A method for breeding a high amylose content rice

By knocking out the SS3a and SS3b genes in rice using genome editing technology, the resistant starch content of rice was increased, solving the problem of low resistant starch content in conventional rice and achieving significant nutritional and health improvement effects.

CN116179575BActive Publication Date: 2026-03-24YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-04-10
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Conventional rice has a low content of resistant starch, which is difficult to significantly increase using existing technologies, thus affecting its effectiveness in preventing chronic diseases such as overweight, obesity, and type II diabetes.

Method used

Using genome editing technology, a co-knockout vector for the soluble starch synthase genes SS3a and SS3b was constructed and introduced into rice using Agrobacterium-mediated transformation to achieve multiple knockouts of the SS3a and SS3b genes, thereby increasing the resistant starch content of rice.

Benefits of technology

It significantly increases the resistant starch content of rice, reduces the starch digestion rate, and improves the nutritional and health quality of rice. The resistant starch content reaches 9.54%-9.73%, which is much higher than that of wild-type rice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116179575B_ABST
    Figure CN116179575B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of rice molecular breeding, specifically relating to a method for cultivating rice with high resistant starch content; it constructs... SS3a and SS3b Gene co-knockout vectors were created and screened using Agrobacterium-mediated methods to obtain simultaneous knockouts. SS3a and SS3b A new rice germplasm containing the gene; sequencing results of PCR amplification products showed that the target rice contained... SS3a and SS3b All genes underwent frameshift mutations, resulting in complete loss of function; digestibility and physicochemical quality analysis results showed that... SS3a and SS3b The gene co-knockout significantly increased the resistant starch content and significantly reduced the digestibility of rice, while also exhibiting significant changes in physicochemical qualities, resulting in a marked improvement in its nutritional and health benefits. Applying the method for cultivating high-resistant starch rice and related genetic materials of this invention to rice breeding practices is expected to bring new breakthroughs in the selection of nutritious and healthy new rice varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of rice molecular breeding, specifically relating to a method for cultivating rice with high resistant starch content. Background Technology

[0002] In recent years, the incidence of chronic diseases related to diet and energy metabolism, such as overweight, obesity, and type II diabetes, has increased significantly worldwide. High consumption of refined starchy foods is a major contributing factor to these conditions. Conventional starches are typically high in energy and are easily digested, absorbed, and converted into glucose in the small intestine. Resistant starch (RS), however, is a special type of starch that is almost impossible to break down into glucose in the small intestine; instead, it is fermented into beneficial short-chain fatty acids in the large intestine. Therefore, consuming foods rich in RS can effectively lower the glycemic index (GI), increase satiety, and prevent blood sugar-related diseases. Furthermore, it can help prevent intestinal diseases such as colon cancer by improving the gut microenvironment and lowering colonic pH.

[0003] Rice is an important staple crop and a major source of starch for most people worldwide, especially in Asia. However, the glutathione (RS) content in conventionally cultivated rice is typically less than 1%, far below the recommended daily intake for humans. Therefore, breeding rice varieties rich in RS is an important direction for rice variety improvement.

[0004] Starch is the most abundant component of rice endosperm, accounting for over 80% of its dry weight, and is composed of amylose and amylopectin in varying proportions. The composition and structure of amylose and amylopectin in the endosperm are key factors determining rice quality. Starch synthesis in rice endosperm is regulated by a series of enzymes, whose encoding genes are collectively known as starch synthesis-related genes (SSRGs). Currently, there are several successful cases of increasing RS content in rice endosperm by regulating the expression of two types of SSRGs: starch branching enzyme (SBE) and soluble starch synthase (SS). For example, by inhibiting or knocking out... SBE3 / SBEIIb Gene expression can significantly increase the RS content in rice; SBE1 / SBEI Gene mutation or inhibition of its expression had no significant effect on the RS level in rice, but simultaneous inhibition or knockout... SBE1 and SBE3 Gene expression can sbe3 The single mutation further increased the RS content to approximately 15%, indicating functional redundancy between the two genes in RS formation; in organisms with high amylose content and strong GBSSI enzyme activity... Wxa under the background of alleles, SS3a / SSIIIa / SSIII- 2 Gene mutations can significantly increase the RS content of rice to 5-6%. In addition, the genes that control the gelatinization temperature ALK / SSIIa / SSII-3 The gene is also an important gene affecting RS content, and high-activity SSIIa protein is beneficial to the formation of RS. In addition to these few genes, the role and genetic effects of most SSRGs in RS formation are still unknown. For example, the soluble starch synthase III (SSIII or SS3) involved in this paper has two isozymes in rice, which are encoded by SS3a / SSIIIa / SSIII-2 and SS3b / SSIIIb / SSIII-1 . SS3b The function of the gene, its effect on RS, and its interaction with SS3a The gene and the redundancy have not been reported before. Further analysis of the function of SSRG is expected to bring new breakthroughs in increasing the RS content of rice. SUMMARY

[0005] The present application provides a method for cultivating high-resistance starch content rice, a method for increasing the resistance of rice starch content by knocking out starch synthesis related genes SS3a and SS3b using genome editing technology, and reducing starch digestion rate, thereby improving the nutritional and healthy quality of rice. The rice obtained by the method has a significantly reduced digestion rate and has a better nutritional and healthy quality.

[0006] The purpose of the present application is achieved by the following technical solutions:

[0007] In a first aspect, the present application provides a soluble starch synthase gene, which is SS3a and SS3b . The gene number RAP Locus of SS3a and SS3b is Os08g0191433 and Os04g0624600, respectively.

[0008] In a second aspect, the present application provides an application of a soluble starch synthase gene in cultivating high-resistance starch content rice.

[0009] The method of the application is as follows: a soluble starch synthase gene SS3a and SS3bco-knockout vector into rice by Agrobacterium-mediated method, and screening to obtain rice plants with simultaneous knockout of SS3a and SS3b genes.

[0010] Preferably, the co-knockout vector comprises genes SS3a and SS3b , and the vector system is CRISPR / Csa9, and the system comprises an intermediate vector SK-gRNA and a final vector pC1300-Cas9 .

[0011] Preferably, the specific steps of constructing the co-knockout vector of the soluble starch synthase gene SS3a and SS3b are as follows:

[0012] Step (a): taking the sequence of SEQ ID NO. 1 SS3a gene fragment and the sequence of SEQ ID NO. 2 SS3b gene fragment as the target sites, respectively adding GGCA before the forward sequence and AAAC before the reverse complementary sequence, and artificially synthesizing two pairs of complementary primers as shown in SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6; the primers are as follows: ;

[0013] Step (b): annealing the primers of step (a) by a PCR instrument to form DNA double strands with sticky ends, respectively connecting into an intermediate vector Aar I enzyme SK-gRNA ; respectively digesting the vector containing the target site SK-gRNA , recovering the gRNA fragment, and simultaneously connecting it into a final vector pC1300-Cas9 using a same tail enzyme system.

[0014] Preferably, the sequence of SEQ ID NO. 1 SS3a gene fragment in step (a) is located on the exon 1 of SS3a gene; and the sequence of SEQ ID NO. 2 SS3b gene fragment is located on the exon 10 of SS3b gene.

[0015] Preferably, the specific steps of introducing the co-knockout vector into rice by Agrobacterium-mediated method are as follows: transforming the co-knockout vector into EHA105 Agrobacterium strain, using Agrobacterium-mediated genetic transformation method to immerse and stain rice callus; culturing and screening to obtain T0 plants; designing primers on the sequences of SS3a and SS3b genes, and detecting by sequencing after PCR amplification SS3a andSS3b Target site editing of genes, screening obtained SS3a and SS3b Rice with simultaneous knockout of genes.

[0016] Preferably, the in SS3a and SS3b The primer is designed on the gene sequence, and the primer is as follows:

[0017] .

[0018] The resistant starch content in rice flour prepared by the high-resistant starch content rice cultivated by the method reaches 9.54%-9.73%, which is much higher than 0.58% of wild type rice.

[0019] The application constructs a co-knockout vector of soluble starch synthase genes of rice SS3a and SS3b The co-knockout vector is introduced into rice variety Nipponbare, and it is detected by PCR amplification and sequencing that target sites of the genes SS3a and SS3b Occur multiple types of mutations, indicating that the co-knockout vector is successfully introduced into the rice receptor and plays a role.

[0020] The application has the following beneficial effects: the application multi-knocks out starch synthesis related genes SS3a and SS3b , SS3a and SS3b The resistant starch content of the co-knockout rice is significantly improved, the digestion rate is significantly reduced, and the physical and chemical quality is also significantly changed, and the nutritional and healthy quality is significantly improved. The method for cultivating high-resistant starch content rice and the related genetic materials are applied to rice breeding practice, and it is expected to bring new breakthroughs to the breeding of new varieties of nutritional and healthy rice. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 CRISPR / Cas9 vector construction and target site sequence comparison of mutant materials, A is the co-knockout SS3a and SS3b T-DNA structure diagram of CRISPR / Cas9 vector of genes; B is SS3a and SS3b Sequence alignment of target sites T1 and T2 in homozygous mutant lines and wild type control (WT). "UTR" represents non-coding sequence; "Exon" represents exon; "Intron" represents intron; "Target site" represents target site; "PAM" represents prototype interval sequence adjacent area; "WT" represents wild type.

[0022] Figure 2 isSS3a and SS3b Comparison of agronomic traits between homozygous mutant lines and wild type control (WT). A is the plant morphology at the grain filling stage; B is the milled rice grain; C-H are grain length, grain width, grain thickness, 1000-grain weight, chalky grain rate and chalkiness, respectively. The scale bars of panels A and B are 10 cm and 5 mm, respectively. "**" indicates P statistically significant difference at P < 0.01.

[0023] Figure 3 For SS3a and SS3b Comparison of digestion properties in milled rice between homozygous mutant lines and wild type control (WT). A-C are resistant starch content, total digestible starch content and digestion curve, respectively. "**" indicates P statistically significant difference at P < 0.01.

[0024] Figure 4 For SS3a and SS3b Comparison of physicochemical properties in milled rice between homozygous mutant lines and wild type control (WT). A-D are total starch content, apparent amylose content, triglyceride content and amylose-lipid complex content, respectively; E is RVA viscosity profile. "**" indicates P statistically significant difference at P < 0.01. DETAILED DESCRIPTION

[0025] To understand the present application, the following examples are further illustrated the present application, but do not limit the present application.

[0026] The instruments, reagents, materials and the like involved in the following examples, if not specifically stated, are all conventional instruments, reagents, materials and the like in the prior art, which can be obtained through conventional commercial channels. The experimental methods, detection methods and the like involved in the following examples, if not specifically stated, are all conventional experimental methods, detection methods and the like in the prior art.

[0027] Example 1: Co-knockout of SS3a and SS3b Creation of new germplasm of rice with high resistant starch content

[0028] 1. Rice materials

[0029] Conventional japonica rice (Oryza sativa L. ssp. japonica) variety Nipponbare (hereinafter referred to as WT), and two Oryza sativa subsp. geng ) rice materials created with Nipponbare as the receptor (named SS3a and SS3b gene co-knockout rice materials (named ss3a-ss3b -1 and ss3a- ss3b -2, respectively). SS3a andSS3b The gene numbers for RAP Locus are Os08g0191433 and Os04g0624600, respectively.

[0030] 2. Carrier Construction

[0031] This study used the classic CRISPR / Csa9 system for gene editing. Genes located at [location missing] were selected... SS3a The T1 sequence on exon 1 of the gene and located in SS3b The T2 sequence on exon 10 of the gene is used as a target site. Figure 1 B). The specific target site sequence is as follows:

[0032] T1 (SEQ ID NO.1) CAGGCTGAAGGTCGTCATC;

[0033] T2 (SEQ ID NO.2) AAATGGACTGTCAAATGGG;

[0034] Primers were designed based on the requirements of the CRISPR / Cas9 system used. Specifically, GGCA was added before the forward sequence of the target site, and AAAC was added before the reverse complementary sequence. These primers were then synthesized by a biotechnology company. The specific primer sequences are as follows:

[0035] T1-F (SEQ ID NO.3) ggcaCAGGCTGAAGGTCGTCATC;

[0036] T1-R (SEQ ID NO.4) aaacGATGACGACCTTCAGCCTG;

[0037] T2-F (SEQ ID NO.5) ggcaAAATGGACTGTCAAATGGG;

[0038] T2-R (SEQ ID NO.6) aaacCCCATTTGACAGTCCATTT;

[0039] The target site primers were mixed and denatured and annealed to form fragments with sticky ends, which were then ligated into... Aar I Enzyme (Fermentas) enzyme-digested intermediate vector SK-gRNA In the middle. Connecting products ( SK-gRNA-T1 and SK-gRNA-T2 After transformation into E. coli, sequencing was performed using universal primer T3 for verification. Sequencing was correct and carried the desired result. SS3a and SS3b The intermediate vector containing the gene target site was digested separately using a homozygous enzyme system, and simultaneously ligated into a gene targeting the target site. Kpn I and BamH The final vector digested with enzyme IpC1300-Cas9 The ligation product (pC1300-1) was transformed into E. coli and sequenced with vector primer pC1300-F to verify the insertion of the target fragment. pC1300-Cas9-T1-T2 Figure 1 A).

[0040] T3 (SEQ ID NO.7) ATTAACCCTCACTAAAGGGA;

[0041] pC1300-F (SEQ ID NO.8) ACACTTTATGCTTCCGGCTC.

[0042] 3. Genetic transformation

[0043] The recombinant vector plasmid pC1300-1 was transformed into EHA105 Agrobacterium strain, and the Agrobacterium-mediated genetic transformation method was used to infect rice callus. After 3 days of co-culture, the callus was cultured on a selection medium containing hygromycin for 2 weeks. The resistant callus was cultured on a pre-differentiation medium for about 10 days, and the pre-differentiated callus was transferred to a differentiation medium for culture, and resistant transgenic T0 plants were obtained after about one month. pC1300-Cas9-T1-T2 4. Detection and selection of mutant plants

[0044] The young leaves of T0 generation tissue culture seedlings were quickly extracted with CTAB method to obtain genomic DNA for mutation type detection. In

[0045] and SS3a Primers were designed on the gene sequence, and the DNA fragment containing the target site was amplified by PCR, and the product was sequenced by the company. The peak chart analysis was performed by online decoding website DSDecodeM (http: / / skl.scau.edu.cn / dsdecode) or manual decoding, and the mutation information was obtained. The mutant single plant was further planted, and the homozygous line was selected, and the transgene trace was removed by hygromycin primer detection. SS3b Detection

[0046] (T1 Test-F / R) and SS3a (T2 Test-F / R) target site mutation amplification primers and hygromycin detection primers (Hyg-1 / 2) sequences are as follows: SS3b T1 Test-F (SEQ ID NO.9) GTCAGGACAGTGCAAAACTCCA;

[0047] T1 Test-R (SEQ ID NO.10) AGAAGGACGAACACTTGGTGGA;

[0048] T2 Test-F (SEQ ID NO.11) GTCAGGACAGTGCAAAACTCCA;

[0049] T2 Test-R (SEQ ID NO.12) AGAAGGACGAACACTTGGTGGA.T2 Test-F (SEQ ID NO.11) GCTTCCACCCTTCTCATACACA;

[0050] T2 Test-R (SEQ ID NO.12) AACAGAACACGGCCAGGTCA;

[0051] Hyg-1 (SEQ ID No.13) GCTTCTGCGGGCGATTTGTGT;

[0052] Hyg-2 (SEQ ID No.14) GGTCGCGGAGGCTATGGATGC;

[0053] After screening for many generations, we obtained two homozygous lines in which both SS3a and SS3b genes were knocked out, named ss3a-ss3b -1 and ss3a-ss3b -2, respectively. In ss3a-ss3b -1, SS3a a T base was inserted at the target site of the SS3b gene, and 4 bases (AAAT) were deleted at the target site of the ss3a-ss3b gene; in SS3a -2, SS3b an A base was inserted at the target site of the ss3a-ss3b gene, and 2 bases (AA) were deleted at the target site of the ss3a-ss3b gene. In both SS3a -1 and SS3b -2, Figure 1 and genes were all frameshifted and could not synthesize functional SS3a and SS3b proteins

[0054] B).

[0055] 5. Agronomic trait investigation ss3a-ss3b -1, ss3a-ss3b -2 and wild type control. The results showed that the plant morphology, kernel length and kernel width of ss3a-ss3b -1 and ss3a-ss3b -2 had no significant change compared with the wild type control, but the kernel thickness and 1000-grain weight were significantly reduced, and the chalky kernel rate and chalkiness were significantly increased Figure 2 , Table 1.

[0056] Table 1. ss3a - ss3b Comparison of agronomic traits between mutants and wild type control

[0057]

[0058] All data are expressed as mean ± standard deviation, n>2, "**" indicates highly significant difference, and no indication indicates no significant difference.

[0059] 6. Digestive characteristics analysis

[0060] Using a digestible and resistant starch assay kit (Megazyme, catalog number K-DSTRS) and an in vitro digestion assay to detect resistant starch... ss3a-ss3b -1、 ss3a-ss3b The digestibility characteristics of mature rice flour from type -2 and wild-type control were analyzed. The results showed that... ss3a-ss3b -1 and ss3a-ss3b The resistant starch content in -2 rice flour increased significantly, reaching 9.54%-9.73%, which is much higher than the 0.58% in wild-type rice. Figure 3 A, Table 2); at the same time, the total digestible starch content decreased significantly ( Figure 3 B, Table 2), the digestion curve slowed down significantly ( Figure 3 C, Table 3). These results indicate co-knockout SS3a and SS3b Genes can significantly improve the nutritional and health quality of rice.

[0061] Table 2. ss3a - ss3b Comparison of resistant starch content and total digestible starch content between mutants and wild-type controls

[0062]

[0063] All data are expressed as mean ± standard deviation, n=3, "**" indicates highly significant difference, and no indication indicates no significant difference.

[0064] Table 3. ss3a - ss3b Comparison of digestibility of mutant and wild-type control at different time points

[0065]

[0066] All data are expressed as mean ± standard deviation, n=3, "**" indicates highly significant difference, and no indication indicates no significant difference.

[0067] 7. Physicochemical quality analysis

[0068] To further clarify SS3a and SS3b The impact of gene co-knockout on rice quality, we... ss3a-ss3b -1、 ss3a-ss3b The total starch content, apparent amylose content, triglyceride content, amylose-lipid complex content, and viscosity properties of mature rice flour from type -2 and wild-type control were analyzed. The results showed that...ss3a-ss3b -1 and ss3a-ss3b The total starch content in 2M flour was significantly reduced, and the apparent amylose content, triglyceride content, and amylose-lipid complex content were significantly increased (P < 0.01) Figure 4 A-D, Table 4); the rapid viscosity analysis (RVA) profile showed that ss3a-ss3b -1 and ss3a- ss3b The viscosity curve of 2M flour was significantly reduced (P < 0.01) Figure 4 E). These results all indicate that SS3a and SS3b The physicochemical properties of the knockout rice were significantly changed.

[0069] Table 4. ss3a - ss3b Comparison of the physicochemical properties of the mutant and wild-type control rice

[0070]

[0071] All data are mean ± standard deviation, n = 3, and “**” indicates a significant difference, and no indication indicates no significant difference.

[0072] In summary, we successfully created a knockout rice material with the co-knockout of the two genes in the background of japonica rice variety Nipponbare using CRISPR / Cas technology, and the functions of the two genes were completely lost. The results of the digestion characteristics and physicochemical property analysis showed that SS3a and SS3b The co-knockout of the two genes significantly increased the resistant starch content of the rice, significantly improved the digestion characteristics, and also significantly changed the physicochemical properties. SS3a and SS3b The co-knockout of the two genes significantly increased the resistant starch content of the rice, significantly improved the digestion characteristics, and also significantly changed the physicochemical properties.

[0073] The above examples are intended to illustrate the disclosed embodiments of the present application and should not be construed as limiting the present application. Various changes or modifications made by those skilled in the art based on the present application should be included within the scope of the appended claims of the present application without departing from the scope and spirit of the present application.

Claims

1. The application of a soluble starch synthase gene in the cultivation of rice with high resistant starch content, characterized in that, The soluble starch synthase gene is SS3a and SS3b ; SS3a and SS3b The gene numbers for RAP Locus are Os08g0191433 and Os04g0624600, respectively. The method of application is as follows: constructing a soluble starch synthase gene. SS3a and SS3b The co-knockout vector was introduced into rice using an Agrobacterium-mediated method, and simultaneous knockout vectors were screened to obtain the desired results. SS3a and SS3b Genetically modified rice.

2. The application according to claim 1, characterized in that, The co-knockout vector contains genes. SS3a and SS3b The vector system is CRISPR / Cas9, and the system contains intermediate vectors. SK-gRNA and final carrier pC1300-Cas9 .

3. The application according to claim 1, characterized in that, The construction of the soluble starch synthase gene SS3a and SS3b The specific steps for co-knockout vectors are as follows: Step (a): Using the sequence shown in SEQ ID NO.1 SS3a The gene fragment and sequence are shown in SEQ ID NO.

2. SS3b The gene fragments were used as target sites. GGCA was added before the forward sequence of the two target sites, and AAAC was added before the reverse complementary sequence. Two pairs of sequences T1-F, T1-R, T2-F, and T2-R were artificially synthesized as shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.

6. Step (b): Anneal the primers from step (a) using a PCR instrument to form double-stranded DNA with sticky ends, and then ligate them into... Aar intermediate carrier digested by enzyme I SK-gRNA ; digest enzymes containing target sites respectively SK-gRNA The vector was used to recover the gRNA fragment, and the fragment was simultaneously ligated into a final vector using a homosuppressive enzyme system. pC1300-Cas9 middle.

4. The application according to claim 3, characterized in that, The sequence in step (a) is as shown in SEQ ID NO.

1. SS3a Gene fragment located at SS3a On exon 1 of the gene; the sequence is shown in SEQ ID NO.

2. SS3b Gene fragment located at SS3b Exon 10 of the gene.

5. The application according to claim 1, characterized in that, The specific steps for introducing the co-knockout vector into rice using the Agrobacterium-mediated transformation method are as follows: the co-knockout vector is transformed into Agrobacterium strain EHA105, and rice callus is infected using the Agrobacterium-mediated genetic transformation method; T0 plants are obtained through culture and screening. exist SS3a and SS3b Primers were designed based on the gene sequence, and the gene was amplified by PCR followed by sequencing detection. SS3a and SS3b Gene target site editing status, screened and obtained SS3a and SS3b Rice with simultaneous gene knockout.

6. The application according to claim 5, characterized in that, The above SS3a and SS3b Primers T1Test-F, T1 Test-R, T2 Test-F, and T2 Test-R were designed on the gene sequence as shown in SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12.