Pepper cytoplasmic male sterility fertility restoration molecular marker, typing primer and application thereof

Through the use of pepper cytoplasmic male sterility restoration molecular markers and KASP typing primers, the problems of long breeding cycle and environmental dependence caused by pepper pollen abortion were solved, and efficient and accurate pepper breeding screening was achieved.

CN116200525BActive Publication Date: 2025-10-17HUNAN AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202211735954.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-30
Publication Date
2025-10-17
Estimated Expiration
2042-12-30

AI Technical Summary

Technical Problem

In the existing technology, pepper pollen abortion leads to a long breeding cycle and susceptibility to environmental influences, making it difficult to efficiently screen out satisfactory plants.

Method used

Molecular markers for restoring cytoplasmic male sterility in pepper and KASP typing primers were developed, and PCR was used to detect specific nucleotide sequences in the pepper genome (C to T mutation in the 246736279-248221876bp interval of chromosome 6) to identify and screen pepper pollen fertility.

Benefits of technology

Through early molecular marker screening, the breeding cycle can be shortened, the selection efficiency and accuracy can be improved, the workload of later identification can be reduced, and high-quality pepper plants can be quickly screened out.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116200525B_ABST
    Figure CN116200525B_ABST
Patent Text Reader

Abstract

The application provides a pepper cytoplasmic male sterility fertility restoration molecular marker, a typing primer and application thereof, constructs an F2 population by using wild type and mutant pepper materials, obtains a chromosome region closely linked to a pepper cytoplasmic male sterility fertility restoration gene by using a BSA population positioning method, designs a KASP molecular marker according to single base mutation, and genotype of 1290 single plants in the F2 population is identified by using the marker, and the coincidence rate reaches 100%. The application not only contributes to identification and assisted breeding of the pepper cytoplasmic male sterility, but also provides a basis for map-based cloning of the cytoplasmic male sterility fertility restoration gene and analysis of a molecular mechanism of the cytoplasmic male sterility, and has wide popularization value.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of pepper breeding molecular biology, and particularly relates to a pepper cytoplasmic male sterility fertility restoration molecular marker, a typing primer and application thereof. BACKGROUND

[0002] Plant male sterility is a common phenomenon in flowering plants, which refers to the abnormal development of stamens or the inability to produce normal functional pollen in the process of sexual reproduction, but the pistil develops normally and functions normally. It is generally divided into cytoplasmic male sterility and cytoplasmic male sterility. Plant cytoplasmic male sterility, also known as nuclear-cytoplasmic interaction sterility, is caused by the joint regulation of nuclear genes ( rfrf ) and cytoplasmic genes ( S ) to cause pollen abortion and sterility. Male sterility can be used in hybrid vigor production of crops. The use of hybrid vigor can greatly improve the yield and quality of crops and promote the development of agricultural production. Male sterility technology is used in hybrid seed production of important crops such as rice, wheat, corn, rapeseed, pepper and tomato. Three-line hybrid breeding based on cytoplasmic male sterility is the most widely used method for utilizing crop heterosis, which includes sterile lines, maintainer lines and restorer lines. Sterile lines have cytoplasmic sterile genes ( S ) and nuclear genes ( rfrf ), which are used as female parents to cross with maintainer lines and restorer lines. Maintainer lines have normal fertile cytoplasmic genes ( N ) and contain the same nuclear genes ( rfrf ) as sterile lines, which exhibit normal fertility and can be used as male parents to cross with sterile lines to propagate sterile lines. Restorer lines have nuclear restorer genes ( RfRf ), which can restore the male fertility of the offspring when crossed with sterile lines, and are used to produce commodity hybrid seeds. The use of cytoplasmic male sterility technology to breed three-line hybrid varieties for hybrid seed production can significantly reduce production costs, simplify the seed production process, and improve seed purity. Rf Genes have been successfully cloned in crops such as rice, corn, radish and sugar beet.

[0003] Pepper ( Capsicum annuumL. ) is an annual or perennial herb, originally from South America, its fruit is bright in color, rich in nutrition, spicy in taste, strong in resistance, and widely planted, which is an important vegetable crop in the world. Capsicum is a common cross-pollinated crop, which has strong heterosis, and the use of hybridization advantage can greatly improve the yield, resistance and quality of capsicum. More than 90% of the varieties applied in China are one-generation hybrids, and the three-line method is currently one of the main methods for producing capsicum hybrid seeds. Genetic mapping of the fertility restoration gene of pepper cytoplasmic male sterility and revealing the molecular mechanism of fertility restoration can accelerate the application of pepper three-line matching method in the production of hybrid seeds, and has important theoretical guiding significance for pepper molecular breeding. Therefore, it is of great significance to develop a molecular marker related to the fertility restoration of pepper cytoplasmic male sterility, to screen satisfactory plants by using the molecular marker, and to study the molecular mechanism of the formation of pepper cytoplasmic male sterility. SUMMARY

[0004] In order to overcome the defects in the prior art, in view of the pollen abortion phenomenon in anther development of capsicum, the present application provides a molecular marker for fertility restoration of pepper cytoplasmic male sterility, a typing primer and an application thereof, which provides a new way for screening and identifying pepper cytoplasmic male sterile mutants and directional hybrid breeding of pepper three-line matching.

[0005] To solve the above technical problems, the technical scheme provided by the present application is:

[0006] The first aspect of the present application provides a molecular marker for fertility restoration of pepper cytoplasmic male sterility, the molecular marker is a nucleotide sequence on the genome of capsicum, the molecular marker is significantly related to the shape of fertility restoration of pepper cytoplasmic male sterility, the nucleotide sequence takes the genome of capsicum as a reference gene, which contains a base sequence located in the interval of 246736279-248221876bp on chromosome 6, which is a C to T mutation at position 247327150 on chromosome 6.

[0007] As an optional implementation manner, the molecular marker is obtained by screening a phenotype-stable male sterile mutant material after EMS mutagenesis.

[0008] As a general technical concept, the second aspect of the present application provides a KASP typing primer of the above-mentioned molecular marker for identification, screening or application, the primer sequence of the KASP typing primer is:

[0009] Forward primer 6X: CAACAGTGGGGCAACCAATAC (SEQ ID No. 1).

[0010] Forward primer 6Y: CAACAGTGGGGCAACCAATAT (SEQ ID No. 2).

[0011] Reverse primer 6C: GTTTGAGTTGGAGGCCATTT (SEQ ID No. 3).

[0012] As an optional implementation, the KASP typing primer provided by the application is characterized in that the forward primer 6X and 6Y are connected with different fluorescent linker sequences, and the fluorescent linker sequences are selected from one of FAM, HEX, FITC, RED, TET, JOE and R110.

[0013] As an optional implementation, the KASP typing primer provided by the application is characterized in that the fluorescent linker sequences connected by the forward primer 6X and 6Y are FAM and HEX, and the sequences are as follows:

[0014] Forward primer PEPER-CMS-6X:

[0015] GAAGGTGACCAAGTTCATGCTCAACAGTGGGGCAACCAATAC (SEQ ID No. 4).

[0016] Forward primer PEPER-CMS-6Y:

[0017] GAAGGTCGGAGTCAACGGATTCAACAGTGGGGCAACCAATAT (SEQ ID No. 5).

[0018] In the application, the selected fluorescent linker sequences are FAM and HEX, wherein the forward primer PEPER-CMS-6X is connected with FAM, and the forward primer PEPER-CMS-6Y is connected with HEX.

[0019] As a general technical concept, the third aspect of the application provides an application of the above-mentioned molecular marker or KASP typing primer, and the application includes at least one of the following applications:

[0020] (1) identifying and assisting in screening pepper fertility;

[0021] (2) identifying, screening or breeding of pepper cytoplasmic male sterile mutants.

[0022] As an optional implementation, the application provided in the application is detected by using a PCR reaction.

[0023] As an optional implementation, in the application provided by the present application, the identification or screening is carried out by PCR detection, specifically, genomic DNA of a sample to be detected is used as a template, and amplification primers of molecular markers are used for amplification, and then fluorescence detection is carried out on the amplification primers, wherein the amplification system is as follows: 50-100 ng of template DNA, 0.15 ul of primer, 5 ul of 2X PARMS mastermix, and ddH2O is supplemented to 10 ul.

[0024] As an optional implementation, in the application provided by the present application, when the fluorescence signal corresponding to the primer PEPER-CMS-6X is detected in the fluorescence detection of the amplification product, the detection site is C:C genotype, and it is determined that the single plant is a pepper pollen fertile phenotype; when the fluorescence signal corresponding to the primer PEPER-CMS-6Y is detected, the detection site is T:T genotype, and it is determined that the single plant is a pepper pollen sterile phenotype; if both fluorescence signals are detected, the detection site is T:C genotype, and it is determined that the single plant is a pepper pollen fertile phenotype.

[0025] As an optional implementation, in the application provided by the present application, Touchdown PCR is used; the Touchdown PCR amplification program is as follows: 94℃ 15min; 95℃ 20s; 65℃-56℃ 60s, 10 cycles, and the annealing and extension temperature is reduced by 0.8℃ in each cycle; 94℃ 20s; 57℃ 60s, 30 cycles.

[0026] Compared with the prior art, the present application has the following beneficial effects:

[0027] (1) The present application locates a new gene for controlling pepper cytoplasmic male sterility by using the BSA positioning method, and develops a KASP molecular marker associated with the pepper cytoplasmic male sterility (CMS) fertility restoration gene according to the mutation site of the gene. The KASP molecular marker can be directly used for identification of pepper pollen fertility and the corresponding genotype, and then assisted breeding is carried out by relying on the molecular marker, so that the problems of long breeding cycle, easy to be affected by the environment and the like can be effectively solved. By using the molecular marker early, satisfactory plants can be quickly screened, the planting scale is effectively reduced, the workload of later identification is reduced, and the selection efficiency and accuracy are improved.

[0028] (2) The patent is helpful to shorten the transgenic period of the restoring line by developing the molecular marker linked to the fertility restorer gene of the cytoplasmic male sterility of pepper, and the gene controlling the fertility restoration of pepper and other excellent trait genes are introduced into the plant by hybridization and backcrossing, thereby providing gene resources for breeding new varieties with high quality. The development of the molecular marker linked to the fertility restorer gene of the cytoplasmic male sterility is beneficial to the directional breeding of the cytoplasmic male sterile line of pepper, and lays a foundation for cloning the fertility restorer gene of pepper and studying the molecular mechanism of the cytoplasmic male sterility of pepper, which has great significance for studying the molecular mechanism of the formation of the cytoplasmic male sterility of pepper. BRIEF DESCRIPTION OF DRAWINGS

[0029] Figure 1 The phenotypic diagram of the whole plant, stem and anther of two parents of BSA positioning in Example 1;

[0030] Figure 2 The diagram of part of the results of genotyping in the F2 population constructed by wild type (WT) and mutant (MT) by using the molecular marker in Example 3;

[0031] Figure 3 The diagram of the chromosome region results of fine mapping of the fertility restorer gene of pepper in Example 1. DETAILED DESCRIPTION

[0032] In order to facilitate the understanding of the present application, the present application will be described in more detail below in combination with the drawings of the specification and the preferred embodiments, but the protection scope of the present application is not limited to the following specific embodiments.

[0033] Unless otherwise defined, all the professional terms used in the following have the same meaning as understood by those skilled in the art. The professional terms used in the present application are only for the purpose of describing the specific embodiments, and are not intended to limit the protection scope of the present application.

[0034] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or can be prepared by the existing method.

[0035] Example 1

[0036] The molecular marker linked to the fertility restorer gene of the cytoplasmic male sterility of pepper is obtained by using the BSA (Bulked segregation analysis, bulked segregation analysis) positioning method.

[0037] 1. Construction of population

[0038] The backbone pepper parent 'ST-8' and the cytoplasmic male sterile material 'CMS20A' selected by multiple generations of self-crossing are used as the materials, and the fertility restorer gene of the cytoplasmic male sterility of pepper is obtained by using the BSA (Bulked segregation analysis, bulked segregation analysis) positioning method. Figure 1The male sterile phenotype of 'CMS20A' is genetically stable and not affected by the environment, and is of the complete sterile type. The fertile parent 'ST-8' parent was crossed with the sterile parent 'CMS20A' to obtain the F1 generation, and the F1 generation was selfed to obtain the F2 population.

[0039] 2. Pollen fertility identification

[0040] At the full-bloom stage of the F2 population, the presence or absence of pollen grains in mature anthers was observed and identified to determine the fertility of individual plants in the population.

[0041] 3. Initial positioning of cytoplasmic male sterility fertility restoration gene

[0042] In the F2 population of ST-8 x CMS20A, 25 fertile plant leaves and 25 sterile plant leaves were selected, and each plant leaf was mixed in equal amounts to construct a fertile / sterile DNA pool. The 'CMS20A' plant leaves were taken as the parent pool, and the total DNA of the three pools was extracted using the CTAB (cetyltrimethylammonium bromide) method. The three pool DNAs were library constructed using the TruSeq DNA LT SamplePrep Kit (Illumina), sequenced by the Illumina Novaseq PE150 platform, and subjected to genome sequencing. After strict quality control, the reads were aligned to the pepper reference genome using the bwa software, and the SNP sites in the whole genome were found using the SAMtools software. Analysis found that the sequencing depths of the fertile pool and the sterile pool were 18.48x and 20.99x, respectively, both covering more than 99% of the whole genome. Screening for base quality values greater than or equal to 30, mapping quality values greater than or equal to 30, base depth greater than or equal to 2 and less than or equal to 80 in both F2 pools, and greater than or equal to 2 and less than or equal to 40 in both parents, a total of 634,273 differential SNPs were finally obtained. The maximum allele frequency (SNP-index) of the sterile pool and the corresponding ΔSNP-index value were calculated, and a window of 2 Mb and a step of 200 kb were plotted. Since the SNPs associated with the target trait are linked to the surrounding SNPs on the chromosome, the candidate interval ΔSNP-index is above 0.5 or close to 1, while the ΔSNP-index in the genomic region without trait association is randomly distributed around 0.5. By observing the ΔSNP-index value distribution, it was found that there was a clear peak region on the whole genome, with a ΔSNP-index value above 0.5 and close to 1, located between 240.1 and 253.0M on chromosome 6, i.e. the fertility restoration gene regulating cytoplasmic male sterility is located in this region.

[0043] 4. Fine mapping of fertility restorer gene

[0044] The chromosome region regulating fertility restoration of cytoplasmic male sterility of pepper obtained by step 3, in order to further narrow the candidate region of the fertility restoration regulating gene, analyze the DNA sequence variation in the segment, develop KASP (Competitive Allele-Specific PCR) markers, genotype the single plants of the F2 population using the developed KSAP molecular markers, and determine the crossover single plants. Based on the phenotypic investigation data of the fertility of the plants and the genotypes of the determined crossover single plants, the fertility restoration gene is located in the interval of 246736279-248221876 bp of chromosome 6, as shown in Figure 3 Finally, the mutation of C to T at position 247327150 on chromosome 6 of the whole genome of pepper is obtained by sequencing.

[0045] Example 2

[0046] According to the molecular markers obtained in Example 1, primers are designed, including two forward primers and one reverse primer, in which the two forward primers are connected with fluorescence linker sequences FAM and HEX, respectively, and the specific information is as follows:

[0047] Forward primer PEPER-CMS-6X:

[0048] GAAGGTGACCAAGTTCATGCTCAACAGTGGGGCAACCAATAC (SEQ ID No. 4).

[0049] Forward primer PEPER-CMS-6Y:

[0050] GAAGGTCGGAGTCAACGGATTCAACAGTGGGGCAACCAATAT (SEQ ID No. 5).

[0051] Reverse primer PEPER-CMS-6C: GTTTGAGTTGGAGGCCATTT (SEQ ID No. 3).

[0052] Using the above primers, Touchdown PCR is used, and the reaction system is shown in Table 1:

[0053] Table 1: PCR reaction system

[0054]

[0055] The amplification program is: 94℃ 15min; 95℃ 20s; 65℃-56℃ 60s, 10 cycles, with a decrease of 0.8℃ in annealing and extension temperature for each cycle; 94℃ 20s; 57℃ 60s, 30 cycles.

[0056] When the amplification product is detected by fluorescence,

[0057] If the sample PCR product only detects the fluorescence signal (FAM) corresponding to primer PEPER-CMS-6X, the detection site is C:C genotype, and it is determined as a single plant of pepper pollen fertile phenotype; if the sample PCR product only detects the fluorescence signal (HEX) corresponding to primer PEPER-CMS-6Y, the detection site is T:T genotype, and it is determined as a single plant of pepper pollen sterile phenotype; if both fluorescence signals are detected, the detection site is T:C genotype, and it is determined as a single plant of pepper pollen fertile phenotype.

[0058] Example 3

[0059] The molecular marker (C to T mutation at position 247327150 on chromosome 6 of pepper genome) is recorded as PEPER-CMS-6. Using PEPER-CMS-6 marker, the leaves of 1290 single plants selected from the F2 population constructed by ST-8 and CMS20A were genotyped, and three fluorescence signals appeared, among which 323 single plants had C:C fluorescence signal, 662 single plants had C:T fluorescence signal, and 305 single plants had T:T fluorescence signal. Combined with the phenotype investigation data, it was found that the genotype was highly consistent with the plant fertility phenotype, and the coincidence rate reached 100%. The fertility type and genotype detection results of part of the single plants in the F2 population are shown in Table 2 below. The above results fully demonstrate that the PEPER-CMS-6 marker has universality and accuracy, and can be applied to the prediction, identification and screening of pepper plant fertility.

[0060] Table 2: Fertility type and genotype of part of the single plants in the F2 population

[0061]

[0062] The above identification results show that, in breeding, by molecular marker identification and screening, retaining the material that detects the C fluorescence signal corresponding to primer PEPER-CMS-6, the pepper cytoplasmic sterile material can be selected and bred. Retaining the material that detects the A fluorescence signal corresponding to primer PEPER-CMS-6, the fertile homozygous material can be selected and bred. Retaining the material that detects the B fluorescence signal (including the fluorescence signals corresponding to the above two primer pairs), the fertile heterozygous material can be selected and bred, and the results are shown in Figure 2 By the previous molecular marker screening, the workload of later screening and identification can be reduced, and the breeding process can be accelerated.

[0063] The above is further detailed description of the present application in combination with specific preferred embodiments, and cannot be deemed as limitation of the specific implementation of the present application to these descriptions. For those skilled in the art to which the present application belongs, several simple deductions or replacements can be made without departing from the concept of the present application, and all of them shall be deemed as falling within the protection scope of the present application.

Claims

1. A molecular marker for restoring fertility of pepper cytoplasmic male sterility, characterized in that: The molecular marker is obtained by amplification of KASP typing primers, and the sequence of the KASP typing primers is: Forward primer PEPER-CMS-6X: GAAGGTGACCAAGTTCATGCTCAACAGTGGGGCAACCAATAC; Forward primer PEPER-CMS-6Y: GAAGGTCGGAGTCAACGGATTCAACAGTGGGGCAACCAATAT; Reverse primer PEPER- CMS-6C: GTTTGAGTTGGAGGCCATTT; The two forward primers PEPER-CMS-6X and PEPER-CMS-6Y are linked to the fluorescent groups FAM and HEX, respectively. When the amplified products are subjected to fluorescence detection, if the fluorescent signal corresponding to the primer PEPER-CMS-6X is detected, the detection site is the C:C genotype, and the plant is determined to have a fertile pepper pollen phenotype; if the fluorescent signal corresponding to the primer PEPER-CMS-6Y is detected, the detection site is the T:T genotype, and the plant is determined to have a sterile pepper pollen phenotype; if both fluorescent signals are detected at the same time, the detection site is the T:C genotype, and the plant is determined to have a fertile pepper pollen phenotype.

2. A KASP typing primer for identifying, screening or applying the molecular marker according to claim 1, characterized in that: The primer sequences of the KASP typing primers are: Forward primer PEPER-CMS-6X: GAAGGTGACCAAGTTCATGCTCAACAGTGGGGCAACCAATAC; Forward primer PEPER-CMS-6Y: GAAGGTCGGAGTCAACGGATTCAACAGTGGGGCAACCAATAT; The reverse primer PEPER-CMS-6C: GTTTGAGTTGGAGGCCATTT; the two forward primers PEPER-CMS-6X and PEPER-CMS-6Y were linked to the fluorescent groups FAM and HEX, respectively.

3. The use of the molecular marker according to claim 1 or the KASP typing primer according to claim 2, characterized in that: The application includes identification and auxiliary screening of pepper fertility, or identification, screening or breeding of pepper cytoplasmic male sterile mutants.

4. The use according to claim 3, characterized in that Identification or screening is performed through PCR detection. Specifically, the genomic DNA of the sample to be tested is used as a template, amplification is performed using molecularly labeled amplification primers, and then the amplification primers are fluorescently detected. The amplification system is: 50-100ng of template DNA, 0.15ul of each primer, 5ul of 2X PARMS master mix, and ddH2O is added to 10ul.

5. The use of the molecular marker according to claim 4, characterized in that When the amplified product is subjected to fluorescence detection, if the fluorescence signal corresponding to the primer PEPER-CMS-6X is detected, the detection site is a C:C genotype, and the plant is determined to have a fertile pepper pollen phenotype; if the fluorescence signal corresponding to the primer PEPER-CMS-6Y is detected, the detection site is a T:T genotype, and the plant is determined to have a sterile pepper pollen phenotype; if both fluorescence signals are detected at the same time, the detection site is a T:C genotype, and the plant is determined to have a fertile pepper pollen phenotype.

6. The use of the molecular marker according to claim 4, characterized in that Touchdown PCR was used; the touchdown PCR amplification program was as follows: 94°C for 15 min; 95°C for 20 s; 65°C-56°C for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8°C in each cycle; 94°C for 20 s; 57°C for 60 s, 30 cycles.

Citation Information

Patent Citations

  • KASP molecular marker for authenticating chili CMS (cytoplasmic male sterility) restoring genes, kit and application of kit

    CN109913575A

  • DNA fragment specific to cytoplasmic male sterile pepper and use thereof

    WO2004099416A1