An arsenic-induced response promoter, its expression vector, and its applications

Abstract

This invention discloses an arsenic-induced response promoter, its expression vector, and its applications. The promoter contains a nucleotide sequence selected from any of the following groups and possessing promoter function: (1) the nucleotide sequence shown in SEQ ID NO.1; (2) a nucleotide sequence capable of hybridizing with the nucleotide sequence shown in (1) under stringent conditions; (3) a nucleotide sequence having at least 90% identity with the nucleotide sequence shown in (1) or (2). The promoter provided by this invention exhibits a strong arsenic response and can specifically respond to pentavalent arsenic stress to increase the expression level of the target gene. Furthermore, it is inhibited by trivalent arsenic, thus showing broad application prospects in gene regulation.

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and biotechnology, and in particular to an arsenic-induced response promoter, its expression vector, and its applications. Background Technology

[0002] Arsenic is a metalloid element widely found in nature, and both arsenic and its soluble compounds are highly toxic. Arsenic pollution poses a significant threat to various life forms, including plants and animals. Related studies have shown that arsenic accumulation in soil, once reaching a certain level, directly affects plant growth and development, reduces agricultural yields, and may enter the edible tissues of fruits and vegetables, as well as the grains of crops such as rice and wheat. When humans ingest a certain amount of arsenic, it can easily cause irreversible damage such as various skin cancers, kidney damage, and cardiovascular diseases.

[0003] Among related technologies, heavy metal soil pollution remediation methods mainly involve engineering remediation measures and physicochemical remediation methods, but these are relatively expensive, cause significant environmental disturbance, and may lead to secondary soil pollution. Phytoremediation technology, due to its advantages of low cost, simple operation, high ecological benefits, minimal environmental disturbance, and no secondary pollution, demonstrates its advantages and development prospects in soil remediation. For arsenic-contaminated soil, using arsenic hyperaccumulating plants is a common and effective approach. Arsenic hyperaccumulating plants are those whose above-ground parts absorb more than 10 times more arsenic than ordinary plants without affecting their normal life activities. Most of the arsenic hyperaccumulating plants discovered so far belong to the genus *Pteris*. Some genes of *Pteris vittata*, a representative arsenic hyperaccumulating plant, have been reported to be arsenic-induced and related to important arsenic metabolism processes such as arsenic transport, detoxification, and accumulation in *Pteris vittata*. Among them, the arsenic (trivalent arsenic) reverse transport protein PvACR3 gene plays an important role in the arsenic hyperaccumulation process. In hyperaccumulating plants and model plants, some key genes that are induced to express by arsenic have been found. Among them, the expression enhancement of arsenic-related genes such as PvACR3 in response to arsenic is limited, and the promoters of arsenic-related genes such as PvACR3 have low selectivity for trivalent and pentavalent arsenic.

[0004] Therefore, it is still necessary to seek a promoter that is highly responsive to arsenic and can specifically respond to pentavalent arsenic stress. Summary of the Invention

[0005] This invention aims to at least solve one of the technical problems existing in the prior art. To this end, this invention proposes a DNA molecule that can specifically respond to pentavalent arsenic stress and can be used to drive the expression of a target gene.

[0006] The present invention also proposes a primer set for amplifying the above-mentioned DNA molecules.

[0007] This invention also proposes a biomaterial.

[0008] This invention also proposes an application of the above-mentioned DNA molecule in the preparation of promoters.

[0009] This invention also proposes the application of the aforementioned DNA molecules or biological materials in the cultivation of transgenic plants.

[0010] The present invention also proposes the application of the above-mentioned DNA molecules or biological materials in driving the expression of target genes in plants.

[0011] This invention also proposes a method for preparing transgenic plants.

[0012] In a first aspect, the present invention provides a DNA molecule containing a nucleotide sequence selected from any one of the following groups and having promoter function:

[0013] (1) The nucleotide sequence shown in SEQ ID NO.1;

[0014] (2) A nucleotide sequence that can hybridize with the nucleotide sequence shown in (1) under strict conditions;

[0015] (3) A nucleotide sequence that has at least 90% identity with the nucleotide sequence shown in (1) or (2).

[0016] The DNA molecule according to embodiments of the present invention has at least the following beneficial effects: the DNA molecule of the present invention is derived from non-hyperaccumulating plants, is the promoter of PeACR3, and can specifically respond to pentavalent arsenic stress, and can be used to drive the high expression of target genes. Furthermore, this DNA molecule can also be inhibited by trivalent arsenic.

[0017] Compared to the promoter of the conventional arsenite reverse transport protein gene PvACR3, the DNA molecule of this invention has a stronger and more specific response to arsenic as a promoter, which is more conducive to regulating the expression of the target gene.

[0018] In some embodiments of the present invention, the DNA molecule is derived from a non-arsenic hyperaccumulating plant.

[0019] A second aspect of the invention provides a set of primers for amplifying the DNA molecule.

[0020] In some embodiments of the present invention, the primer set includes an upstream primer shown in SEQ ID NO. 5 and a downstream primer shown in SEQ ID NO. 6.

[0021] A third aspect of the present invention provides a biomaterial, which is any one of the following 1) to 8):

[0022] 1) The DNA molecule mentioned above;

[0023] 2) An expression cassette containing the DNA molecule described in 1);

[0024] 3) A recombinant vector containing the DNA molecule described in 1);

[0025] 4) A recombinant vector containing the expression cassette described in 2);

[0026] 5) Recombinant microorganisms or cell lines containing the DNA molecules described in 1);

[0027] 6) Recombinant microorganisms or cell lines containing the expression cassette described in 2);

[0028] 7) Recombinant microorganisms or cell lines containing the recombinant vector described in 3);

[0029] 8) Recombinant microorganisms or cell lines containing the recombinant vector described in 4).

[0030] In a fourth aspect, the present invention provides the use of the above-described DNA molecule as and / or in the preparation of promoters.

[0031] In some embodiments of the present invention, the promoter is a pentavalent arsenic-induced promoter.

[0032] A fifth aspect of the present invention provides the application of the aforementioned DNA molecules or biological materials in the cultivation of transgenic plants.

[0033] In a sixth aspect, the present invention provides the application of the above-described DNA molecules or biological materials in driving the expression of target genes in plants.

[0034] In some embodiments of the present invention, the target gene is the PeACR3 gene.

[0035] In a seventh aspect, the present invention provides a method for preparing a transgenic plant, the method comprising the following steps: introducing the above-mentioned biological material into a plant.

[0036] Other features and advantages of the invention will be set forth in the description which follows, and will be apparent in part from the description, or may be learned by practicing the invention. Attached Figure Description

[0037] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0038] Figure 1 This is a statistical graph showing the expression of the PeACR3 gene in response to pentavalent arsenic in an embodiment of the present invention;

[0039] Figure 2 The results of agarose gel electrophoresis of the PCR products of the four primer pairs used in the PeACR3pro promoter cloning process of this invention are shown in the embodiments of the present invention.

[0040] Figure 3 This is a schematic diagram of the structure of recombinant plasmid 1300GN-Unigene0002384 in an embodiment of the present invention.

[0041] Figure 4 The agarose gel electrophoresis results of transgenic Arabidopsis thaliana lines screened by hygromycin in an embodiment of the present invention are shown.

[0042] Figure 5 This is a diagram showing the GUS staining results of transgenic Arabidopsis plants according to an embodiment of the present invention.

[0043] Figure 6 This is a statistical chart showing the expression of downstream genes induced by different concentrations of pentavalent and trivalent arsenic in an embodiment of the present invention. Detailed Implementation

[0044] The following will describe the concept and technical effects of the present invention clearly and completely with reference to the embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0045] In the description of this invention, the terms "one embodiment," "some embodiments," "illustrative embodiment," "example," "specific example," or "some examples," etc., refer to specific features, structures, materials, or characteristics described in connection with that embodiment or example, which are included in at least one embodiment or example of the invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0046] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0047] Example 1: Obtaining the PeACR3Pro promoter sequence

[0048] In this invention, previous research on the ACR3 homolog gene (numbered Unigene0002384, hereinafter referred to as the PeACR3 gene) of the root system of the non-hyperaccumulating plant Pteris ensiformis showed that the PeACR3 gene is strongly induced by pentavalent arsenic, upregulated by approximately 50-fold (specifically as follows). Figure 1 (As shown in A).

[0049] Further validation was performed using the SYBR Green PCR Master Mix kit (Vazyme Biotech, Nanjing, China) for real-time quantitative PCR (qRT-PCR). Results were analyzed using 2... -ΔΔCT Statistical analysis showed that the expression of the PeACR3 gene in roots was induced by pentavalent arsenic, with an upregulation of approximately 14-fold (e.g., ...). Figure 1 (As shown in B).

[0050] Using a chromosome walking kit (TAKARA, Japan), three specific primers SP1, SP2, and SP3 were designed based on the known CDS sequence of the PeACR3 gene.

[0051] The specific primer sequences are shown in Table 1:

[0052] Table 1 Primer nucleotide sequences

[0053] Primer name Primer sequence (5'-3') SP1 Primer CCACCGAGCTTTTCATATTGCACCTT(SEQ ID NO.2) SP2 Primer AGCTACTTGGAATGCCTTCTTCAC(SEQ ID NO.3) SP3 Primer TCGAGCAGCGAAAGCTGTTTGAAA(SEQ ID NO.4)

[0054] After performing the first PCR reaction and accurately quantifying the genomic DNA by OD assay, an appropriate amount was taken as a template. Apprimer 1 / 2 / 3 / 4 (random primers with lower annealing temperature provided by the kit) were used as upstream primers, and SP1 Primer was used as downstream primer.

[0055] The 1st PCR reaction system is shown in Table 2:

[0056] Table 2: 1st PCR reaction system

[0057] reagents Volume (μL) Template (genomic DNA) 2 dNTP Mixture (2.5mM each) 3.2 <![CDATA[10×LA PCR BufferⅡ(Mg 2+ plus)]]> 2 TaKaRa LA Taq (5U / μL) 0.2 AP1 / 2 / 3 / 4 Primer (100 pmol / μL) 0.4 SP1 Primer 0.4 <![CDATA[ddH2O]]> 41.8

[0058] The first PCR amplification program was as follows: ① 94℃ pre-denaturation for 1 min, 98℃ denaturation for 1 min. ② 94℃ denaturation for 1 min, 50℃ annealing for 1 min, 72℃ extension for 2 min. Perform 5 reaction cycles. ③ 94℃ denaturation for 30 sec, 25℃ annealing for 3 min, 72℃ extension for 2 min. ④ 94℃ denaturation for 30 sec, 60℃ annealing for 1 min, 72℃ extension for 2 min. ⑤ 94℃ denaturation for 30 sec, 60℃ annealing for 1 min, 72℃ extension for 2 min. ⑥ 94℃ denaturation for 30 sec, 44℃ annealing for 1 min, 72℃ extension for 2 min. Perform 15 reaction cycles. ⑦ 72℃ extension for 10 min.

[0059] For the second PCR reaction, 1 μL of the first PCR reaction solution was used as the template for the second PCR reaction. AP Primer 1 / 2 / 3 / 4 was used as the upstream primer and SP2 Primer was used as the downstream primer.

[0060] The 2nd PCR reaction system is shown in Table 3:

[0061] Table 3: 2nd PCR reaction system

[0062] reagents Volume (μL) Template (1st PCR reaction solution) 1 dNTP Mixture (2.5mM each) 3.2 <![CDATA[10×LA PCR BufferⅡ(Mg 2+ plus)]]> 2 TaKaRa LA Taq (5U / μL) 0.2 AP1 / 2 / 3 / 4 Primer (100 pmol / μL) 0.4 SP2 Primer 0.4 <![CDATA[ddH2O]]> 42.8

[0063] The second PCR amplification program was as follows: ① Denaturation at 94℃ for 30 seconds, annealing at 60℃ for 1 min, and extension at 72℃ for 2 min. ② Denaturation at 94℃ for 30 seconds, annealing at 60℃ for 1 min, and extension at 72℃ for 2 min. ③ Denaturation at 94℃ for 30 seconds, annealing at 44℃ for 1 min, and extension at 72℃ for 2 min. Perform 15 reaction cycles. ② Anneal at 72℃ for 10 min.

[0064] For the 3rd PCR reaction, 1 μL of the 2nd PCR reaction solution was used as the template for the 3rd PCR reaction. AP Primer 1 / 2 / 3 / 4 was used as the upstream primer and SP3 Primer was used as the downstream primer.

[0065] The 3rd PCR reaction system is shown in Table 4:

[0066] Table 4: 3rd PCR reaction system

[0067]

[0068]

[0069] The third-degree PCR amplification program was as follows: ① Denaturation at 94℃ for 30 seconds, annealing at 60℃ for 1 minute, and extension at 72℃ for 2 minutes. ② Denaturation at 94℃ for 30 seconds, annealing at 60℃ for 1 minute, and extension at 72℃ for 2 minutes. ③ Denaturation at 94℃ for 30 seconds, annealing at 44℃ for 1 minute, and extension at 72℃ for 2 minutes. ① Perform 15 reaction cycles. ② Anneal at 72℃ for 10 minutes.

[0070] Take 5 μL each of the 1st, 2nd, and 3rd PCR reaction solutions and perform electrophoresis on a 1% agarose gel. The electrophoresis results are as follows: Figure 2As shown in the figure. The results indicate that the product amplified using AP3 and SP3 primers is likely the target fragment. The product amplified using AP3 and SP3 primers for 3rd PCR was selected, and the product was electrophoresed on a 1% agarose gel. The gel was then recovered using a gel extraction kit. The product was ligated into the 007S vector using the 007S-Topo kit (Tsingke, Nanjing), transformed into DH5α competent E. coli cells (Tsingke, Nanjing), and then selected for sequencing. The obtained sequence was compared with the known CDS sequence DNA fragment (5' end) of PeACR3, confirming that the product sequence was the PeACR3 promoter region sequence, with a full length of 1304 bp. Based on the determined PeACR3 promoter region sequence, primers Primer1 and Primer2 were designed, and the primer sequences are shown in Table 5. High-fidelity DNA polymerase I-5 was used. TM PCR amplification was performed using 2×High-Fidelity Master Mix, and the PCR system is shown in Table 6.

[0071] Table 5: Primer nucleotide sequences

[0072] Primer name Nucleotide sequence (5'-3') Primer1 CAAGAAGAACGTAGATGGGT(SEQ ID NO.5) Primer2 CTCCCTTGACATAATACCCG(SEQ ID NO.6)

[0073] Table 6: PCR reaction system

[0074] Components Volume (μL) Primer1 2 Primer2 2 DNA polymerase I-5 25 promoter DNA fragment 1 <![CDATA[ddH2O]]> 20

[0075] The PCR amplification program was as follows: ① Pre-denaturation at 98℃ for 2 min. ② Denaturation at 98℃ for 10 sec, annealing at 55℃ for 15 sec, and extension at 72℃ for 30 sec. ③ Perform 34 reaction cycles. ④ Anneal at 72℃ for 5 min.

[0076] The amplified product was purified by gel electrophoresis, and the promoter sequence was re-cloned using the 007BS-Topo cloning kit (Tsingke, Nanjing). The resulting DNA fragment was named PeACR3Pro. The total promoter length was 1304 bp.

[0077] The nucleotide sequence of PeACR3Pro is as follows:

[0078] TGCAACACAATCGTCAAATGCCCAATAACACAATCACGAGACAACATGCAGGAGAT

[0079] AAATTAGACGCCCATGCAGATTCTAAACTAAAACATTCTTTTTACAGCAAATAGATGACC

[0080] ACCATCACAAATATTTTTTATGTAGAAATTGGTCATGTAACCTGGTCCAAATTCAAACAC

[0081] AATGCTAAGGCTGCCGAGATGTGCGAAAAACGTTGCCAACGAATTTAGTTTTCCAAAAC

[0082] ACTGAACTCAAGATCAAAATTTAGTTTTTACAGATTAATGACCAAAATTGGCCAACAACC

[0083] CCCCATTTAAATGTGGACCATAGATCCAACACTTAAAACGGAGGAACAGCGTGTCTGAG

[0084] ACTTGTGTGGGGGCGGGAGTTCTAAACCTTCTCCAATATCCGAATCTTGCCCATTGGCTC

[0085] TTCCCCCATCGCAAGAGCGCTTCTTCCTCTCATTCCAAAATTCTTTTCCGCCCTATTAAAA

[0086] CCCTCGCTCTCTGCCAGCAGCGTGTGAGAGTGAGAGGGAGCGAGAGACGAGGCGGAC

[0087] GGGCGAGCGAGAGAGGAGGCAGCGTAGCAGTCGCAGCAGGTATGGCTAACTCCAGTGC

[0088] AGAGCGAAAGCAGCAAATGGCCCTGGACATTGCTGATGGGAACGACCCGTCAGACGCT

[0089] GAAAAAACCGCTGACGAAGGCATAAAACGTGAGGTTATCCCTCTCCCTCTCCCTCTTGC

[0090] GCCCCCGCGCGCGCGCGCGCGCACACACACACACACATTAAGATAACCTTCCTTTCTCT

[0091] GTCTCACTGACGACATGCATTCTCTCTCTCTCTCTCTCTCTCGTCGTGGCTTTGCTTCTCT

[0092] GTCGGCTCCCTGCTGTTTTCTACACGCATGCATCTCAAGAAATTGGGCGTGTGTCGTCTG

[0093] GTTTCTTGATTTTTGTCCGTTCGTCCCTCCTCTTCTCTCTCTCTCTCTCTCTCTCTC

[0094] TCTCTCACACACACACACACACACACACACACACGTACGTCATGCGGCTCATGCC

[0095] TTTGCTTGTCTGTCTGGTCCCTCTGTAGGCTACTACACCCATACAGTTTAGGAAGTTAGG

[0096] TGCTGTGTGTGCTCACATTTGAAATTGTGTAGGTGCAATCGCTGCTTTTTGTGTTTGTGT

[0097] GAGAGAGAGAGATTGTGTGACCTGCGAAATTTCATGTGTGTGCTGTGTTCTTTGTACGCT

[0098] TGTTTTCTTGTTGGGGGGGGAGGGGGGGGAGACAGAGAGAGAGAATTTATTGTAGTGA

[0099] AAGGAGAGAGAGAGAGAGAGAGAGAGAGTTCGTGTAACTTACGGAACTTCA

[0100] T(SEQ ID NO.1).

[0101] Example 2 Construction of recombinant expression vector

[0102] 1. Enzyme digestion of 1300GN vector and amplification products

[0103] (1) The plasmid pCAMBIA1300GN (kindly provided by Nanjing Agricultural University) was digested with restriction endonucleases BamHI and KpnI, respectively. The digestion system is shown in Table 7:

[0104] Table 7: Enzyme digestion system

[0105]

[0106]

[0107] (2) The recovered amplification product obtained in Example 1 was subjected to PCR amplification using I5 high-fidelity enzyme, and the product was purified by gel extraction. The PCR system is shown in Table 8:

[0108] Table 8: PCR reaction system

[0109] Components Volume (μL) PeACR3Pro-F (20μM) 2 PeACR3Pro-R (20μM) 2 DNA polymerase I-5 25 PeACR3 template DNA 1 <![CDATA[ddH2O]]> 20

[0110] The PCR amplification program was as follows: ① Pre-denaturation at 98℃ for 2 min. ② Denaturation at 98℃ for 10 sec, annealing at 55℃ for 15 sec, and extension at 72℃ for 30 sec.

[0111] ② Perform 34 reaction cycles. ③ Anneal at 72℃ for 5 minutes.

[0112] The primer sequences are shown in Table 9:

[0113] Table 9: Primer nucleotide sequences

[0114]

[0115] 2. Construction of the recombinant vector

[0116] The digested vector backbone and amplification product were ligated using Premix ligase (Yeasen, Shanghai) to obtain the recombinant plasmid 1300GN-Unigene0002384. The ligation system is shown in Table 10.

[0117] Table 10: Connection System

[0118] Components Volume (μL) Premix ligase 5 1300GN carrier 2.5 Amplified product fragment 2.5 <![CDATA[ddH2O]]> 10

[0119] 3. Transformation of competent cells using recombinant plasmid vectors

[0120] Transform 10 μL of the ligation product into 100 μL of DH5α competent cells: After mixing the product with the competent cells, incubate on ice for 30 min, heat shock at 42℃ for 90 s, immediately place on ice for 2 min, add 500 μL of LB medium preheated to room temperature, and culture on a shaker at 37℃ for 1 h at 180 rpm. Centrifuge at 5000 rpm for 3 min, discard 500 μL of culture supernatant, mix the remaining 100 μL with a pipette, spread evenly on an LB plate containing 50 μg / mL kanamycin, invert, and incubate overnight at 37℃.

[0121] 4. Sequencing and identification

[0122] Positive single colonies were selected and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0123] Sequencing results showed that the PeACR3Pro recombinant vector promoter sequence in the obtained 1300GN-Unigene0002384 particle vector was correct.

[0124] 5. Extract plasmids from correctly sequenced positive strains.

[0125] The positive strains with correct sequencing were expanded and cultured overnight at 37°C in 20 ml LB medium containing kanamycin resistance. Plasmids were then extracted. A schematic diagram of the recombinant plasmid 1300GN-Unigene0002384 is shown below. Figure 3 As shown.

[0126] Example 3: Obtaining and Validating Transgenic Plants

[0127] 1. Transformation of recombinant plasmids

[0128] The recombinant plasmid 1300GN-Unigene0002384 obtained in Example 2 was electroporated to transform Agrobacterium strain GV3101. After culturing on Kans resistant medium for two days, single colonies were picked and positive clones were identified by shaking.

[0129] 2. Screening of transgenic Arabidopsis plants

[0130] (1) Agrobacterium infection

[0131] Wild-type Arabidopsis thaliana was planted in substrate soil, and the constructed Agrobacterium strain GV3101 was streaked when the Arabidopsis began to bolt. After the appearance of green flower buds in the Arabidopsis, Agrobacterium was expanded in LB medium containing KANA and RIF resistance. After the Agrobacterium reached its optimal activity OD (0.8-1.0), the bacterial cells were enriched and transferred into the invasion staining solution (5% sucrose, 0.02% sliwet77). The unopened flowers of Arabidopsis (preferably with a slight white tinge) were immersed in the infection solution for 45 seconds.

[0132] (2) Arabidopsis thaliana cultivation

[0133] First, place Arabidopsis seeds in 1.5ml centrifuge tubes for sterilization. Add 1ml of 75% ethanol and shake the tubes for 1-2 minutes. Add 1ml of 5% sodium hypochlorite solution and wash inverted for about 10 minutes, then aspirate the solution from the centrifuge tubes. Add sterile deionized water, wash inverted, and discard the solution; repeat this process 5 times. Evenly sow the sterilized Arabidopsis seeds on 1 / 2 MS medium and place them in the dark at 4℃ for 3 days, then transfer them to a light incubator for 7 days. After observing the Arabidopsis seeds germinate and develop two cotyledons, transplant them into pots containing sand and vermiculite. Cover with plastic wrap and cultivate in a greenhouse. Cultivation conditions: 14h / day photoperiod, average day / night temperature of 26℃ / 20℃, maintaining ~60% relative humidity and 350μmol / m³.-2 s -1 Provide adequate light intensity. Remove the plastic wrap after one week, and water with nutrient solution every 3 days during the growing cycle. Finally, wait for the Arabidopsis thaliana to mature and be harvested. After drying, store in a cool, dry place.

[0134] (3) Screening of positive Arabidopsis thaliana transgenic plants

[0135] The T1 generation of transgenic Arabidopsis thaliana was harvested through culture and propagation. T1 generation Arabidopsis thaliana seedlings were germinated on 1 / 2 MS medium supplemented with 30 mg / L hygromycin, and positive transformant plants were screened out.

[0136] (4) qRT-PCR identification of transgenic Arabidopsis thaliana lines

[0137] After selecting positive seedlings, they were cultured on 1 / 2 MS medium containing 30 mg / L hygromycin until their biomass reached a certain level. Plant tissues were then collected to extract plant RNA, and transgenic Arabidopsis lines were identified by semi-quantitative PCR (using hygromycin as the target product). Hygromycin-resistant transgenic Arabidopsis lines Ex-1, Ex-2, and Ex-3 were obtained through hygromycin screening, demonstrating good growth under resistant conditions.

[0138] The primers for the semi-quantitative PCR reaction are shown in Table 11, and the PCR reaction system is shown in Table 12.

[0139] Table 11: Primer nucleotide sequences

[0140] Primer name Nucleotide sequence (5'-3') Primer1 ATGCTCAACACATGAGCGAA(SEQ ID NO.9) Primer2 CCACTATCCTTCGCAAGACC(SEQ ID NO.10)

[0141] Table 12: PCR reaction system

[0142] Components Volume (μL) Primer1 (10μM) 0.4 Primer2 (10μM) 0.4 2×ChamQ SYBR Color qPCR Master Mix 10 cDNA 2 <![CDATA[ddH2O]]> 7.2

[0143] The PCR amplification program was as follows: ① 95℃ pre-denaturation for 30 seconds. ② 95℃ denaturation for 10 seconds, 60℃ annealing for 30 seconds. ③ Perform 40 reaction cycles. ④ 95℃ denaturation for 15 seconds, 60℃ annealing for 60 seconds, 95℃ extension for 15 seconds.

[0144] After the PCR reaction was completed, electrophoresis was performed on a 1% agarose gel. The electrophoresis results are as follows: Figure 4 As shown, the results are consistent with expectations.

[0145] 3. Cultivation of transgenic Arabidopsis thaliana lines

[0146] Seeds of the positive transgenic Arabidopsis line Ex-1 obtained above were germinated on sterile 1 / 2 MS medium containing 30 mg / L hygromycin. Five days later, Arabidopsis seedlings with uniform growth were transferred to CK (without As V) and 1 / 2 MS medium containing 50 μM As V and 50 μM As III, respectively.

[0147] 4. GUS staining analysis

[0148] After 10 days of cultivation in a greenhouse, the underground parts of Arabidopsis thaliana were taken for GUS staining experiments, and DNA was extracted from the aboveground parts and PCR and gel electrophoresis were performed using primers with the nucleic acid sequence.

[0149] GUS staining results are as follows Figure 5 As shown, the results indicate that the infected Arabidopsis thaliana stained blue after being cultured on pentavalent arsenic plates, indicating that the reporter gene GUS was induced and started by pentavalent arsenic. However, the staining results after being cultured on CK plates and trivalent arsenic plates were not visible, indicating that the PeACR3Pro promoter sequence can initiate the expression of downstream genes when induced by pentavalent arsenic, but is not induced by trivalent arsenic.

[0150] To further verify that the promoter sequence can initiate downstream gene expression when induced by pentavalent arsenic, Arabidopsis transgenic lines Ex-1, Ex-2, and Ex-3 were treated with different concentrations of pentavalent arsenic (20 μM and 100 μM) and different concentrations of trivalent arsenic (20 μM and 100 μM). RNA was extracted from each Arabidopsis transgenic line for reverse transcription, and the expression level of the GUS gene was detected by qRT-PCR.

[0151] The results are as follows Figure 6 As shown, the results indicated that GUS expression was highest in Arabidopsis transgenic lines under pentavalent arsenic stress. At a concentration of 20 μM pentavalent arsenic, the average expression level of the GUS gene increased from approximately 0.008 to 0.014–0.031, and at a concentration of 100 μM pentavalent arsenic, the average expression level increased from approximately 0.008 to 0.020–0.034. In contrast, GUS expression was extremely low in Arabidopsis transgenic lines under trivalent arsenic stress, lower than that of the wild type. Specifically, at a concentration of 10 μM trivalent arsenic, the average expression level of the GUS gene decreased from approximately 0.008 to 0.002, and at a concentration of 50 μM trivalent arsenic, the average expression level decreased from approximately 0.008 to 0.002–0.004. This suggests that trivalent arsenic may inhibit GUS gene expression.

[0152] The above experiments demonstrate that the PeACR3Pro promoter obtained from the PeACR3 gene has the ability to be induced by pentavalent arsenic and may be inhibited by trivalent arsenic.

[0153] The embodiments of the present invention have been described in detail above. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A DNA molecule, characterized in that, The nucleotide sequence of the DNA molecule is shown in SEQ ID NO.1, and the DNA molecule has promoter function.

2. A biological material, which is any one of 1) to 3) below: 1) An expression cassette containing the DNA molecule as described in claim 1; 2) A recombinant vector containing the DNA molecule as described in claim 1; 3) A recombinant vector containing the expression cassette described in 1).

3. The use of the DNA molecule of claim 1 as and / or in the preparation of promoters.

4. The application according to claim 3, characterized in that, The promoter is a pentavalent arsenic-induced promoter.

5. The application of the DNA molecule of claim 1 or the biological material of claim 2 in the cultivation of transgenic plants.

6. The use of the DNA molecule of claim 1 or the biomaterial of claim 2 in driving the expression of a target gene in plants.

7. The application according to claim 6, characterized in that, The target gene is the PeACR3 gene.

8. A method for preparing a transgenic plant, characterized in that, The method includes the following steps: introducing the biomaterial as described in claim 2 into a plant.

Images