Molecular marker for wheat plant height and stem sucrose content ta spp-5a
By developing TaSPP-5A molecular markers related to wheat plant height and stem sucrose content, and using genomic detection technology to rapidly identify wheat traits, the problem of difficulty in selecting plant height and stem sucrose content in wheat breeding has been solved, improving breeding efficiency and accuracy and promoting the development of high-yielding wheat varieties.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-10-08
- Publication Date
- 2026-03-17
AI Technical Summary
Current wheat breeding methods face significant challenges in selecting plant height and sucrose content in stems, have long conventional breeding cycles, and lack sufficient application of molecular marker technology in wheat, resulting in low breeding efficiency.
To develop TaSPP-5A molecular markers related to wheat plant height and sucrose content in stems, we will detect the N-site genotype in the genome, amplify the TaSPP-5A gene using specific primers, and identify haplotypes by combining PCR and enzyme digestion techniques, thereby achieving rapid identification of wheat traits.
By detecting the TaSPP-5A molecular marker, wheat varieties with high plant height and high stem sucrose content can be quickly and accurately identified, improving the efficiency and accuracy of breeding selection and promoting the cultivation of high-yielding wheat varieties.
Smart Images

Figure GDA0005283470390000071 
Figure GDA0005283470390000081 
Figure GDA0005283470390000082
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biotechnology and plant breeding, and relates to a molecular marker related to wheat plant height and stem sucrose content and its application, specifically the TaSPP-5A molecular marker for wheat plant height and stem sucrose content. Background Technology
[0002] Wheat is one of the world's most important food crops, playing a vital role in food production and national economic development. Conventional breeding is time-consuming, difficult, and labor-intensive. In contrast, molecular markers allow breeders to quickly and accurately identify wheat materials with phenotypic traits, greatly improving the efficiency and accuracy of breeding selection.
[0003] Sucrose is a major product of plant photosynthesis and plays a crucial role in plant growth and development, signal transduction, and responses to abiotic stress. Sucrose phosphate phosphatase (SPP) is a key enzyme in sucrose synthesis, and studies have shown that SPP activity is closely related to sucrose content. The protein encoded by TaSPP-5A in wheat is a member of the wheat SPP family. The development of this molecular marker will be of great significance for breeding wheat varieties with high sucrose content. Summary of the Invention
[0004] The purpose of this invention is to provide TaSPP-5A molecular markers for wheat plant height and stem sucrose content, and to provide a method for identifying or assisting in the identification of wheat traits to be tested through molecular markers.
[0005] To achieve the above objectives, the TaSPP-5A molecular markers for wheat plant height and stem sucrose content described in this invention include the following steps: detecting the N locus in the genome of the wheat to be tested, and determining the wheat trait based on the genotype of the N locus as follows: the N locus results in the following two haplotypes of wheat:
[0006] The genotype at the N locus is C / C, which is haplotype I;
[0007] The genotype at the N locus is T / T, which is haplotype II;
[0008] Wheat varieties with the genotype C / C at the N locus have higher plant height and stem sucrose content than wheat varieties with the genotype T / T at the N locus.
[0009] The N site refers to one InDel site and three SNP sites in the TaSPP sequence, namely positions 677, 1242, 1305, and 2077 of the TaSPP-5A gene.
[0010] The TaSPP-5A molecular marker for wheat plant height and stem sucrose content was implemented using the following steps:
[0011] (I) Acquisition of TaSPP-5A gene polymorphism and haplotype:
[0012] (1) Acquisition of TaSPP-5A gene polymorphism:
[0013] The forward primer sequence of TaSPP-5A, TaSPP-5A-Primer-F, is:
[0014] TGACGAACCCTAACCTGCTT;
[0015] The reverse primer sequence of TaSPP-5A, TaSPP-5A-Primer-R, is:
[0016] ATCAAGAGACCTCCGTAGACAT;
[0017] The identification sequences of TaSPP-5A-Primer-F and TaSPP-5A-Primer-R are located upstream and downstream of TaSPP, respectively;
[0018] Using wheat genomic DNA as a template, the TaSPP-5A gene was amplified using specific primers TaSPP-5A-Primer-F and TaSPP-5A-Primer-R. The target fragment was ligated into the pEASY Blunt Clonging Vector, and then single clones were selected for sequencing and alignment.
[0019] The PCR amplification conditions were as follows: 10×Easypfu Buffer 10 μL, dNTP 10 μL, forward and reverse primers 10 μmol / L and 2 μL respectively, and ddH2O was added to a total volume of 50 μL; the reaction conditions were: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 57℃ annealing for 30 s, and 72℃ extension for 2.5 min, for a total of 35 cycles; 10×Easypfu Buffer and Easypfu were both products of Beijing TransGen Biotech Co., Ltd.; the reaction conditions were: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 57℃ annealing for 30 s, and 72℃ extension for 2.5 min, for a total of 35 cycles;
[0020] (2) Obtaining the TaSPP-5A haplotype:
[0021] The four polymorphic sites of TaSPP exist in two haplotypes in natural wheat populations, which are named haplotype Hap-5A-1 and haplotype Hap-5A-2, respectively.
[0022] (II) Obtaining the TaSPP-5A molecular marker:
[0023] Based on the differences in the wheat genome sequence, a gene-specific primer pair PN was designed to amplify DNA fragments containing the N site. The primer pair PN consists of single-stranded DNA with primer names pe1 and pe2.
[0024] The pe1 sequence is TGTTTCTCCAAGAGACGTTGAATT;
[0025] The pe2 sequence is TGAGATGGGAGAGGGGAGAAATTTAG;
[0026] (1) Extract the wheat genomic DNA to be tested, and perform PCR amplification using genomic-specific primers TaSPP-5AsF and TaSPP-5AsR to obtain PCR products;
[0027] TaSPP-5AsF: AGCAATGCCCAAGAGGAA;
[0028] TaSPP-5AsR:ATTACTTGCCTCCATGTCGAA;
[0029] (2) Dilute the PCR product of step (1) by 200 times, and use the primers in step (1) to perform PCR amplification on PN to obtain the PCR amplification product.
[0030] (3) The PCR product from step (2) was digested with EcoRI to obtain the PCR product. The PCR was detected by 4% agarose gel electrophoresis. The size of each fragment in the digested product was identified and recorded, and the N site of the wheat to be tested was recorded.
[0031] The PCR amplification of PN was performed using the following PCR amplification system: 1 μL template DNA, 10 μL 2×Utaq Master Mix, 10 μL each of forward primer pe1 (10 μL / L) and reverse primer pe2 (10 μL / L), and ddH2O added to 20 μL.
[0032] The PN was amplified by PCR under the following conditions: 94℃ for 5 min, 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, for 33 cycles; then 72℃ for 5 min and stored at 4℃.
[0033] The present invention describes the use of the molecular marker of the TaSPP-5A gene, which is associated with wheat plant height and sucrose content as described in claim 1, in the genotyping of natural wheat populations and the association analysis of plant height and sucrose content traits.
[0034] The present invention provides a method for screening wheat plant height and high stem sucrose content, comprising the following steps: screening wheat populations with genotype C / C at the N locus in the above method.
[0035] The TaSPP-5A molecular markers for wheat plant height and stem sucrose content described in this invention have the following advantages: Sequence analysis revealed two haplotypes of the four TaSPP polymorphic sites in natural wheat populations; this invention discloses the identification of the N site in the wheat genome, corresponding to position 1242 of sequence 1. Natural population association analysis showed that wheat varieties with N site C had higher plant height and stem sucrose content than those with N site T. By detecting the SNP markers at these two sites, wheat varieties with higher plant height and stem sucrose content can be identified. This invention provides a new method for marker-assisted breeding of wheat and has significant implications for cultivating high-yielding wheat varieties. Attached Figure Description
[0036] Figure 1 The results of molecular marker enzyme digestion electrophoresis detection were developed for the SNPs of this invention;
[0037] Lane M is a 2000bp DNA ladder.
[0038] Figure 1 The image shows the restriction enzyme bands of PCR products from different wheat PN primer pairs digested with EcoRI.
[0039] Figure 1 In the middle left image, lane C contains two bands from top to bottom, one 215bp and the other 20bp. Due to the long electrophoresis time, the 20bp fragment is barely visible. Lane T contains a 235bp band.
[0040] Figure 2 These are two haplotypes that exist in natural populations;
[0041] Hap-5A-1 and Hap-5A-2 are haplotypes I and II, respectively. Detailed Implementation
[0042] Example 1
[0043] like Figure 1 , 2 As shown, the TaSPP-5A molecular markers for wheat plant height and stem sucrose content described in this invention include the following steps: detecting the N locus in the genome of the wheat to be tested, and determining the wheat trait to be tested based on the genotype of the N locus as follows: the N locus results in the following two haplotypes of wheat:
[0044] The genotype at the N locus is C / C, which is haplotype I;
[0045] The genotype at the N locus is T / T, which is haplotype II;
[0046] Wheat varieties with the genotype C / C at the N locus have higher plant height and stem sucrose content than wheat varieties with the genotype T / T at the N locus.
[0047] The N site refers to one InDel site and three SNP sites in the TaSPP sequence, namely position 677 (polymorphism exists), position 1242 (polymorphism exists), position 1305 (polymorphism exists), and position 2077 (polymorphism exists) of the TaSPP-5A gene.
[0048] The TaSPP-5A molecular marker for wheat plant height and stem sucrose content was implemented using the following steps:
[0049] (I) Acquisition of TaSPP-5A gene polymorphism and haplotype:
[0050] (1) Acquisition of TaSPP-5A gene polymorphism:
[0051] The forward primer sequence of TaSPP-5A, TaSPP-5A-Primer-F, is:
[0052] TGACGAACCCTAACCTGCTT;
[0053] The reverse primer sequence of TaSPP-5A, TaSPP-5A-Primer-R, is:
[0054] ATCAAGAGACCTCCGTAGACAT;
[0055] The identification sequences of TaSPP-5A-Primer-F and TaSPP-5A-Primer-R are located upstream and downstream of TaSPP, respectively;
[0056] Using wheat genomic DNA as a template, the TaSPP-5A gene was amplified using specific primers TaSPP-5A-Primer-F and TaSPP-5A-Primer-R. The target fragment was ligated into the pEASY Blunt Clonging Vector, and then single clones were selected for sequencing and alignment.
[0057] The PCR amplification conditions were as follows: 10×Easypfu Buffer 10 μL, dNTP 10 μL, forward and reverse primers 10 μmol / L and 2 μL respectively, and ddH2O was added to a total volume of 50 μL; the reaction conditions were: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 57℃ annealing for 30 s, and 72℃ extension for 2.5 min, for a total of 35 cycles; 10×Easypfu Buffer and Easypfu were both products of Beijing TransGen Biotech Co., Ltd.; the reaction conditions were: 94℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 57℃ annealing for 30 s, and 72℃ extension for 2.5 min, for a total of 35 cycles;
[0058] (2) Obtaining the TaSPP-5A haplotype:
[0059] The four polymorphic sites of TaSPP exist in two haplotypes in natural wheat populations, which are named haplotype Hap-5A-1 and haplotype Hap-5A-2, respectively; the haplotype sites in the sequence are shown in Table 1:
[0060] Table 1. Nucleotides at each SNP site for each haplotype
[0061] Location 677bp 1,242bp 1,305bp 2,077bp Hap-5A-1 T C C G Hap-5A-2 - T T A
[0062] (II) Obtaining the TaSPP-5A molecular marker:
[0063] Based on the differences in the wheat genome sequence, a gene-specific primer pair PN was designed to amplify DNA fragments containing the N site. The primer pair PN consists of single-stranded DNA with primer names pe1 and pe2.
[0064] The pe1 sequence is TGTTTCTCCAAGAGACGTTGAATT;
[0065] The pe2 sequence is TGAGATGGGAGAGGGGAGAAATTTAG;
[0066] (1) Extract the wheat genomic DNA to be tested, and perform PCR amplification using genomic-specific primers TaSPP-5AsF and TaSPP-5AsR to obtain PCR products;
[0067] TaSPP-5AsF: AGCAATGCCCAAGAGGAA;
[0068] TaSPP-5AsR:ATTACTTGCCTCCATGTCGAA;
[0069] (2) Dilute the PCR product of step (1) by 200 times, and use the primers in step (1) to perform PCR amplification on PN to obtain the PCR amplification product.
[0070] The PCR amplification of PN was performed using the following PCR amplification system: 1 μL template DNA, 10 μL 2×Utaq Master Mix, 10 μL each of forward primer pe1 (10 μL / L) and reverse primer pe2 (10 μL / L), and ddH2O added to 20 μL.
[0071] The PN was amplified by PCR under the following conditions: 94℃ for 5 min, 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, for 33 cycles; then 72℃ for 5 min and stored at 4℃.
[0072] (3) The PCR product from step (2) was digested with EcoRI to obtain the PCR product. The PCR was detected by 4% agarose gel electrophoresis. The size of each fragment in the digested product was identified and recorded, and the N site of the wheat to be tested was recorded.
[0073] If the enzyme digestion product is a 235bp DNA fragment (position 1 of sequence 2 - 235bp), the nucleotide sequence of the wheat sample at the N site is T (…). Figure 1 In the swimming lane T);
[0074] If the enzyme digestion product is a DNA fragment of 215 bp (position 21-235 bp of sequence 2) and 20 bp (position 1-20 bp of sequence 1), then the nucleotide at the N site of the wheat sample to be tested is C( Figure 1 Lane C in the swimming pool;
[0075] DNA fragments from enzyme digestion products 235, 215, and 20 were analyzed to determine the T / C ratio of nucleotides at the N site in the wheat sample. Figure 1 (T / C of the swimming lane).
[0076] (4) Based on the results of step (3), wheat is divided into the following two haplotypes according to the N site:
[0077] I: C / C (i.e., haplotype I);
[0078] II: T / T (i.e., haplotype II);
[0079] The part before the " / " represents a homologous chromosome, and the part after the " / " represents another homologous chromosome.
[0080] This molecular marker was used to genotype natural populations and to perform correlation analysis with plant height and sucrose content patterns.
[0081] Using 200 hexaploid wheat accessions from a natural population as test wheat, the wheat species were genotyped according to the method in step 2. The size of the amplification products of a random sample of wheat was verified by sequencing. The results are shown in the table below:
[0082] Haplotype statistics of natural wheat populations
[0083]
[0084]
[0085] Association analysis between haplotypes and sucrose and plant height:
[0086] The General Linear Model (GLM) in Tassel was used to perform a correlation analysis on the two haplotypes, plant height, and stem sucrose content shapes at the locus.
[0087]
[0088] Note: * The differences in traits among different wheat genotypes were extremely significant (P<0.05).
[0089] As shown in the table above, among the two haplotypes present in the natural wheat population, wheat varieties with N locus C have higher plant height and stem sucrose content than wheat varieties with N locus T. By detecting the SNP markers at the two loci, wheat varieties with higher plant height and stem sucrose content can be identified. This invention provides a new method for molecular marker-assisted breeding of wheat, which is of great significance in the breeding of high-yielding wheat varieties.
[0090] Sequence Listing SEQ ID NO:1;
[0091]
[0092]
[0093]
[0094] Sequence Listing SEQ ID NO:2;
[0095] <110> Gansu Agricultural University <120> TaSPP-5A molecular marker for wheat plant height and sucrose content in stems <140> 2021111677063 <141> 2021-10-08 <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2872 <212> DNA <213> 2 Ambystoma laterale x Ambystoma jeffersonianum <400> 1 atggataagc tcaagggctc tgcgcgtctt atgattgttt cagatctcga tcacacaatg 60 gtgtttgtta aactcgcagc ttggattttg tccagagata attgtaactt tttgtatgac 120 caactaattt gaagtttctt gggttttaaa ctttaggttg atcatcatga cgaagagaac 180 ctgtctttgc ttaggtttgg ggccctttgg gagtctgttt actgtcagga ttctcttctt 240 gtctttttca acaggaagat cacctactct gtataaggaa ttgaggaaag agaagcctat 300 gctaactcca gatatcacta ttttgttctg tgggctctga gataacttat ggtgaagcca 360 tggtccctga tcatggctgg gaggaatatc tgaacaataa gtgggacagg aatattgttc 420 ttgaggagac agctaagttt tctgagctga agcttcaggc atgttcgatt gctaaacagc 480 tacttcccct attaataat cattttgatc tctatacaat aacactttat tgtcattcac 540 ttgcatgaat gcaggtagag acagaacagc gtccacataa ggtcagcttt ttggttgaca 600 agaagaacgc tcagggagtg atcaagtctc tctccgagaa gtttgagaaa cgtggggtga 660 ggcagcatgc ttacttttt ttaagaggca gcatgtttat ctgatgttgt taggtgttag 720 ttttcgcaa tatattcttt aagaaacatg gttttttgga atttgtgtgg ttaactacta 780 tatttactgt aaacaggtag atgcgaaaat aatctacagt ggtggccagg atcttgacat 840 attagctcaa ggggctggaa agggtcaagc acttgcatat ttgctcaaga agttaggttc 900 atgcggaaaa acacccaaca atactcttgc ttgtggtgac tctggtaatg atgcagaatt 960 attcagtatc cctggtgtac atggtgtcat ggtcagtgta caataacttg catgatgtgt 1020 ctataaaagt tcaggcgtga atgaatgtga gtttactgca actctatgtt ctaaaatgtt 1080 aggttagcaa tgcccaagag gaactactcc agtggcatgc agaaaatgcg aaggataatc 1140 ctaagataat tcatgcaact gagaggtgtg ctgctggtat tattcaagct attgggcact 1200 tcaagctagg acctaatgtt tctccaagag acgttgagtt cccttacatc aaggaggacc 1260 ctttcaagcc tacagcggcc attgtgaagt tctatgttct gtacgaaaag tggcgtagag 1320 ctgatgttcc aaaggctgat tctgttatag agtacttcaa aaacaccaca gtatgtatat 1380 ggttttccac ttccatatac atttaaatag tttgtttagc ttttgttaa atttctccct 1440 ctccccatct cagtttctca agctttctaa ttctgagaaa atgccatatt ttccttaata 1500 ttttctcaa acttaaagat tatttattta ttgtgggtgt taggatgcaa tggagttatt 1560 attcatccgt ctggggtcga actttcgatc cattcgtcca ttgatgaggc tggcttcatg 1620 ttatggtgac aaacaaggga aaaagtaccg atcatgggtg gacagacttg ttatcttgca 1680 gactgctcct gacagttggc ttgtgagatt cgacttgtgg gaggcagaag gtgagtgttt 1740 atgattctgc aaagtattat acagttactg ccctgagcaa ctcaaacttt aaaaaaat 1800 gctatttaat acgttttgtt cagattgcaa tctttttacc cagtttgtat gtgctcaatc 1860 agaattcttg ttttatttat agatagtgtc attatggtt tacctttatt cgacatggag 1920 gccaagtaat aattttagga ctatggtagt aggtttttat attactttgc gcacatatcc 1980 ttttttttc ctgttgcgaa acaatgaccg catcattcag ttacagagaa gtacaatgct 2040 aaatttacag tgtggactgt tgtataactc tattctggcc agatattatg gacttactgg 2100 ttatggtatg aagtgatcta gatagtagaa gttgactgaa acataatccc tttactacat 2160 atgtaaacat caatgaccac ttgatgataa tggccataga ttcaaagtcc ctttgcaaaa 2220 ggacaacccg tggattgggg gtcattcgtt gttgagcaat caatagttat atcccgagtc 2280 agttggggat gtcgaaaatc aatcttggtc tatgattaat ggaaaattgt gcttcaagct 2340 agttaaaatg atctggctac ctgatttgac atgttccctt cctaacaaag aggtatgggg 2400 actttagcat gggttttgcc ggttgattct atctgatgga catgatgatt atctgatttc 2460 tacctaatgg agggcatagc gcataacctg tgggacagtg tgacgtggat ttcaaagttt 2520 tttcgtcctg tcaattatta tataagcacg ctcgcgttat cttcatataa aatcttattt 2580 tagcgaatca tcctcacctc aatgtttaat gcgccgctat gctattttca ggtaatgcgt 2640 gggcgtgctg ttttacaacc cttgcactga atgtaaaggt atatatatat atatatatat 2700 cacttgtgtt gagccaaaac ctgacctgac ccactcgtat tttggaaatt ttaacacggg 2760 ttgttttttg tgatgtcact cagcctgaaa cccctggggt tttgtggtaa cacacatcca 2820 caagacatgg cgtaaagaat atcccggggt cgagcagtca tccaaactct ag 2872 <210> 2 <211> 232 <212> DNA <213> Triticum aestivum <400> 1 tgttctcca agagacgttg agttccctta catcaaggag gaccctttca agcctacagc 60 ggccattgtg aagttctatg ttctgtacga aaagtggcgt agagctgatg ttccaaaggc 120 tgattctgtt atagagtact tcaaaaacac cacagtgtat atggttttcc acttccataa 180 catttaaata gtttggttag cttttgcta aatttctccc tctcccatct ca 232
Claims
1. A method of screening for wheat plant height and stem sucrose content, characterized by: comprising the following steps: detecting N locus of TaSPP-5A gene in the wheat genome to be tested, wherein the N locus is at position 1242 of SEQ ID NO: 1; judging the wheat plant height and stem sucrose content according to the genotype of the N locus: if the genotype of the N locus is C / C, the wheat plant height and stem sucrose content are higher than those of the wheat variety with genotype T / T.
2. The method for screening the wheat plant height and stem sucrose content according to claim 1, wherein: designing a gene-specific primer pair PN to amplify the DNA fragment containing the N locus according to the sequence difference of the wheat genome, wherein the primer pair PN is composed of single-stranded DNA of primer names pe1 and pe2; the sequence of pe1 is TGTTTCTCCAAGAGACGTTGAATT; the sequence of pe2 is TGAGATGGGAGAGGGAGAAATTTAG; (1) extracting the wheat genome DNA to be tested, and performing PCR amplification using the genome-specific primers TaSPP-5AsF and TaSPP-5AsR to obtain a PCR product; TaSPP-5AsF: AGCAATGCCCAAGAGGAA; TaSPP-5AsR: ATTACTTGGCCTCCATGTCGAA; (2) diluting the PCR product of step (1) by 200 times, and performing PCR amplification using the primer pair PN to obtain a PCR amplification product; (3) PCR products of step (2) were digested with EcoR I restriction enzyme, and PCR products were detected by 4% agarose gel electrophoresis. The size of each fragment in the restriction enzyme digestion products was identified and recorded, and the situation of the wheat to be tested at N site was recorded.
3. The method of claim 2, wherein the method is used to screen for wheat plant height and stem sucrose content. The amplification system in step (2) is: 1 μL of template DNA, 10 μL of 2×Utaq Master Mix, 10 μmol / L of forward primer pe1 and reverse primer pe2, and ddH2O to 20 μL.
4. The method of claim 3, wherein the wheat plants are selected for plant height and stem sucrose content. The PCR amplification conditions in step (2) are: 94℃ for 5 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 33 cycles; 72℃ for 5 min, and 4℃ for preservation.
5. A method of screening for wheat varieties with higher plant height and higher sucrose content in high stem, characterized in that, comprising the following steps: screening the wheat population with genotype C / C of the N locus according to any one of claims 1-4.
Citation Information
Patent Citations
Molecular marker TaSnRK2.3A related to thousand grain weight and plant height of wheat and application of molecular marker
CN106381343A
Molecular marker TaSnRK2.3B related with thousand seed weight of wheat and content of soluble sugar in wheat straw and application of molecular marker TaSnRK2.3B
CN106755355A