Codon-optimized yak Beta-lactoglobulin gene and its application

Through the combination of codon optimization and specific expression vectors, the efficient expression of Beta-lactoglobulin in Pichia cerevisiae is achieved, solving the problem of insufficient expression in the prior art and achieving the effect of industrial production level.

CN116200397BActive Publication Date: 2025-06-06THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310157743.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-13
Publication Date
2025-06-06
Estimated Expiration
2043-02-13

AI Technical Summary

Technical Problem

In the prior art, the expression of Beta-lactoglobulin is insufficient and it is difficult to meet the needs of industrial production.

Method used

The genes of yak Beta-lactoglobulin are optimized by codons, combining specific expression vectors and yeast strains, and efficient expression in Pichia yeast is achieved.

Benefits of technology

The expression of Beta-lactoglobulin has been significantly increased, reaching the industrial production level, and can be used to prepare artificial dairy products with higher application value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116200397B_ABST
    Figure CN116200397B_ABST
Patent Text Reader

Abstract

The present invention provides a codon-optimized yak Beta-lactoglobulin gene, an application of the gene in preparing yak Beta-lactoglobulin, an expression vector, a yeast strain for efficiently expressing yak Beta-lactoglobulin, and a method for preparing yak Beta-lactoglobulin. Through the above technical scheme, the present invention can efficiently ferment and produce yak Beta-lactoglobulin, so it can be used to prepare artificial milk food, nutritional additives, biomedicine and daily cosmetic products with higher application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a codon-optimized yak Beta-lactoglobulin gene, the use of the gene in preparing yak Beta-lactoglobulin, an expression vector, a yeast strain for efficiently expressing yak Beta-lactoglobulin, and a method for preparing yak Beta-lactoglobulin. Background Art

[0002] Beta-lactoglobulin is the main component of whey protein, with a molecular weight of 18kDa, accounting for about 50-55% of the weight of whey protein and 7-12% of the weight of the whole fresh milk protein. Beta-lactoglobulin is rich in branched-chain amino acids and can be used as an energy source to provide energy. Beta-lactoglobulin is rich in cysteine ​​and methionine, which can be used to maintain the level of glutathione in the body and play an antioxidant role. Beta-lactoglobulin also contains a large amount of lysine and arginine, which can stimulate the secretion of metabolic hormones and promote muscle growth. Beta-lactoglobulin can also combine with minerals (such as zinc, calcium), fat-soluble vitamins (VA, VE) and lipids, and has antioxidant and antiviral activity. Adding Beta-lactoglobulin can improve the flavor and texture of yogurt products and increase the absorbability of nutrients in yogurt. Beta-lactoglobulin has multiple ligand binding sites, which can effectively embed, deliver and protect bioactive ingredients from oxidation and degradation. It is an important green biological carrier and can be used to load fat-soluble functional factors such as retinols, folic acid, resveratrol, catechins, hesperidin, quercetin, tea polyphenols, phospholipids, curcumin, fatty acids, laurate and cholesterol, etc. Therefore, Beta-lactoglobulin has huge application scenarios and market demand in the fields of nutritional additives, biopharmaceuticals and cosmeceuticals.

[0003] In recent years, in the food, detergent, papermaking, chemical, pharmaceutical and cosmeceutical industries, in order to overcome the difficulties of protein extraction from natural sources and reduce costs, recombinant proteins have been widely used. However, there is still a need to further improve the expression of Beta-lactoglobulin. Summary of the invention

[0004] The purpose of the present invention is to further increase the expression level of Beta-lactoglobulin.

[0005] In order to achieve the above object, the present invention provides a codon-optimized yak Beta-lactoglobulin gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0006] The present invention also provides the use of the gene as described above in preparing yak Beta-lactoglobulin.

[0007] The present invention also provides an expression vector, into which the gene as described above is inserted to form an expression frame for expressing Beta-lactoglobulin shown in SEQ ID NO.2.

[0008] Optionally, the nucleotide sequence of the expression vector is shown as SEQ ID NO.3.

[0009] The present invention also provides a yeast strain for efficiently expressing yak Beta-lactoglobulin, wherein the yeast strain is Pichia pastoris into which the expression vector as described above is introduced.

[0010] The present invention also provides a method for preparing Beta-lactoglobulin, which comprises: culturing the yeast strain as described above to obtain a cultured material, and purifying the Beta-lactoglobulin from the cultured material.

[0011] Optionally, the culture conditions include: the components of the culture medium include 10-30 g / L peptone, 5-20 g / L yeast extract, 1-2 g / L amino-free yeast nitrogen source, 0.2-0.6 mg / L biotin and 2-10 mL / L methanol; the culture temperature is 25-35°C and the time is 60-90 hours.

[0012] Through the above technical scheme, the present invention achieves high expression of Beta-lactoglobulin in Pichia pastoris, and thus can be used to prepare artificial dairy products with higher application value.

[0013] Other features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the following specific embodiments, they are used to explain the present invention but do not constitute a limitation of the present invention. In the accompanying drawings:

[0015] Figure 1 This is a schematic diagram of the structure of the artificial efficient expression module of yak Beta-lactoglobulin.

[0016] Figure 2 It is the result of the highly efficient secretory expression of optimized yak Beta-lactoglobulin in yeast strain. M, standard molecular weight; GS-BgrLG, yak Beta-lactoglobulin BgrLG secreted and expressed in the fermentation liquid of the strain constructed by the present invention.

[0017] Figure 3 This is the result of comparing the short peptides obtained by mass spectrometry detection of secretory expression proteins with the yak Beta-lactoglobulin sequence. Bold characters represent matching sequences.

[0018] Figure 4 Comparison of the expression levels of the artificially optimized yak Beta-lactoglobulin BgrLG and the original yak Beta-lactoglobulin WtLG. M, standard molecular weight; 1, recombinant strain GS-WtLG expressing the original gene; 2, recombinant strain GS-BgrLG expressing the optimized gene. The box marks the secreted yak Beta-lactoglobulin in the fermentation broth.

[0019] Description of Sequence Listing

[0020] SEQ ID NO.1 is the nucleotide sequence of the codon-optimized yak Beta-lactoglobulin gene;

[0021] SEQ ID NO.2 is the amino acid sequence of codon-optimized yak Beta-lactoglobulin;

[0022] SEQ ID NO.3 is the nucleotide sequence of the constructed high-efficiency expression vector of yak Beta-lactoglobulin;

[0023] SEQ ID NO.4 is the nucleotide sequence of the wild-type gene of yak Beta-lactoglobulin.

[0024] SEQ ID NO.5 is the upstream primer BgrLG-F for quantitative analysis of Beta-lactoglobulin.

[0025] SEQ ID NO.6 is the downstream primer BgrLG-R for quantitative analysis of Beta-lactoglobulin.

[0026] SEQ ID NO.7 is the upstream primer GAP-F for quantitative analysis of the housekeeping gene GAP.

[0027] SEQ ID NO.8 is the downstream primer GAP-R for quantitative analysis of the housekeeping gene GAP. DETAILED DESCRIPTION

[0028] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0029] The invention provides a codon-optimized yak Beta-lactoglobulin gene, the nucleotide sequence of the gene is shown as SEQ ID NO.1.

[0030] The present invention also provides the use of the gene described above in the preparation of yak Beta-lactoglobulin. The gene of Beta-lactoglobulin described above can significantly increase the expression level of yak Beta-lactoglobulin in Pichia pastoris.

[0031] The present invention also provides an expression vector, into which the gene as described above is inserted to form an expression frame for expressing yak Beta-lactoglobulin shown in SEQ ID NO.2.

[0032] Among them, in the sequence of SEQ ID NO.2, the amino acids at positions 1-169 are the main body of yak Beta-lactoglobulin, and the last 6 amino acids are purification tags.

[0033] Among them, a suitable expression vector can be selected according to the adaptability of the host, such as the pPIC9K expression vector of Miaoling Biotechnology Co., Ltd.

[0034] Alternatively, if Figure 1 As shown, the expression vector is inserted with a yak Beta-lactoglobulin expression module, and the expression vector is pPIC-LG, and its nucleotide sequence is shown in SEQ ID NO.3.

[0035] The present invention also provides a yeast strain for efficiently expressing Beta-lactoglobulin, wherein the yeast strain is Pichia pastoris into which the expression vector as described above is introduced.

[0036] The Pichia pastoris may be any commercially used Pichia pastoris expression strain, such as the yeast expression strain GS115 from Miaoling Biotechnology Co., Ltd.

[0037] The present invention also provides a method for preparing Beta-lactoglobulin, which comprises: culturing the yeast strain as described above to obtain a cultured material, and obtaining the Beta-lactoglobulin from the cultured material.

[0038] Optionally, the culture conditions may include: the components of the culture medium include 10-30 g / L peptone, 5-20 g / L yeast extract, 1-2 g / L amino-free yeast nitrogen source, 0.2-0.6 mg / L biotin and 2-10 mL / L methanol; the culture temperature is 25-35°C and the time is 60-90 hours.

[0039] The present invention is further described in detail by way of examples. The raw materials used in the examples can be obtained through commercial sources. The expression vector pPIC9K is a commercial product of Miaoling Biological Company; the yeast expression strain GS115 is a commercial product of Miaoling Biological Company.

[0040] Example 1

[0041] like Figure 1 As shown, this example illustrates the construction process of the yak Beta-lactoglobulin expression module.

[0042] Firstly, the target yak Beta-lactoglobulin codon-optimized coding gene BgrLG was synthesized by chemical synthesis, and the target Beta-lactoglobulin expression functional module was constructed.

[0043] Then, restriction endonuclease SnaBI and NotI sequence were added to connect to the yeast expression vector pPIC9K multiple cloning site to construct vector pPIC-BgrLG.

[0044] Next, the positive recombinant expression vector pPIC-BgrLG that was verified to be correct was cut with restriction endonuclease Sal I to prepare linearized plasmid DNA, which was then electroporated (1.5 kV, 25 μF, 200 Ω) into Pichia pastoris GS115. Positive recombinant yeast strains were screened using geneticin resistance plates, and identified using colony PCR and sequenced for verification.

[0045] The identification and sequencing results showed that the expression function module of the target yak Beta-lactoglobulin encoding gene BgrLG was successfully constructed. The expression module was connected to the vector pPIC9K to construct the recombinant expression plasmid pPIC-BgrLG ( Figure 1 ) and transformed into Pichia pastoris for integration. The research results showed that the yak Beta-lactoglobulin yeast expression yeast strain GS-BgrLG was constructed.

[0046] Example 2

[0047] This example is used to illustrate the efficient expression of Beta-lactoglobulin in Pichia pastoris.

[0048] This example uses the yak Beta-lactoglobulin expression module strain GS-BgrLG constructed in Example 1 and the control yeast expression strain GS115.

[0049] First, the Beta-lactoglobulin strain was picked up and placed in a seed liquid medium (the medium ingredients included 20 g / L peptone, 10 g / L yeast extract and 20 g / L glucose), and cultured at 30° C. for 20 hours.

[0050] Next, it was transferred to 100 mL of fermentation medium (the components of the medium included 10-30 g / L of peptone, 5-20 g / L of yeast extract, 1-2 g / L of amino-free yeast nitrogen source, 0.2-0.6 mg / L of biotin and 2-10 mL / L of methanol) at a concentration of 2%, and fermented in a shake flask at 30°C and 220 rpm for 72 hours, with methanol added every 24 hours (the amount of methanol added was 5 mL / L). Then, the fermentation supernatant was collected by centrifugation, and the milk protein was purified using the His-Tag label of artificial milk protein and Ni-NTA-resin purification column, and the expression of the target milk protein was detected by SDS-PAGE protein electrophoresis ( Figure 2 ), and the expression product was identified by MS mass spectrometry analysis ( Figure 3 ).

[0051] The experimental results showed that the yeast expression strain GS-BgrLG with the yak Beta-lactoglobulin gene expression functional module was able to induce efficient heterologous expression of Beta-lactoglobulin through shake flask fermentation, and mass spectrometry identification showed that the expressed protein was yak Beta-lactoglobulin. The results showed that the extracellular concentration of Beta-lactoglobulin expressed by the expression strain GS-BgrLG was as high as 352 mg / L, reaching the industrial production level.

[0052] Example 3

[0053] This example is used to illustrate that the optimized Beta-lactoglobulin encoding gene significantly increased the expression level of Pichia pastoris.

[0054] First, the original coding gene WtLG of the target yak Beta-lactoglobulin was synthesized by chemical synthesis. The nucleotide sequence of the gene is shown in SEQ ID NO.4

[0055] Then, the yeast expression strain GS-WtLG of the original yak Beta-lactoglobulin gene WtLG was constructed using the same method as in Example 1.

[0056] Next, the yak Beta-lactoglobulin expression module strain GS-BgrLG constructed in Example 1 and the control yeast expression strain GS-WtLG expressing the original gene WtLG were used as the starting strains. The culture medium (the components of the culture medium include 10-30g / L peptone, 5-20g / L yeast extract, 1-2g / L amino-free yeast nitrogen source, 0.2-0.6mg / L biotin and 2-10mL / L methanol) was transferred to the fermentation medium at a concentration of 2% and fermented in a shake flask at 30°C and 220rpm for 72 hours, and methanol was added every other day (the amount of methanol added was 5mL / L). The fermentation supernatant was collected by centrifugation, and the expression of the target milk protein was detected by SDS-PAGE protein electrophoresis ( Figure 4 ).

[0057] The experimental results showed that the constructed strain GS-BgrLG could clearly detect the induced Beta-lactoglobulin BgrLG, while the strain GS-WtLG expressing the original gene sequence could only see a faint band. After purifying the target milk protein with Ni-NTA-resin purification column and comparing the protein expression levels, the results showed that the expression level of the strain GS-WtLG expressing the original gene of yak Beta-lactoglobulin was 1.34 mg / L, while the expression level of the strain GS-BgrLG expressing the optimized gene sequence was 262 times that of the GS-WtLG strain.

[0058] Example 4

[0059] This example is used to illustrate the number of inserted copies of the BgrLG gene in the yak Beta-lactoglobulin expression module strain GS-BgrLG.

[0060] This example uses the yak Beta-lactoglobulin expression module strain GS-BgrLG constructed in Example 1. Real-time fluorescence quantitative PCR method was used for detection.

[0061] Firstly, the Pichia pastoris housekeeping gene GAP was selected as the internal reference gene, and real-time quantitative primers were designed using BgrLG and GAP genes as templates.

[0062] Primers sequence BgrLG-F TGTTCAAGATAGACGCGCTGA(SEQ ID NO.5) BgrLG-R TTGGGTTGAAGCTGAGACGG(SEQ ID NO.6) GAP-F GGTATTAACGGTTTCGGACGTATTG(SEQ ID NO.7) GAP-R GATGTTGACAGGGTCTCTCTCTTGG(SEQ ID NO.8)

[0063] Next, the Beta-lactoglobulin expression module strain GS-BgrLG was inoculated into liquid culture medium and cultured at 30° C. for 20 hours, and the genome was extracted to determine the genome concentration and purity.

[0064] Then, the extracted GS-BgrLG genome sample was diluted 10 times to obtain the original solution, 10 -1 , 10 -2 , 10 -3 Four gradients. Similarly, fluorescent quantitative PCR was performed using BgrLG-F and BgrLG-R, GAP-F and GAP-R as primers. Each gradient was repeated 3 times. Subsequently, based on the standard curve, the ratio of the copy number of the GS-BgrLG gene to the copy number of the GAP gene was used as the benchmark, which was the starting copy number of the GS-BgrLG gene in the Pichia pastoris genome.

[0065] The experimental results showed that the gene copy number of BgrLG in the yak Beta-lactoglobulin expression module strain GS-BgrLG was between 4.46 and 6.28, and the average value was selected considering the system error. The gene copy number of BgrLG in the engineered yeast strain GS-BgrLG was 5.

[0066] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0067] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0068] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. Application of codon-optimized yak Beta-lactoglobulin gene in the preparation of yak Beta-lactoglobulin, It is characterized in that The nucleotide sequence of the gene is shown in SEQ ID NO.1; The Beta-lactoglobulin gene increases the expression level of yak Beta-lactoglobulin in Pichia pastoris.

2. An expression vector, It is characterized in that The expression vector is inserted with the gene described in claim 1 and forms an expression frame for expressing yak Beta-lactoglobulin shown in SEQ ID NO.

2.

3. The expression vector according to claim 2, in, The nucleotide sequence of the expression vector is shown in SEQ ID NO.

3.

4. A yeast strain that efficiently expresses yak Beta-lactoglobulin, It is characterized in that The yeast strain is Pichia pastoris into which the expression vector according to any one of claims 2 to 3 is introduced.

5. A method for preparing yak Beta-lactoglobulin, It is characterized in that The method comprises: culturing the yeast strain according to claim 4 to obtain a cultured material, and purifying the Beta-lactoglobulin from the cultured material.

6. The method according to claim 5, in, The culture conditions include: the components of the culture medium include 10-30 g / L of peptone and 5-20 g / L of yeast extract.

7. The method according to claim 6, in, The culture medium also includes 1-2 g / L of an amino-free yeast nitrogen source.

8. The method according to claim 6, in, The components of the culture medium also include 0.2-0.6 mg / L of biotin and 2-10 mL / L of methanol.

9. The method according to claim 6, in, The culture conditions also include: a culture temperature of 25-35° C. and a culture time of 60-90 hours.

Citation Information

Patent Citations

  • Recombinant proteins

    WO2022269549A2