Pathogen-specific nucleic acid genes of proteus mirabilis and detection methods

Abstract

The application discloses a pathogen-specific nucleic acid gene of Proteus mirabilis and a detection method, the nucleotide sequence of the pathogen-specific nucleic acid gene is at least a part of any sequence in the sequence table Seq ID No:4-Seq ID No:10 or a complementary sequence thereof. A PCR reaction is carried out by taking clinical sample DNA as a template, a forward primer in amplification primers used in the PCR reaction is SEQ ID NO:1, a reverse primer is SEQ ID NO:2, a target sequence of crRNA used in cooperation of the primer pair is indicated in SEQ ID NO:3, and detection is carried out by using LbCas12a, crRNA and ssDNA-reporter. The pathogen-specific nucleic acid fragment provided by the application can be used for rapid identification of the pathogen of Proteus mirabilis, and has high accuracy and short detection period when applied in clinic.

Description

TECHNICAL FIELD

[0001] The present application relates to a pathogen-specific nucleic acid gene of Proteus mirabilis and a detection method, and belongs to the technical field of genetic engineering. BACKGROUND

[0002] Clinical antibiotic use depends on the identification of pathogenic bacteria to provide targeted medication guidance for doctors. The current clinical traditional pathogenic bacteria detection method is culture method, which identifies pathogenic bacteria species by collecting body fluid of patients and performing colony culture. This method is also the current gold standard for clinical microbiological testing. The culture method is complex to operate, 1) sterile operation to collect the body fluid sample of the patient; 2) transferring the body fluid sample to the corresponding sterile culture bottle for culture and inoculation to the flat plate culture dish; 3) picking single clone for staining microscopic observation, differential growth experiment on selective medium or various biochemical tests; 4) identifying according to the phenotypic characteristics and physiological characteristics of the pathogenic bacteria and providing data to the clinician. The traditional culture method is time-consuming (the above process takes 2-5 days), and some pathogenic bacteria have strict requirements for culture conditions, and culture may fail, resulting in detection failure. In addition, contamination often occurs during bacterial culture and isolation, resulting in false positive results. The above false positive and false negative cases often lead to misdiagnosis and misuse of antibiotics.

[0003] Among the main pathogenic Enterobacteriaceae, Proteus mirabilis is one of the least studied pathogenic bacteria to date. For a long time, researchers have always believed that Proteus mirabilis is a conditional pathogen that can cause symptomatic infections of the urinary tract, including cystitis and pyelonephritis, and is present in cases of asymptomatic bacteriuria, especially in the elderly and type 2 diabetes patients. These infections can also cause sepsis and develop into uremia that can be life-threatening. In addition, in addition to urinary tract infections, this species can also cause infections of the respiratory tract, eyes, ears, nose, skin, throat, burns and wounds, and is associated with neonatal meningitis, pulmonary edema and osteomyelitis. Some studies suggest that Proteus mirabilis is also associated with rheumatoid arthritis. For departments such as ICU, it is urgent to quickly and accurately obtain etiological information to timely and reasonably carry out antibacterial treatment to improve the clinical manifestations of patients and increase the cure rate. However, the current clinical pathogenic bacteria detection technology - traditional culture method still cannot meet the needs of clinical diagnosis and treatment. SUMMARY

[0004] The present application provides a pathogen-specific nucleic acid gene of Proteus mirabilis and a detection method.

[0005] Technical scheme: In order to achieve the above purpose, the technical scheme adopted by the present application is:

[0006] A pathogen-specific nucleic acid gene of Proteus mirabilis, a nucleotide sequence of which is at least a part of any one of the sequences of the sequence listing of Seq ID No: 4-Seq ID No: 10, or a complementary sequence thereof.

[0007] Preferably, the primers used for amplification include the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0008] Preferably, at least part of the sequence of the amplification product is used as the target sequence of the crRNA, and the target sequence of the crRNA includes the sequence shown in SEQ ID NO: 3.

[0009] A specific detection method of a pathogen-specific nucleic acid gene of Proteus mirabilis, comprising the following steps:

[0010] S101, specific detection: cross PCR reaction is performed on the amplification primers and the corresponding crRNA respectively;

[0011] The forward primer used in the amplification primers is SEQ ID NO: 1; the reverse primer used in the amplification primers is SEQ ID NO: 2; and the target sequence of the crRNA used in cooperation with the primer pair is shown in SEQ ID NO: 3.

[0012] S102, after the PCR reaction is completed, the detection is performed by agarose electrophoresis, and whether the primers are specific is judged according to whether there is an obvious bright band of the target DNA size in the gel map result.

[0013] A detection method of a pathogen-specific nucleic acid gene of Proteus mirabilis, comprising the following steps:

[0014] Step 1, extracting the DNA of a clinical sample containing Proteus mirabilis;

[0015] Step 2, performing cross PCR reaction on the clinical sample DNA obtained in step 1 to obtain an unpurified PCR reaction stock solution, and the forward primer used in the amplification primers is SEQ ID NO: 1; the reverse primer used in the amplification primers is SEQ ID NO: 2.

[0016] Step 3, detecting the unpurified PCR reaction stock solution by using LbCas12a, crRNA and ssDNA-reporter, and the target sequence of the crRNA used is shown in SEQ ID NO: 3; and then determining the detection result based on the fluorescence signal.

[0017] A kit for detecting a pathogen with a Proteus mirabilis pathogen-specific nucleic acid gene, comprising a forward primer in the amplification primer used in PCR reaction is SEQ ID NO: 1; a reverse primer in the amplification primer used is SEQ ID NO: 2; the target sequence of the crRNA used in cooperation with the primer pair is SEQ ID NO: 3;

[0018] The Crispr / Cas family nuclease with transcleavage activity, the crRNA with at least part of the sequence of the amplification product as the target sequence, and the single-stranded DNA reporter molecule with a fluorescent group and a quencher group at the 5' and 3' ends, wherein the Proteus mirabilis pathogen-specific nucleic acid fragment is selected from at least part of any one of SEQ ID NO: 4-10, or a complementary sequence thereof.

[0019] Preferably, the Crispr / Cas family nuclease is LbCas12.

[0020] Compared with the prior art, the present application has the following beneficial effects:

[0021] The pathogen-specific nucleic acid fragment provided by the present application can be used for rapid identification of pathogens, and has a high positive detection rate and a short detection period (e.g., less than 3 hours) when applied in clinical practice. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 A flowchart of the method for obtaining a pathogen-specific nucleic acid fragment described in the present application.

[0023] Figure 2 A schematic diagram showing the transcleavage activity of Cas12a.

[0024] Figure 3 An electrophoresis result diagram of the amplification product after conventional PCR amplification of the DNA template of various pathogens commonly seen in clinical practice using the primer pair SEQ ID NO: 1 and SEQ ID NO: 2 against Proteus mirabilis.

[0025] Figure 4 Fluorescent signal results of detection of different amplification products using LbCas12a and crRNA are shown. DETAILED DESCRIPTION

[0026] The present application will be further illustrated below in conjunction with the drawings and specific examples, and it should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application, and after reading the present application, various equivalent forms of the present application modified by those skilled in the art all fall within the scope defined by the claims attached hereto.

[0027] A method for obtaining a pathogen-specific nucleic acid gene of a Proteus mirabilis pathogen, comprising the steps of:Figure 1 As shown, the method comprises the following steps:

[0028] 1) Obtain whole genome sequences: Obtain whole genome sequences of hundreds of common microorganisms from public databases such as NCBI.

[0029] 2) Obtain intra-species common sequences of the same bacteria.

[0030] 3) Obtain inter-species specific sequences.

[0031] 4) Remove repetitive sequences: Use tools such as RepeatMasker to cover repetitive sequences.

[0032] In this way, we obtained the nucleotide sequences of Proteus mirabilis, which are shown in SEQ ID NO: 4-10, respectively.

[0033] After obtaining the sequences of these pathogen-specific nucleic acid fragments, they can be conveniently used for detecting various pathogens in patients or patient samples. The sequences of these pathogen-specific nucleic acid fragments can also be included in some detection kits, for example, as positive control products. It can be understood that in the detection process, the full length of the specific nucleic acid fragment (SEQ ID NO: 4-10) provided by the present application for Proteus mirabilis can be detected; or only a partial fragment thereof.

[0034] The CRISPR / Cas system is the most widely used gene editing system at present, which has the potential to target and cut nucleic acid molecules, achieving the purpose of site-directed editing. At present, multiple proteins containing editing potential have been identified in the Cas protein family, among which CRISPR / Cas9 and CRISPR / Cas12a are the most widely used. The composition of the CRISPR / Cas system is simple, which is composed of Cas protein with nucleic acid cleavage activity and crRNA. The guide RNA contains specific nucleic acid sequences of target genes. By changing the target gene sequence in crRNA, editing at different sites can be achieved. Also, by concatenating different crRNAs, simultaneous editing at multiple sites can be achieved. The crRNA guides the Cas protein to the target site, and the Cas protein cuts the target site to produce a break in the DNA strand, and then the corresponding DNA repair mechanism is activated, thereby introducing mutations and achieving the destruction of the target site.

[0035] In recent years, research has found that Cas12a has both 1) cis cleavage activity of targeting and cutting DNA, and 2) trans cleavage activity of non-specifically cutting any single-stranded DNA (see Figure 2). When the Cas12a-crRNA complex binds to the target site, the reverse cleavage activity of Cas12a will be triggered, and Cas12a has the ability to cut any single-stranded DNA molecules around it, and this activity is independent of the sequence of single-stranded DNA. The reverse cleavage activity can be used to cut single-stranded DNA after Cas12a binds to the target molecule, and the presence of single-stranded DNA proves the presence of the target molecule. The process is as follows: 1) using nucleic acid amplification technology to enrich the Proteus mirabilis specific nucleic acid fragments in the sample to be tested, and to improve the specificity; 2) using Cas12a and crRNA and single-stranded reporter DNA to detect the amplification product, if there is a Proteus mirabilis specific nucleic acid fragment in the amplification product, Cas12a will cut the reporter DNA to produce a fluorescent signal.

[0036] In some embodiments, the crRNA used in conjunction with Cas12crRNA consists of a 21 nt backbone and a 20-24 nt seed region / spacer for recognizing the target sequence. In more specific embodiments, the sequence of the crRNA synthesized by in vitro transcription is: 5'-AAUAGAACAUUCUAUCUUCAAUCUACACUUAGUAGAAAUUACCUAUAGUGAGUCGU AUUA-3' (SEQ ID NO: 11). In some embodiments, the corresponding crRNA can be obtained by in vitro transcription using T7 RNA polymerase with DNA as a template, and the pure crRNA can be obtained by purification.

[0037] One end of the single-stranded reporter DNA molecule has a fluorescent group modification, and the other end has a quencher group modification. Due to the presence of the quencher group, the complete single-stranded reporter DNA molecule does not produce a fluorescent signal, and when the reverse cleavage activity of Cas12a is triggered, the single-stranded reporter DNA molecule is cut, so that the quencher group and the fluorescent group are separated, and a fluorescent signal is produced. The presence or absence of a fluorescent signal or its intensity indicates the presence or absence of an amplification product or the amount of amplification product.

[0038] We first obtained the intraspecific DNA sequences specific to Proteus mirabilis, and designed and synthesized specific crRNA for targeted recognition of the pathogenic bacteria according to the sequences. Then, we expressed and purified the LbCas12a protein derived from Lachnospiraceae bacterium in E. coli, and verified that the protein has cis and trans cleavage activity. Subsequently, using single-stranded reporter DNA, LbCas12a protein and specific crRNA, and with the aid of PCR amplification technology, a CRISPR / Cas12a-based pathogenic bacteria detection method was developed, and its accuracy and specificity were verified. Finally, using the CRISPR / Cas12a-based pathogenic bacteria detection tool, rapid detection of clinical samples of patients with severe pneumonia was realized within 3 hours. The CRISPR / Cas12a-based pathogenic bacteria detection method provided by the application is expected to become a new type of rapid clinical pathogenic bacteria detection means, and provide important technical support for improving the diagnosis and treatment level of severe pneumonia.

[0039] In some embodiments of the application, the trans cleavage activity of Cas12a is utilized to detect pathogen-specific nucleic acid fragments or their amplification products, which further increases the specificity of the detection method due to the need for crRNA to be complementary to the target DNA.

[0040] The nucleic acid sequences mentioned in the application are as follows:

[0041] SEQ ID NO: 1 forward primer

[0042] CGCTGTATGGATTCGCTGAATTT

[0043] SEQ ID NO: 2 reverse primer

[0044] TTAACTTTTTCACGGCCTTATTCT

[0045] SEQ ID NO: 3 seed sequence

[0046] TGAAGATAGAATGTTCTATT

[0047] SEQ ID NO: 4 Proteus mirabilis-specific fragment

[0048]

[0049] SEQ ID NO: 5 Proteus mirabilis-specific fragment

[0050]

[0051] SEQ ID NO: 6 Proteus mirabilis specific fragment

[0052]

[0053] SEQ ID NO: 7 Proteus mirabilis specific fragment

[0054]

[0055] SEQ ID NO: 8 Proteus mirabilis specific fragment

[0056]

[0057] SEQ ID NO: 9 Proteus mirabilis specific fragment

[0058]

[0059] SEQ ID NO: 10 Proteus mirabilis specific fragment

[0060]

[0061] SEQ ID NO: 11 Proteus mirabilis crRNA sequence

[0062]

[0063] The present application is further illustrated by the following specific examples.

[0064] Example 1 Specificity verification of pathogenic bacteria detection method based on CRISPR / Cas

[0065] The pathogenic bacteria used for detection were all from the intensive care unit of Gulou Hospital, isolated and cultured from clinical samples of patients with severe pneumonia, and the strain species were determined by the Microbial Testing Department of Gulou Hospital (each pathogenic bacteria had two groups, respectively from different patients).

[0066] 1. Specificity test

[0067] In order to prove the specificity and reliability of the pathogenic bacteria detection method based on the CRISPR / Cas system, we performed cross detection experiments on the amplification primers and the corresponding crRNA, respectively.

[0068] 1.1 Primer specificity test

[0069] In order to clarify the specificity of the amplification primer, the amplification primer for Proteus mirabilis was respectively taken as the template with the genomic DNA extracted from Proteus mirabilis and other 11 kinds of pathogenic bacteria commonly seen in clinic, and cross PCR reaction was performed.

[0070] The forward and reverse primers used in the amplification primer are as follows:

[0071] SEQ ID NO: 1 and 2 are used for amplification of genomic DNA of Proteus mirabilis;

[0072] The target sequence (or seed region) of the crRNA used in cooperation with the above primer pair is shown in SEQ ID NO: 3.

[0073] The following shows an example of designing amplification primers and crRNA sequences using a specific nucleic acid fragment of the Proteus mirabilis pathogen, in which the sequences corresponding to the upstream primer and the downstream primer (SEQ ID NO: 1 and 2) are underlined, the target sequence of the crRNA (SEQ ID NO: 3) is underlined, and the PAM sequence is boxed.

[0074]

[0075] According to I-5 TM PCR was performed according to the instructions of Master Mix (TsingKe), in which I-5 TM 2X High-Fidelity Master Mix 25 μl, SEQ ID: 1 primer 2 μl, SEQ ID: 2 primer 2 μl, template DNA 50 ng, add water to 50 μl. Amplification was performed under the following program: 98°C for 2 min, (98°C for 10 s, 52°C for 10 s, 72°C for 15 s) for 30-35 cycles, 72°C for 5 min. The corresponding positive and negative controls were set for PCR amplification, respectively using the genomic DNA of the target pathogen and water as the amplification template.

[0076] After the PCR reaction, the specificity of the primers was judged according to whether there was a clear bright band of the target DNA size in the gel map.

[0077] 1.2 crRNA specificity test

[0078] The above crRNA designed for specific DNA sequences of the pathogen was used to detect the PCR product amplified by the corresponding primers, and 3 replicates were set for each sample. The reaction was as follows: 2 μl of PCR product / unpurified PCR reaction liquid in 1.1, 2 μl of reaction buffer, 1300 ng of LbCas12a, 180 ng of crRNA, 1 μl of ssDNA-reporter (10 μM), and add water to 20 μl.

[0079] The structure and sequence of the ssDNA-reporter are as follows: 5'-TTATT-3', the 5' end is FAM, and the 3' end is BHQ1.

[0080] The above reaction solution was added to a 384-well plate, and reacted at 37°C for 30-45 min. After the reaction was completed, the fluorescence value of each well was detected using an enzyme marker (Infinite M200 Pro multifunctional enzyme marker, Austria Tecan), and the detection parameters were set as follows:

[0081]

[0082]

[0083] 2. Experimental results

[0084] 2.1 Test results of primer specificity

[0085] As shown in Figure 3 , only a small amount of non-specific banding exists for individual non-target pathogens, but a large amount of target DNA product can be amplified when the corresponding pathogen genomic DNA is used as a template, indicating that the primer for amplifying Proteus mirabilis has good specificity.

[0086] 2.2 Test results of crRNA specificity

[0087] The above PCR reaction solution amplified by the corresponding primer was detected using LbCas12a and crRNA for Proteus mirabilis. Figure 4 The fluorescence results show that the detection system of Proteus mirabilis pathogen can only produce a clear fluorescence signal when the amplification product of PCR amplification using Proteus mirabilis pathogen genomic DNA as a template, and the fluorescence signal intensity of the rest of the non-target pathogens is consistent with the negative control, indicating that the binding with crRNA makes the specificity of this detection method very good.

[0088] Example 2: Detection of clinical samples of severe pneumonia patients using CRISPR / Cas system

[0089] 1. Experimental operation

[0090] The 12 clinical samples (sputum or alveolar lavage fluid) were all from the intensive care unit of Gulou Hospital, and were compared with the pathogen types determined by the traditional culture isolation detection method of the Microbial Testing Department of Gulou Hospital.

[0091] 1.1 Extraction of clinical sample DNA by kit method

[0092] The extraction of clinical sample DNA was completely in accordance with the Quick-DNA / RNA TM Pathogen Miniprep Kit (ZYMORESEARCH) product manual, and the operation steps are briefly described as follows:

[0093] a) Add 800 μL DNA / RNA Shield reagent to 50-200 μL sample, vortex for 60 s, and centrifuge at 16,000 x g for 1 min. b) Aspirate 200 μL supernatant, add 2 μl Proteinase K, mix well.

[0094] c) Add 1 ml Pathogen DNA / RNA buffer reagent, mix well, stand at room temperature for 5 min, and transfer to a DNA binding column. d) Centrifuge at 16,000 x g for 30 s, discard the filtrate.

[0095] e) Add 500 μl Wash buffer, centrifuge at 16,000 x g for 30 s, discard the filtrate. Repeat this step once.

[0096] f) Add 500 μl ethanol (95-100%), centrifuge at 16,000 x g for 1 min, transfer the DNA binding column to a new 1.5 ml centrifuge tube. g) Aspirate 50 μl 65°C DNase-free water to the middle of the centrifugal column, stand at room temperature for 2-5 min, centrifuge at 16,000 x g for 1 min, collect the eluate, which is the solution containing genomic DNA.

[0097] 1.2 PCR reaction amplifies target sequence

[0098] Using the total DNA extracted from the clinical sample as a template, PCR amplification reaction was performed using 1 pair of primers described in Example 1. The template used in the positive control group was the genomic DNA of Proteus mirabilis, and the template used in the negative control group was water.

[0099] The PCR reaction system and reaction conditions are the same as in Example 1.

[0100] 1.3 Cas12a detection

[0101] Unpurified PCR reaction stock solution was detected using LbCas12a, crRNA and ssDNA-reporter. For the same sample to be tested, 3 replicates were set up;

[0102] The detection reaction system and reaction conditions are the same as in Example 1.

[0103] 2. Experimental results

[0104] Twelve severe pneumonia patient clinical samples were amplified using 1 pair of amplification primers, followed by detection of the corresponding PCR reaction solution using single-stranded reporter DNA, LbCas12a and specific crRNA of Proteus mirabilis. The detection results based on the determination of fluorescence signals are shown in Table 1, and compared with the traditional culture method.

[0105] Table 1. Comparison of Proteus mirabilis detection results in 12 clinical bronchoalveolar lavage fluid samples.

[0106]

[0107] As shown in Table 1, *Proteus mirabilis* was detected in clinical samples 1 and 10 using CRISPR / Cas12a assay, while the remaining samples were negative. This result is consistent with the culture results and next-generation sequencing results.

[0108] In summary, compared to traditional detection methods that rely on pathogen isolation and culture, the method developed in this study is based on...

[0109] The CRISPR / Cas12a pathogen detection tool has demonstrated good detection performance, especially for samples with low bacterial loads, and has shortened the traditional detection cycle from several days to less than 4 hours. This preliminarily confirms that this detection method can serve as a potential tool for rapid diagnosis of the presence of Proteus mirabilis in clinical samples. Besides Proteus mirabilis, based on the specific nucleic acid fragments of numerous pathogens provided in this article, similar methods can be used to identify pathogens causing various other infectious diseases.

[0110] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A kit for detecting a pathogen with a pathogen-specific nucleic acid gene of Proteus mirabilis, characterized by: The forward primer SEQ ID NO: 1 in the amplification primer used for the PCR reaction, the reverse primer SEQ ID NO: 2 used for the amplification primer; A Crispr / Cas family nuclease having trans-cleavage activity, a crRNA having a target sequence of at least a part of the sequence of the amplification product, the target sequence of the crRNA being SEQ ID NO: 3, and a single-stranded DNA reporter molecule having a fluorescent group and a quencher group at the 5' and 3' ends, respectively, wherein the nucleotide sequence of the pathogen-specific nucleic acid gene of Proteus mirabilis is shown in SEQ ID NO:

4. A Crispr / Cas family nuclease having trans-cleavage activity, a crRNA having a target sequence of at least a part of the sequence of the amplification product, the target sequence of the crRNA being SEQ ID NO: 3, and a single-stranded DNA reporter molecule having a fluorescent group and a quencher group at the 5' and 3' ends, respectively, wherein the nucleotide sequence of the pathogen-specific nucleic acid gene of Proteus mirabilis is shown in SEQ ID NO: 4.

Images