, which can reach 64.1-71.5% under suitable conditions, significantly exceeding the phosphorus removal rate of existing phosphorus-accumulating bacteria.

Description

Technical Field

[0001] This invention belongs to the field of environmental microbiology technology and relates to a polyphosphate-accumulating Acinetobacter strain SXO-5 and its applications. Background Technology

[0002] Phosphorus is an essential nutrient for plant growth, and phosphorus pollution can lead to eutrophication of water bodies. Therefore, biological phosphorus removal technologies are commonly used to effectively reduce phosphorus levels in water bodies, preventing water quality deterioration and aquatic environmental imbalance. Commonly used biological phosphorus removal processes include A / O, Phostrip, A2O, inverted A2O, and SBR. The microorganisms responsible for phosphorus removal are called polyphosphate-accumulating organisms (PAOs), which are bacteria with anaerobic phosphorus release and aerobic (or anoxic) superphosphate uptake characteristics. Researchers have already screened out various bacteria with phosphorus accumulation capabilities from environmental media such as soil and water. These include Acinetobacter, Staphylococcus, Aeromonas, Pseudomonas, Microthrix, and Moraxella Fulton. However, their phosphorus removal rates are not high, and further research is needed to investigate the effects of different conditions on the phosphorus removal rates of these strains.

[0003] The A2O process is a typical wastewater nitrogen and phosphorus removal process, consisting of three reaction zones: anaerobic, anoxic, and aerobic. In the anaerobic zone, polyphosphate-accumulating bacteria hydrolyze intracellular polyphosphates (Poly-P) into orthophosphates, releasing them extracellularly and acquiring energy. They then use this energy to absorb readily degradable COD from the wastewater to synthesize poly(β-hydroxybutyrate) (PHB), an energy storage substance. Under aerobic conditions, polyphosphate-accumulating bacteria use free oxygen as an electron acceptor to oxidize the intracellularly stored PHB. Utilizing the energy generated from this reaction, they excessively absorb phosphates from the wastewater, synthesizing high-energy substances ATP and Poly-P. In this process, the aerobic phosphorus uptake exceeds the anaerobic phosphorus release, achieving highly efficient phosphorus removal through the discharge of excess sludge. Summary of the Invention

[0004] The problem solved by this invention is to provide a polyphosphate-accumulating Acinetobacter strain SXO-5 and its application. This strain is a polyphosphate-accumulating bacterium screened from the sludge of the aerobic tank in the A2O process, which can provide excellent bacterial resources for biological phosphorus removal processes.

[0005] This invention is achieved using the following technical solution:

[0006] An polyphosphate-accumulating Acinetobacter sp. SXO-5 strain, taxonomically named Acinetobacter sp. SXO-5, with accession number CGMCC No. 25518, has been deposited at the China General Microbiological Culture Collection Center.

[0007] This strain is a Gram-positive bacterium; its cells turn blue after methylene blue staining.

[0008] The strain grows into round, off-white, opaque colonies on solid isolation medium, with a moist, smooth surface and no protrusions.

[0009] The 16S rDNA sequence of this strain is shown in SEQ.ID.NO.1.

[0010] The phosphorus removal rate of this strain ranges from 66.7% to 59.6% at pH 6 to 9, with pH 7 being the optimal phosphorus removal condition.

[0011] The polyphosphate-accumulating Acinetobacter strain SXO-5 is used as a polyphosphate-accumulating bacterium in biological phosphorus removal from water.

[0012] The Acinetobacter strain SXO-5 is used as a polyphosphate-accumulating bacterium in the A2O process.

[0013] The conditions required for the Acinetobacter strain SXO-5 include a pH of 6–9 and a NaAC content of 3–9 g / L.

[0014] The required conditions for the Acinetobacter strain SXO-5 are pH 7 and NaAC content of 5 g / L.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The polyphosphate-accumulating bacteria Acinetobacter sp. SXO-5 of this invention was isolated from the sludge of the aerobic tank in the A2O process. It can effectively reduce the phosphorus content in wastewater and provide excellent strain resources for the A2O biological phosphorus removal process. In the early stage of cultivation (0-12h), this strain exhibits an exponential growth trend, is in the logarithmic growth phase, grows rapidly, and has vigorous metabolism. During the 12-20h static cultivation period, the growth of strain SXO-5 slows down. During the 20-50h aerobic cultivation period, the growth rate is greater than that during the static period, making it easy to cultivate and propagate. Moreover, it has a good phosphorus removal rate, which can reach 64.1-71.5% under suitable conditions, significantly exceeding the phosphorus removal rate of existing polyphosphate-accumulating bacteria.

[0017] Preservation Instructions

[0018] The strain provided in this invention is taxonomically named Acinetobacter sp. SXO-5, with accession number CGMCC No. 25518. It was deposited on August 10, 2022, at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The collection center's testing results indicate it is viable. Attached Figure Description

[0019] Figure 1 The colony morphology of strain SXO-5 on solid culture medium;

[0020] Figure 2 Gram staining image of strain SXO-5;

[0021] Figure 3 Phylogenetic tree of strain SXO-5;

[0022] Figure 4 The growth curve of strain SXO-5 is shown. Detailed Implementation

[0023] The present invention will be further explained and described below with reference to the accompanying drawings and embodiments.

[0024] The polyphosphate-accumulating Acinetobacter strain SXO-5 provided by this invention is a polyphosphate-accumulating bacterium screened from the sludge of the aerobic tank in the A2O process, which can provide an excellent strain resource for the A2O biological phosphorus removal process. The phosphorus removal conditions of the screened polyphosphate-accumulating bacterium SXO-5 were optimized to obtain the culture conditions under which SXO-5 exerts its maximum phosphorus removal capacity. This has important reference value for the study of polyphosphate-accumulating bacteria characteristics and the improvement of phosphorus removal rate.

[0025] Example 1: Screening and identification of Acinetobacter sp. SXO-5, a polyphosphate-accumulating bacterium

[0026] (1) Source of strain

[0027] The bacterial strains used in this invention are derived from activated sludge in the aerobic tank of the A2O process;

[0028] The activated sludge was taken from the Suxi Wastewater Treatment Plant in Yiwu City on July 23, 2021.

[0029] (2) Culture medium

[0030] ① Aerobic liquid culture medium (pH=7): KH2PO4, 135-140 mg / L; K2HPO4, 245 mg / L; (NH4)2SO4, 140 mg / L; CaCl2·2H2O, 14 mg / L; MgSO4·7H2O, 180 mg / L; trace element solution, 0.4 ml / L; vitamin solution, 1 ml / L.

[0031] ② Anaerobic liquid culture medium (pH=7): NaAC, 4g / L; (NH4)2SO4, 140mg / L; CaCl2·2H2O, 14mg / L; MgSO4·7H2O, 180mg / L; trace element solution, 0.4ml / L; vitamin solution, 1ml / L.

[0032] ③LB solid medium (pH=7): tryptone, 10 g / L; NaCl, 10 g / L; yeast extract, 5 g / L; agar, 15 g / L.

[0033] ④ Solid separation culture medium (pH=7): NaAC, 4 g / L; KH2PO4, 0.18 g / L; K2HPO4, 0.32 g / L; (NH4)2SO4, 1.5 g / L; CaCl2·2H2O, 0.15 g / L; MgSO4·7H2O, 1.7 g / L; trace element solution, 4 ml; vitamin solution, 10 ml / L; agar, 15 g / L. After sterilization, pour the culture medium onto plates and allow it to cool. Spread 80 μl of 5-bromo-4-chloro-3-indole-phosphate (BCIP) solution (20 mg BCIP dissolved in 1 ml dimethylformamide) onto the plates and allow it to stand for 1.5 h for absorption. Polyphosphate-accumulating bacteria turn blue upon contact with BCIP, which can be used for preliminary screening.

[0034] ⑤ Phosphorus removal capacity test medium (pH=7): NaAC, 5g / L; NH4Cl, 0.4g / L; beef extract, 0.2g / L; tryptone, 0.4g / L; trace element solution, 2ml / L; KH2PO4, 0.1g / L.

[0035] ⑥ Trace element solution: FeCl3·6H2O, 1.5 g / L; H3BO3, 0.15 g / L; CuSO4·5H2O, 0.04 g / L; MgSO4·7H2O, 0.18 g / L; KI, 0.18 g / L; MnCl2·4H2O, 0.13 g / L; Na2MO4·2H2O, 0.06 g / L; ZnSO4·7H2O, 0.12 g / L; CoCl2·6H2O, 0.15 g / L.

[0036] ⑦ Vitamin solution: Vitamin B1, 50 mg / L; Vitamin B2, 50 mg / L; Vitamin B6, 100 mg / L; Vitamin B12, 2 mg / L; Folic acid, 10 mg / L; Niacin, 50 mg / L; Calcium pantothenate, 50 mg / L; Para-aminobenzoic acid, 50 mg / L; Biotin, 21 mg / L;

[0037] All culture media were sterilized at 121°C for 20 min and then cooled to room temperature before use.

[0038] (3) Domestication and enrichment

[0039] Centrifuge the collected activated sludge, discard the supernatant, place the precipitate in a 250ml saline bottle containing 100ml aerobic liquid culture medium, and incubate at 30℃ and 120r for 23h with shaking, let stand for 1h, centrifuge at 6000r for 20min, and discard the supernatant.

[0040] The sludge sediment was transferred to a saline bottle containing 100 mL of anaerobic liquid culture medium, and nitrogen was purged for 10 min to ensure that the dissolved oxygen in the bottle was below 0.1 mg·L⁻¹. -1 Incubate at 30℃ for 24 hours.

[0041] Following the above cultivation method, aerobic and anaerobic alternating cultivation is carried out for 5 cycles to complete the domestication and enrichment.

[0042] (4) Screening and purification

[0043] The acclimated and enriched activated sludge was centrifuged at 6000 rpm for 20 min, the supernatant was discarded, and the sludge precipitate was washed with sterile water. Then, it was diluted with sterile physiological saline (0.9%) to concentrations of 10, 2×10, 4×10, and 10, respectively. 2 2×10 2 10 3 10 4 Diluted the culture medium with BCIP and spread it onto solid isolation medium plates covered with BCIP. Incubate at 30°C for 2–3 days until blue colonies appear. Select single colonies that have turned distinctly blue and exhibit inconsistent morphology and perform streak plating on four zones of the BCIP isolation plate.

[0044] Repeat this process 3-4 times for screening and purification until colonies on each plate appear blue and have a uniform morphology.

[0045] The phosphorus removal capacity of the strains obtained after final screening and purification was tested, and one strain with obvious polyphosphate accumulation effect was selected and named SXO-5.

[0046] (5) Strain identification

[0047] Methylene blue staining solution: Methylene blue 1g / L; glacial acetic acid, 50ml / L; 95% ethanol, 50ml / L.

[0048] After screening and purification, the strain was cultured in phosphorus removal capacity test medium at 30℃ and 120 rpm for 24 h, centrifuged at 6000 rpm for 20 min, the supernatant was discarded, the bacterial pellet was washed with sterile water, and the bacterial cells were diluted with 0.2 ml of sterile water. 10 μl of the diluted bacterial solution was smeared and stained with methylene blue for 2 min. After washing off the stain, the bacteria were fixed with an alcohol lamp flame for microscopic examination. The bacteria appeared blue, further confirming that strain SXO-5 is an polyphosphate-accumulating bacterium.

[0049] Strain SXO-5 was identified as a Gram-positive bacterium by Gram staining (e.g. Figure 2 (As shown).

[0050] The genomic DNA of this strain was extracted and used as a template. The 16S rDNA sequence of this strain was obtained by PCR amplification.

[0051] Upstream primer: AGAGTTTGATCCTGGCTCAG;

[0052] Downstream primer: GGTTACCTTGTTACGACTT;

[0053] PCR reaction mixture (25 μl):

[0054]

[0055] PCR amplification program: denaturation at 98℃ for 10 s, annealing at 55℃ for 45 s, extension at 72℃ for 1 min; 30 cycles, with a final extension at 72℃ for 4 min. PCR amplification products were detected by 1% agarose gel electrophoresis.

[0056] The SXO-5 16S rDNA sequence is shown in SEQ ID NO.1.

[0057] Homology analysis of strain SXO-5 and its 16S rDNA sequences was performed using BLAST in GenBank. A phylogenetic tree of this strain was constructed using MEGA 7 software (e.g., ...). Figure 3 As shown in the figure, the results showed that the strain had 99% similarity to Acinetobacter sp., confirming that SXO-5 belongs to Acinetobacter sp.

[0058] Example 2: Determination of the growth curve of Acinetobacter sp. SXO-5

[0059] Preparation of seed culture: Single colonies of strain SXO-5 grown on LB solid medium were picked and inoculated into LB liquid medium, and cultured at 30℃ and 120 rpm for 24 h. The bacterial culture was then diluted with sterile water to OD. 595 =0.7, to be used.

[0060] Growth curve determination: 2% seed culture was inoculated into a 250ml saline bottle containing 100ml of phosphorus removal capacity testing medium, and aerobically cultured at 30℃ and 120r for 12h, then allowed to stand for 8h, and continued aerobic culture for 40h. OD was measured every 4h. 595 .

[0061] The growth curve of strain SXO-5 was obtained as follows: Figure 4 As shown.

[0062] The test results showed that the strain exhibited an exponential growth trend in the early stage of culture (0–12 h), indicating a rapid growth rate and vigorous metabolism during the logarithmic growth phase. During the static culture period of 12–20 h, the growth of strain SXO-5 slowed down. During the aerobic culture period of 20–50 h, the growth rate increased compared to the static period, but decreased compared to the early growth stage. After 50 h, the growth rate of strain SXO-5 plateaued, and the OD... 595 It remains basically unchanged, tending towards a period of stability and decline.

[0063] Example 3: Optimization of polyphosphate accumulation conditions for Acinetobacter sp. SXO-5

[0064] Phosphorus removal rate calculation formula: η=(P C -P S ) / P C ×100%, where η is the phosphorus removal rate (%); P C The blank represents the phosphorus concentration (mg / L); P S The phosphorus concentration (mg / L) of the sample.

[0065] (1) The seed liquid of strain SXO-5 was obtained according to the seed liquid preparation method in Example 2.

[0066] (2) Single-factor experiment

[0067] The effects of pH, trace elements, and sodium acetate (NaAC) content on the phosphorus removal rate of Acinetobacter sp. SXO-5 were investigated. A blank control group without strain SXO-5 was included in the experiment (the culture medium composition was the same as that used in the phosphorus removal capacity test in Example 1).

[0068] ① Effect of pH on phosphorus removal rate of polyphosphate-accumulating bacteria Acinetobacter sp. SXO-5: The pH of the phosphorus removal capacity test medium was adjusted to 5, 6, 7, 8 and 9 in sequence, while other culture conditions were kept consistent with those of the phosphorus removal capacity test medium in Example 1.

[0069] ② Effect of trace element content on phosphorus removal rate of polyphosphate-accumulating bacteria Acinetobacter sp. SXO-5: The trace element content of the phosphorus removal capacity test medium was adjusted to 0, 1, 2, 3 and 4 ml / L respectively, while other culture conditions were kept consistent with the phosphorus removal capacity test medium composition in Example 1.

[0070] ③ Effect of NaAC content on phosphorus removal rate of Acinetobacter sp. SXO-5: The NaAC content of the phosphorus removal capacity test medium was adjusted to 3, 5, 7 and 9 g / L respectively, while other culture conditions were kept consistent with the phosphorus removal capacity test medium in Example 1.

[0071] Following the culture method for growth curve determination in Example 2, 5 ml of cultured bacterial solution was placed in a centrifuge tube and centrifuged at 6000 r for 20 min. The supernatant was then filtered through a 0.22 μm sterile filter. The phosphorus content was determined using a SpectroDirect spectrophotometer and the matching total phosphorus measurement reagent. The phosphorus removal rate of the strain was calculated according to the phosphorus removal formula for different pH, trace element content, and NaAC content.

[0072] (3) Test results

[0073] The effects of pH, trace elements, and NaAC content on the phosphorus removal rate of strain SXO-5 are shown in Tables 1, 2, and 3, respectively.

[0074] Table 1 Effect of pH value on phosphorus removal rate of strain SXO-5

[0075]

[0076] Table 2. Effects of trace element content on phosphorus removal rate of strain SXO-5

[0077]

[0078] Table 3 Effect of NaAC content on phosphorus removal rate of strain SXO-5

[0079]

[0080]

[0081] As shown in Table 1, the phosphorus removal rate of strain SXO-5 was low at pH=5. As the pH increased (6-9), the phosphorus removal rate first increased and then decreased. The maximum phosphorus removal rate was 71.5% at pH=7.

[0082] As shown in Table 2, the phosphorus removal rate of strain SXO-5 did not change much, and the maximum phosphorus removal rate was 70.4% when the trace element content was 0.

[0083] As shown in Table 3, the phosphorus removal rate of strain SXO-5 reached a maximum of 64.1% when the NaAC concentration was 5 g / L.

[0084] Strain SXO-5 was screened from activated sludge in the aerobic tank of the A2O process. The results indicate that factors affecting its phosphorus removal rate include pH, the amount of trace elements added, and the NaAC content. pH and NaAC content have a significant impact, while the amount of trace elements added has a smaller effect on phosphorus removal. Therefore, to ensure that strain SXO-5 exhibits better phosphorus removal performance, its growth conditions need to be controlled.

Claims

1. A polyphosphate-accumulating Acinetobacter strain SXO-5, characterized in that, This strain is an polyphosphate-accumulating bacterium, taxonomically named Acinetobacter sp. SXO-5, with accession number CGMCC No. 25518, and has been deposited at the China General Microbiological Culture Collection Center.

2. The polyphosphate-accumulating Acinetobacter bacillus strain SXO-5 as described in claim 1, characterized in that, This strain is a Gram-positive bacterium; its cells turn blue after methylene blue staining. The strain grows into round, off-white, opaque colonies on solid isolation medium, with a moist, smooth surface and no protrusions.

3. The polyphosphate-accumulating Acinetobacter bacillus strain SXO-5 as described in claim 1, characterized in that, The 16S rDNA sequence of this strain is shown in SEQ.ID.NO.

1.

4. The polyphosphate-accumulating Acinetobacter bacillus strain SXO-5 as described in claim 1, characterized in that, The phosphorus removal rate of this strain ranges from 66.7% to 59.6% at pH 6 to 9, with pH 7 being the optimal phosphorus removal condition.

5. The application of the polyphosphate-accumulating Acinetobacter strain SXO-5 as described in claim 1 as a polyphosphate-accumulating bacterium in biological phosphorus removal from water.

6. The application as described in claim 5, characterized in that, The application of Acinetobacter strain SXO-5 as polyphosphate-accumulating bacteria in the A2O process.

7. The application as described in claim 5, characterized in that, The conditions required for Acinetobacter strain SXO-5 include a pH of 6–9 and a NaAC content of 3–9 g / L.

8. The application as described in claim 5 or 7, characterized in that, The conditions required for Acinetobacter strain SXO-5 are pH 7 and NaAC concentration of 5 g / L.