A novel gene editing system for mediating A to C mutation or T to G mutation in mammals and its application

Abstract

The present invention relates to a novel gene editing system for mediating A to C mutation or T to G mutation in mammals and its application. The gene editing system is a fusion protein constructed by fusing artificially evolved mouse-derived 3-methyladenine glycosidase, monomeric adenosine deaminase Tad-8e, and catalytically impaired Cas9n. The method for mediating A to C mutation or T to G mutation in mammals comprises the following steps: (1) preparing a gRNA sequence for a target genome editing site in vitro; (2) preparing mRNA of a single-base editor ACBE2Q in vitro; (3) introducing the single-base editor system and gRNA into a target eukaryotic cell; (4) screening correctly edited eukaryotic cells.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a novel gene editing system for mediating A to C mutation or T to G mutation in mammals and its application. Background Art

[0002] The essence of human genetic diseases is gene mutation. About 60% of genetic diseases are caused by single base mutations. The traditional homologous recombination mediated by genome editing technology is very inefficient (0.1%-5%) to correct such genetic diseases. [1,2] The single-base editor derived from the CRISPR system is an emerging high-efficiency base editing technology in recent years. It has shown great application prospects in basic research and clinical disease treatment due to its advantages such as no DNA double-strand breaks, no need for recombination templates, and high-efficiency editing.

[0003] Classic base editors are mainly divided into cytosine base editors (CBE) and adenine base editors (ABE). The former is composed of the activity-impaired spCas9n from Streptococcus pyogenes, rat-derived cytosine deaminase rAPOBEC1 and uracil glycosidase inhibitor. The Cas9 protein recognizes and specifically binds to DNA with NGG as PAM, and then, under the action of deaminase and DNA repair, it finally achieves C·GT·A replacement within 20bp of the upstream target sequence of NGG (positions 21-23). ​​The editing window is mainly located at positions 4-8. [2] , which is expected to correct 14% of human pathogenic point mutations; the latter is to fuse the bacterial TadA with spCas9, and with the assistance of directed evolution and protein engineering transformation technology, after 7 rounds of evolution, it finally obtained the adenine base editor ABE7.10 that can act on single-stranded DNA. The active editing region is mainly located at positions 4-7. The average editing efficiency of A·TG·C caused by this system in human cells is about 53%, which is much higher than the efficiency of base mutation mediated by homologous recombination. The purity of its product is as high as 99.9% and the occurrence of extremely low indels (insertions and deletions) is very low. [3] More importantly, about 47% of human pathogenic point mutations are caused by mutations from C·G to T·A, and adenine base editors are expected to correct nearly half of the pathogenic point mutations. [1] , showing its great potential in mutation base modification and genetic disease treatment. Currently, ABE has been widely used in animal model preparation. [4-8] and gene therapy [9-14] .

[0004] Both CBE and ABE can only achieve base conversion. In the early process of developing CBE, scientists found that knocking out intracellular uracil glycosidase (UNG) or removing cytosine glycosidase inhibitor (UGI) would produce C·G-to-G·C and C·G-to-A·T editing byproducts, that is, C-based transversion occurs. [3,15] Recently, based on the phenomenon of editing byproducts produced by previous CBEs, scientists have developed a series of CGBEs by fusing CBEs with UGI removed with different types of UNG, DNA damage repair proteins or trans-damage polymerases. [16-19] , which is expected to treat the 11% pathogenic point mutation of G·C to C·G.

[0005] However, there is no reported enzyme that can directly catalyze adenine (A) in genomic DNA to cytosine (C), and the reverse strand is cytosine (T) to guanine (G). Human pathogenic point mutations (SNVs) that require A to C or T to G to correct account for 16%, and C to A or G to T pathogenic point mutations are also the second most common pathogenic SNVs, which is beyond the range of diseases that can be covered by classic CBE. [1] .

[0006] [References]

[0007] [1]Rees HA, Liu DR. Base editing: Precision chemistry on the genome and transcriptome of living cells. Nat Rev Genet, 2018, 19: 770-788

[0008] [2]Komor AC, Kim YB, Packer MS, et al. Programmable editing of a targetbase in genomic DNA without double-stranded DNA cleavage. Nature, 2016, 533: 420-424

[0009] [3]Gaudelli NM,Komor AC,Rees HA,et al.Programmable base editing of a*t to g*c in genomic DNA without DNA cleavage.Nature,2017,551:464-471

[0010] [4]Liang P,Sun H,Zhang X,et al.Effective and precise adenine baseediting in mouse zygotes.Protein Cell,2018,9:808-813

[0011] [5]Ma Y,Yu L,Zhang X,et al.Highly efficient and precise base editingby engineered dcas9-guide trna adenosine deaminase in rats.Cell Discov,2018,4:39

[0012] [6]Liu Z,Lu Z,Yang G,et al.Efficient generation of mouse models ofhuman diseases via abe-and be-mediated base editing.Nat Commun,2018,9:2338

[0013] [7]Ryu SM,Koo T,Kim K,et al.Adenine base editing in mouse embryos andan adult mouse model of duchenne muscular dystrophy.Nat Biotechnol,2018,36:536-539

[0014] [8]Yang L,Zhang X,Wang L,et al.Increasing targeting scope ofadenosine base editors in mouse and rat embryos through fusion of tadadeaminase with cas9 variants.Protein Cell,2018,9:814-819

[0015] [9]Suh S,Choi EH,Leinonen H,et al.Restoration of visual function inadult mice with an inherited retinal disease via adenine base editing.NatBiomed Eng,2021,5:169-178

[0016]

[10] Rothgangl T,Dennis MK,Lin PJC,et al.In vivo adenine base editingof pcsk9 in macaques reduces ldl cholesterol levels.Nat Biotechnol,2021,

[0017]

[11] Kim Y,Hong SA,Yu J,et al.Adenine base editing and prime editingof chemically derived hepatic progenitors rescue genetic liver disease.CellStem Cell,2021,

[0018]

[12] Newby GA,Yen JS,Woodard KJ,et al.Base editing of haematopoieticstem cells rescues sickle cell disease in mice.Nature,2021,595:295-302

[0019]

[13] Koblan LW,Erdos MR,Wilson C,et al.In vivo base editing rescueshutchinson-gilford progeria syndrome in mice.Nature,2021,589:608-614

[0020]

[14] Musunuru K,Chadwick AC,Mizoguchi T,et al.In vivo crispr baseediting of pcsk9 durably lowers cholesterol in primates.Nature,2021,593:429-434

[0021]

[15] Komor AC,Zhao KT,Packer MS,et al.Improved base excision repairinhibition and bacteriophage mu gam protein yields c:G-to-t:A base editorswith higher efficiency and product purity.Sci Adv,2017,3:eaao4774

[0022]

[16] Koblan LW,Arbab M,Shen MW,et al.Efficient c*g-to-g*c base editorsdeveloped using crispri screens,target-library analysis,and machinelearning.Nat Biotechnol,2021,

[0023]

[17] Chen L,Park JE,Paa P,et al.Programmable c:G to g:C genome editingwith crispr-cas9-directed base excision repair proteins.Nat Commun,2021,12:1384

[0024]

[18] Zhao D,Li J,Li S,et al.Glycosylase base editors enable c-to-a andc-to-g base changes.Nat Biotechnol,2021,39:35-40

[0025]

[19] Kurt IC, Zhou R, Iyer S, et al. Crispr c-to-g base editors for inducing targeted DNA transversions in human cells. Nat Biotechnol, 2021, 39: 41-46. Summary of the invention

[0026] The present invention relates to a method for editing a single base of a eukaryotic cell genome in vitro, the method comprising the following steps:

[0027] (1) Preparing gRNA sequences targeting target genome editing sites in vitro;

[0028] (2) preparing mRNA of the single-base editor ACBE2Q in vitro;

[0029] (3) introducing the single-base editor and gRNA into target eukaryotic cells;

[0030] (4) Screening for correctly edited eukaryotic cells.

[0031] The eukaryotic cells include, but are not limited to, somatic cells and germ cells; preferably, the eukaryotic cells are egg cells;

[0032] The single-base editor ACBE2Q described in step (2) is a fusion protein constructed by fusing artificially evolved mouse-derived 3-methyladenine glycosylase (Aag) with monomeric adenosine deaminase Tad-8e (or its functional mutant) and Cas9n with impaired catalytic activity, and adding a nuclear localization signal, and its mRNA encodes the polypeptide shown in SEQ ID NO.1;

[0033] The method of introducing the target eukaryotic cells in step (3) includes, but is not limited to, one or any combination of vector transfection, microinjection, transfection, lipofection, heat shock, electroporation, gene gun, DEAE-dextran-mediated transfection, preferably, microinjection is used;

[0034] The screening described in step (4) is to screen the target eukaryotic cells with correct editing results by means of gene sequencing.

[0035] Preferably, the method of introducing the target eukaryotic cells in step (3) is microinjection.

[0036] Specifically, for single cell microinjection, the formula of the cell injection solution is:

[0037] Use nuclease-free water to prepare the injection mixture, and the total volume of the injection mixture is 20 μL;

[0038] The concentration of the ACBE2Q fusion protein mRNA is 1-1000 ng / μL, preferably 10-600 ng / μL, more preferably 50-150 ng / μL; the concentration of the sgRNA is 1-1000 ng / μL, preferably 10-600 ng / μL, more preferably 150-250 ng / μL.

[0039] Most preferably, the injection mixture with a total volume of 20 μL contains the ACBE2Q fusion protein mRNA with a final concentration of 100 ng / μL and the sgRNA with a final concentration of 200 ng / μL.

[0040] The present invention also relates to the following applications of a single base editing system:

[0041] (1) Preparation of gene editing products;

[0042] (2) Preparation of drugs or biological products for the treatment and / or prevention of diseases;

[0043] (3) Preparation of animal models or new plant varieties;

[0044] The single-base editing system comprises: a nucleic acid encoding the single-base editor ACBE2Q, and / or a recombinant vector comprising a nucleic acid encoding the single-base editor ACBE2Q, and / or a recombinant cell or recombinant bacteria comprising a nucleic acid of the single-base editor ACBE2Q.

[0045] The amino acid sequence of the ACBE2Q fusion protein is shown in SEQ ID NO.1.

[0046] SEQ ID NO.1:

[0047]

[0048] The beneficial effects of the present invention are:

[0049] We fused the artificially evolved mouse-derived 3-methyladenineglycosylase with the monomeric adenosine deaminase Tad-8e and the catalytically impaired Cas9n to construct ACBE, and achieved base transversion from A to C or T to G in mice. If this technology is further applied in clinical practice, it is expected to treat the 16% C·G to A·T disease-related SNPs; it will also greatly promote its application in the preparation of human disease models, crop genetic breeding, and other aspects. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 , Schematic diagram of targeting the splice acceptor site of the Duchenne muscular dystrophy (DMD) gene.

[0051] Figure 2 Comparison of high-throughput sequencing results of the F0 generation after microinjection of mRNA of the ACBE2Q system into germ cells.

[0052] Figure 3 , editing efficiency at splice sites in mice bearing the DMD-producing A to C mutation.

[0053] Figure 4 Immunofluorescence staining was performed on F0 and F0 mice to detect the expression of dystrophin. In the figure, DAPI is a nuclear dye, laminin is a control protein sample, Merge is a fluorescence overlay of DAPI and Dystrophin / Laminin, and the scale bar is 50μm. DETAILED DESCRIPTION

[0054] According to the DNA base excision repair mechanism, we fused a mouse 3-methyladenine glycosidase (Aag) variant with monomeric adenosine deaminase Tad-8e and catalytically impaired Cas9n to construct ACBE2Q. The specific structure and design of the fusion protein can be found in the Chinese invention patent applied for by the applicant on the same day. The name of the invention is: "A new gene editing system mediating A to C mutation or T to G mutation and its application".

[0055] Obviously, those skilled in the art will understand that the following examples are only used to illustrate the essence of the present invention, and are not intended to limit the scope of protection of the present invention. Furthermore, using the method of the present invention, a single base A to C (sense strand) or T to G (antisense strand) base transversion can be performed on various mammalian cells including germ cells, somatic cells, and stem cells.

[0056] Based on the DNA base excision repair mechanism, we fused a mouse 3-methyladenine glycosidase (Aag) variant with monomeric adenosine deaminase Tad-8e and catalytically impaired Cas9n to construct ACBE2Q, which was then injected into mouse embryos to edit the splice acceptor site (SAS, Figure 1 ). In the following examples, the mouse strain used to construct the animal model was C57 / BL6 mouse.

[0057] Example 1. Construction and in vitro transcription of mRNA and target sgRNA transcription templates of ACBE single-base editor fusion protein

[0058] 1. Construction of working system mRNA and target sgRNA transcription template

[0059] The T7 promoter was introduced into the mRNA template of ACBE2Q by PCR using primer pair IVT-T7-ACBE2Q-F and IVT-T7-ACBE2Q-R (Table 2).

[0060] Table 1. Target sequences and identification primers used

[0061]

[0062] Table 2. PCR primers used in IVT

[0063] Primer name Primer sequence (5'-3') IVT-T7-ACBE2Q-F GCCGCGATCACTAATACGACTCACTATAGGGAGAGCCGC IVT-T7-ACBE2Q-R CTAGACTTTCCTCTTCTTCTTGGGCTCGAATTCG

[0064] The structure and sequence of the fusion protein of the ACBE2Q sequence single base editor can be found in the Chinese patent application filed by the applicant on the same day. Invention patent, the invention name is: "A new gene editing system for mediating A to C mutation or T to G mutation and its application" .

[0065] 2. sgRNA (DMD-splice sg7) in vitro transcription

[0066] Download mouse-related gene sequences from NCBI, such as Figure 1 As shown, a chemically modified synthetic sgRNA (target sequence is shown in Table 1) was designed and ordered at the target site (the splice acceptor site region at the 5' end of the 27th exon of the dystrophin gene, i.e., the DMD gene) (ordered from GenScript Biotech).

[0067] sgRNA:UUUUCAGAGAGCUAAAGAAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGGCUUUU.

[0068] 3. Transcription of working system mRNA (ACBE2Q)

[0069] In vitro RNA transcription kit (mMESSAGE The T7 template of ACBE2Q obtained by PCR (Table 2) was used for in vitro transcription using the PCR Ultra Kit to obtain the working system mRNA, which was then purified.

[0070] 4. Preparation of Microinjection Mixture

[0071] The injection mixture was prepared with nuclease-free water to obtain a total volume of 20 μL, a mixture of working system mRNA (containing (ACBE2Q mRNA) at a final concentration of 100 ng / μL) and sgRNA (DMD-splice sg7) at a final concentration of 200 ng / μL.

[0072] Example 2: Editing germ cells in vitro

[0073] 1. Collection of 1-cell embryos

[0074] (1) Day 1: 100 μL (5 IU) of PMSG working solution was intraperitoneally injected into 6-8 week old female donor mice between 1 and 2 pm.

[0075] (2) Day 3: 100 μL (5 IU) of hCG working solution was injected into the abdominal cavity of the PMSG-injected female mice between 2 and 4 p.m. After the injection, the hormone-treated female mice were placed in cages with male mice aged 10 to 14 weeks. At the same time, the female mice in estrus who had not been treated with hormones were mated with sterilized male mice at around 4 p.m. to prepare pseudo-pregnant female mice.

[0076] (3) Day 4: Before 9 a.m., check whether the recipient female mice that were caged with the sterilized male mice have pregnancy plugs. The female mice with pregnancy plugs were placed in a new cage for the embryo transfer experiment in the afternoon.

[0077] (4) The superovulated donor mouse was killed by carbon dioxide asphyxiation, and the oviduct was removed and placed in a plate. Preheated M2 culture medium was added to the plate.

[0078] (5) Place the fallopian tube in another new dish, add preheated M2 medium and hyaluronic acid to the dish, and the volume ratio of M2 medium to hyaluronic acid is 9:1. Under a stereo microscope, use a tweezer to pull the ampulla of the fallopian tube to release the embryo from the fallopian tube into the dish. Incubate the embryo in M2 medium with hyaluronic acid until the cumulus cells fall off. After removing the cumulus cells, transfer the embryo to a new dish, add M2 medium without hyaluronic acid to the dish, and repeatedly rinse the embryo with M2 medium to rinse the hyaluronic acid and cumulus cells clean.

[0079] (6) Transfer the rinsed embryos to a new dish, add a few drops of KSOM medium to the dish, and then slowly add mineral oil to the dish so that the KSOM medium is separated and covered by the mineral oil. Generally speaking, in a 35 mm dish, 6 spots of KSOM medium can be added, each spot is 50 μL. Put 50 embryos as a group and first place them in the middle KSOM medium spot for rinsing, and then transfer them to a new medium spot. Before microinjection, incubate the removed embryos in M2 medium in the cell culture incubator.

[0080] 2. Microinjection and embryo transfer

[0081] (1) Prepare the fixation needle, injection needle and siliconized glass slide. Place a drop of M2 medium covered with mineral oil in the middle of the slide.

[0082] (2) The injection needle is allowed to automatically absorb and fill with the microinjection mixture prepared in step 4 of Example 1 by capillary action, and the injection needle is loaded onto the fixed handle of the microinjection instrument.

[0083] (3) Transfer 50 embryos to the M2 medium on the slide, move the fixation needle close to the embryo, and fix the embryo on the fixation needle by negative pressure. After the embryo is fixed, find the cytoplasm under a high-power microscope, push the tip of the injection needle through the zona pellucida and cell membrane, and inject the mixed solution into the cytoplasm of the embryo.

[0084] (4) Transfer the injected embryonic cells to a new M2 culture medium. Repeat steps (3) and (4) until all embryos have been injected. After injecting one experimental group, transfer the embryos to a new KSOM culture medium and place the embryos in a cell culture incubator for 1-2 hours or overnight. After all embryos have been injected, exclude embryos that died due to mechanical damage and transfer healthy embryos to a new KSOM culture medium.

[0085] (5) Inject 600 μL of Avertin into the peritoneal cavity of the pseudopregnant mouse to anesthetize it. Use a shaver to shave the hair on the back of the mouse. Use 70% ethanol to wipe the shaved skin.

[0086] (6) Make a small cut at the location of the ovary, use blunt-tipped forceps to pull the ovarian fat pad to pull the ovary out, and at the same time use hemostats to fix the ovary on the outside. Use blunt-tipped forceps to find the funnel-shaped opening of the fallopian tube located on the lower side of the ovarian sac.

[0087] (7) Allow the transfer needle to absorb M2 culture medium, two small bubbles, and about 15 embryos in sequence. The bubbles are to facilitate observation of the position of the embryos in the transfer needle.

[0088] (8) Gently open the ovarian sac, locate the funnel-shaped opening of the fallopian tube with forceps, extend the transfer needle to the opening of the ovary, then eject the embryo from the transfer needle and gently withdraw the transfer needle.

[0089] (9) Release the hemostatic clamp that fixes the ovarian fat pad, put the ovary back into its original cavity, and suture the muscle opening and skin opening respectively with sutures.

[0090] (10) Place the post-operative mice on a warming table at 37 degrees. After the mice regain consciousness, transfer them to a feeding cage and wait for the embryo to develop until delivery. Generally speaking, the mother mice with successful transplantation give birth to mice after 3 weeks.

[0091] Example 3: Identification of single base editing effects

[0092] 1. Mouse genome identification

[0093] Example 2 After successful transplantation, mice were born with their toes cut for genome identification around 10-15 days after birth. The specific steps were as follows:

[0094] 1.1. Genome extraction

[0095] ① Cut the toes and put them into 1.5mL centrifuge tubes. Add 500μL of toe digestion solution prepared at a ratio of proteinase K: tissue lysis solution = 1:500 to each tube and place in a 55℃ water bath overnight;

[0096] ② Take out the toes that have been digested overnight, place them at room temperature for 10-15 minutes, invert thoroughly to mix, and centrifuge at 13000rpm for 15 minutes.

[0097] ③ Aspirate 400 μL of supernatant from each tube, add an equal volume of chloroform, mix thoroughly until the DNA is precipitated, and centrifuge at 12,000 rpm for 10 minutes.

[0098] ④ Add 200 μL of 75% alcohol pre-cooled in a -20°C refrigerator to each tube, mix gently, centrifuge at 12000 rpm at 4°C for 5 min, discard the supernatant, and dry in a clean workbench.

[0099] ⑤ Add 50-100 μL of deionized ultrapure water according to the amount of DNA, dissolve at 55℃ for 2 hours and it can be used as a PCR template.

[0100] 1.2 Genome identification

[0101] According to the primer pair F / R of the target DMD-splice sg7 in Table 1, the DNA fragment containing the target was obtained, and the double peak was confirmed by first-generation sequencing, and then high-throughput deep sequencing was performed to obtain the editing efficiency. According to the high-throughput results, a total of 32 F0 mice ( Figure 2), 30 F0s mutated, 21 F0s mutated from A to C at the splicing site, accounting for 70% of the mutant F0s, and the average efficiency of A to C mutations at the splicing site was 56.1% ( Figure 3 ).

[0102] 1.3 Phenotypic identification of DMD mutant mice

[0103] The cells from 5-week-old wild-type mice (blank control) and the A to C mutant mice (#D02) identified above at the splicing site of the DMD gene were subjected to immunohistochemical detection as follows:

[0104] Take the tibialis anterior muscle of the mouse and rinse it with alcohol and PBS. Put it in a small cube box covered with OTC glue, put it in an isopentane beaker, freeze it in liquid nitrogen, take it out for about 30 seconds, store it at -20℃, and then perform frozen sections. Wash the prepared sections with PBST 3 times / 5min, draw oil circles at the tissue position, add blocking solution for blocking, and after blocking for 1h, incubate overnight with laminin primary antibody or dystrophin primary antibody (using 1:500 diluted primary rabbit polyclonal antibody (Abcam, ab11575) or primary rabbit polyclonal antibody (Abcam, ab15277)). The sections were washed 3 times / 5 min with PBST, then incubated with 1:1000 anti-rabbit secondary antibody for 2 h, washed 3 times / 5 min with PBST, incubated with 1:100 diluted DAPI for 10 min, washed 3 times / 5 min with PBST, added with anti-quenching agent, covered with a coverslip, sealed with nail polish, and the fluorescence of the sections was observed under a fluorescence microscope.

[0105] The results showed that compared with wild-type mice, the ACBE2Q-treated group (#D02) affected the expression of dystrophin ( Figure 4 ), which also proves that the DMD animal disease model was successfully constructed.

[0106] Finally, it should be noted that the above embodiments are only used to help those skilled in the art understand the essence of the present invention and are not used to limit the protection scope of the present invention. SEQUENCE LISTING <110> East China Normal University & Shanghai Bangyao Biotechnology Co., Ltd. <120> A novel gene editing system for mediating A to C mutation or T to G mutation in mammals and its application <130> BYP2021-0008 <160> 1 <170> PatentIn version 3.5 <210> 1 <211> 1967 <212> PRT <213> Artificial Sequence <400> 1 Met Lys Arg Thr Ala Asp Gly Ser Glu Phe Glu Ser Pro Lys Lys Lys 1 5 10 15 Arg Lys Val Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn 20 25 30 Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys 35 40 45 Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn 50 55 60 Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr 65 70 75 80 Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg 85 90 95 Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp 100 105 110 Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp 115 120 125 Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val 130 135 140 Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu 145 150 155 160 Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu 165 170 175 Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu 180 185 190 Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln 195 200 205 Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val 210 215 220 Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu 225 230 235 240 Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe 245 250 255 Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser 260 265 270 Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr 275 280 285 Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr 290 295 300 Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu 305 310 315 320 Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser 325 330 335 Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu 340 345 350 Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile 355 360 365 Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly 370 375 380 Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys 385 390 395 400 Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu 405 410 415 Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile 420 425 430 His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr 435 440 445 Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe 450 455 460 Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe 465 470 475 480 Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe 485 490 495 Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg 500 505 510 Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys 515 520 525 His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys 530 535 540 Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly 545 550 555 560 Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys 565 570 575 Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys 580 585 590 Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser 595 600 605 Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe 610 615 620 Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr 625 630 635 640 Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr 645 650 655 Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg 660 665 670 Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile 675 680 685 Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp 690 695 700 Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu 705 710 715 720 Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp 725 730 735 Ser Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys 740 745 750 Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val 755 760 765 Met Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu 770 775 780 Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys 785 790 795 800 Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu 805 810 815 His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr 820 825 830 Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile 835 840 845 Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe 850 855 860 Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys 865 870 875 880 Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys 885 890 895 Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln 900 905 910 Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu 915,920,925 Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln 930,935,940 Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys 945 950 955 960 Tyr Asp Glu Asn Asp Lys Ile Arg Glu Val Lys Val Ile Thr Leu 965,970,975 Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys 980,985,990 Val Arg Glu Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu Asn 995 1000 1005 Ala Val Val Gly Thr Ala Leu Ile Lys Tyr Pro Lys Leu Glu 1010 1015 1020 Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys 1025 1030 1035 Met With Lys Ser Glu Gln Glu With Gly Lys With Thr Only Lys 1040 1045 1050 Tyr Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile 1055 1060 1065 Thr Has Asn Gly Glu With Arg Lys Arg Pro Leu With Glu Thr 1070 1075 1080 Asn Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe 1085 1090 1095 Ala Thr Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val 1100 1105 1110 Lys Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile 1115 1120 1125 Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp 1130 1135 1140 Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala 1145 1150 1155 Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys 1160 1165 1170 Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu 1175 1180 1185 Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys 1190 1195 1200 Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys 1205 1210 1215 Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala 1220 1225 1230 Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser 1235 1240 1245 Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu 1250 1255 1260 Lys Gly Ser Ser Gly Gly Ser Ser Gly Gly Ser Ser Gly Ser Glu 1265 1270 1275 Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser Gly Gly 1280 1285 1290 Ser Ser Gly Gly Ser Pro Ala Arg Gly Gly Ser Ala Arg Pro Gly 1295 1300 1305 Arg Gly Ala Leu Lys Pro Val Ser Val Thr Leu Leu Pro Asp Thr 1310 1315 1320 Glu Gln Pro Pro Phe Leu Gly Arg Ala Arg Arg Pro Gly Asn Ala 1325 1330 1335 Arg Ala Gly Ser Leu Val Thr Gly Tyr His Glu Val Gly Gln Met 1340 1345 1350 Pro Ala Pro Leu Ser Arg Lys Ile Gly Gln Lys Lys Gln Arg Leu 1355 1360 1365 Ala Asp Ser Glu Gln Gln Gln Thr Pro Lys Glu Arg Leu Leu Ser 1370 1375 1380 Thr Pro Gly Leu Arg Arg Ser Ile Tyr Phe Ser Ser Pro Glu Asp 1385 1390 1395 His Ser Gly Arg Leu Gly Pro Glu Phe Phe Asp Gln Pro Ala Val 1400 1405 1410 Thr Leu Ala Arg Ala Phe Leu Gly Gln Val Leu Val Arg Arg Leu 1415 1420 1425 Ala Asp Gly Thr Glu Leu Arg Gly Arg Ile Val Glu Thr Glu Ala 1430 1435 1440 Tyr Leu Gly Pro Glu Asp Glu Ala Ala His Ser Arg Gly Gly Arg 1445 1450 1455 Gln Thr Pro Glu Asn Arg Gly Met Phe Met Lys Pro Gly Thr Leu 1460 1465 1470 Tyr Val Phe Leu Ile Tyr Gly Met Tyr Phe Cys Leu Asn Val Ser 1475 1480 1485 Ser Gln Gly Ala Gly Ala Cys Val Leu Leu Arg Ala Leu Glu Pro 1490 1495 1500 Leu Glu Gly Leu Glu Thr Met Arg Gln Leu Arg Asn Ser Leu Arg 1505 1510 1515 Lys Ser Thr Val Gly Arg Ser Leu Lys Asp Arg Glu Leu Cys Ser 1520 1525 1530 Gly Pro Ser Lys Leu Cys Gln Ala Leu Ala Ile Asp Lys Ser Phe 1535 1540 1545 Asp Gln Arg Asp Leu Ala Gln Asp Asp Ala Val Trp Leu Glu His 1550 1555 1560 Gly Pro Leu Glu Ser Ser Ser Pro Ala Val Val Val Ala Ala Ala 1565 1570 1575 Arg Ile Gly Ile Gly His Ala Gly Glu Trp Thr Gln Lys Pro Leu 1580 1585 1590 Arg Phe Tyr Val Gln Gly Ser Pro Trp Val Ser Val Val Asp Arg 1595 1600 1605 Val Ala Glu Gln Met Asp Gln Pro Gln Gln Thr Ala Cys Ser Glu 1610 1615 1620 Gly Leu Leu Ile Val Gln Lys Ser Glu Val Glu Phe Ser His Glu 1625 1630 1635 Tyr Trp Met Arg His Ala Leu Thr Leu Ala Lys Arg Ala Arg Asp 1640 1645 1650 Glu Arg Glu Val Pro Val Gly Ala Val Leu Val Leu Asn Asn Arg 1655 1660 1665 Val Ile Gly Glu Gly Trp Asn Arg Ala Ile Gly Leu His Asp Pro 1670 1675 1680 Thr Ala His Ala Glu Ile Met Ala Leu Arg Gln Gly Gly Leu Val 1685 1690 1695 Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu Tyr Val Thr Phe 1700 1705 1710 Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His Ser Arg Ile 1715 1720 1725 Gly Arg Val Val Phe Gly Val Arg Gln Ser Lys Arg Gly Ala Ala 1730 1735 1740 Gly Ser Leu Met Asn Val Leu Asn Tyr Pro Gly Met Asn His Arg 1745 1750 1755 Val Glu Ile Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu 1760 1765 1770 Leu Cys Asp Phe Tyr Arg Met Pro Arg Gln Val Phe Asn Ala Gln 1775 1780 1785 Lys Lys Ala Gln Ser Ser Ile Asn Ser Gly Gly Ser Ser Gly Gly 1790 1795 1800 Ser Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro 1805 1810 1815 Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser Pro Glu Asp Asn Glu 1820 1825 1830 Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr Leu Asp Glu 1835 1840 1845 Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile Leu Ala 1850 1855 1860 Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His Arg 1865 1870 1875 Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe 1880 1885 1890 Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp 1895 1900 1905 Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu 1910 1915 1920 Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr 1925 1930 1935 Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Met Lys Arg Thr Ala 1940 1945 1950 Asp Gly Ser Glu Phe Glu Ser Pro Lys Lys Lys Arg Lys Val 1955 1960 1965

Claims

1. A method for editing a single base in a eukaryotic cell genome in vitro, the method comprising the following steps: (1) Prepare gRNA sequences targeting target genome editing sites in vitro; (2) Preparation of mRNA of the single-base editor ACBE2Q in vitro; (3) introducing the single-base editor and gRNA into the target eukaryotic cells; (4) Screening for correctly edited eukaryotic cells; The mRNA encoding amino acid sequence of the single-base editor ACBE2Q in step (2) is a polypeptide represented by SEQ ID NO.1; The eukaryotic cells include: Somatic cells, germ cells.

2. The method according to claim 1, characterized in that The eukaryotic cell is an egg cell.

3. The method according to claim 1, characterized in that The method of introducing the target eukaryotic cells in step (3) includes: vector transfection, microinjection, lipofection, heat shock, electroporation, gene gun, DEAE-dextran mediated transfection or any combination thereof; The screening described in step (4) is: screening the target eukaryotic cells with correct editing results by means of gene sequencing.

4. The method according to claim 3, characterized in that The method for introducing the target eukaryotic cells in step (3) is microinjection.

5. The method according to claim 4, characterized in that When performing the microinjection on a single cell, the cell injection solution used is prepared with nuclease-free water, and the total volume of the cell injection mixture is 10-50 μL; it contains: (1) mRNA of ACBE2Q at a concentration of 1-1000 ng / μL; and (2) The sgRNA at a concentration of 1-1000 ng / μL.

6. The method according to claim 5, characterized in that The cell injection mixture contains: (1) mRNA of ACBE2Q at a concentration of 10-600 ng / μL; and (2) The sgRNA at a concentration of 10-600 ng / μL.

7. The method according to claim 6, characterized in that The cell injection mixture contains: (1) mRNA of ACBE2Q at a concentration of 50-150 ng / μL; and (2) The sgRNA at a concentration of 150-250 ng / μL.

8. The method according to claim 7, characterized in that The total injection mixture volume was 20 μL; it contained: The ACBE2Q mRNA at a final concentration of 100 ng / μL; The final concentration of the sgRNA was 200 ng / μL.

9. The following applications of the single-base editing ACBE2Q system: (1) Preparation of gene editing products; (2) Preparation of drugs or biological products for the treatment and / or prevention of diseases; (3) Preparation of animal models or new plant varieties; The system comprises: Nucleic acid encoding the single-base editor ACBE2Q, and / or A recombinant vector encoding a nucleic acid of the single-base editor ACBE2Q, and / or A recombinant cell or recombinant bacterium comprising a nucleic acid of the single-base editor ACBE2Q; The amino acid sequence of the single-base editor ACBE2Q is shown in SEQ ID NO.1.

Images